ID: 948802614

View in Genome Browser
Species Human (GRCh38)
Location 2:240439735-240439757
Sequence CTGGTGAGGGGCTGTGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 546
Summary {0: 1, 1: 0, 2: 1, 3: 50, 4: 494}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948802614_948802627 24 Left 948802614 2:240439735-240439757 CCTGGCACACAGCCCCTCACCAG 0: 1
1: 0
2: 1
3: 50
4: 494
Right 948802627 2:240439782-240439804 CCTGTCCAGGTGGCTCAGCGTGG 0: 1
1: 0
2: 1
3: 17
4: 204
948802614_948802623 14 Left 948802614 2:240439735-240439757 CCTGGCACACAGCCCCTCACCAG 0: 1
1: 0
2: 1
3: 50
4: 494
Right 948802623 2:240439772-240439794 TGTGCCCTGTCCTGTCCAGGTGG 0: 1
1: 0
2: 1
3: 19
4: 235
948802614_948802621 11 Left 948802614 2:240439735-240439757 CCTGGCACACAGCCCCTCACCAG 0: 1
1: 0
2: 1
3: 50
4: 494
Right 948802621 2:240439769-240439791 CCCTGTGCCCTGTCCTGTCCAGG 0: 1
1: 0
2: 5
3: 101
4: 468

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948802614 Original CRISPR CTGGTGAGGGGCTGTGTGCC AGG (reversed) Intronic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
900595952 1:3480265-3480287 CTGAGCAGGGGCTGGGTGCCCGG + Intronic
900659627 1:3776123-3776145 CCTTTGAAGGGCTGTGTGCCAGG - Intergenic
901207914 1:7507888-7507910 CTGGAGAGCTGCGGTGTGCCAGG - Intronic
901530891 1:9851862-9851884 CCAGGGAGGGGCTGTGGGCCAGG + Intronic
902384176 1:16067121-16067143 CTGGGGAGGGGGTGGGAGCCAGG - Intronic
902389069 1:16092297-16092319 GTGGGTGGGGGCTGTGTGCCTGG - Intergenic
902696529 1:18144224-18144246 CTGGGAAGGGGCTGTGGGCCAGG - Intronic
902840526 1:19071186-19071208 CTGGAGAGGGTCTGGGAGCCTGG + Intergenic
902884596 1:19395703-19395725 CAGGTGATGGGTTGTGTGCCTGG - Intronic
903144553 1:21362571-21362593 CTGCTGAGGGGCTGTGGGTGGGG + Intergenic
903536157 1:24067737-24067759 CAGGTGTGGGGCACTGTGCCTGG + Intronic
903576294 1:24341644-24341666 GTGGAGAGGGGCTGTGTCTCTGG + Intronic
903674914 1:25057523-25057545 CAGGTGAGGGGCTGGGGGCGTGG - Intergenic
903733897 1:25517740-25517762 AGGGAGAGGGGCTGTGTGCACGG + Intergenic
903806027 1:26006142-26006164 GTGGTGAGGGGCAGTGGGCAAGG + Intergenic
903999499 1:27330928-27330950 CTGGTGAGGGGCAGAGGGCCAGG - Intronic
904604858 1:31692695-31692717 CTGGGGAGGGACTGTGCGCTTGG - Intronic
904958187 1:34306391-34306413 CTGGTGGGGGTCTGCCTGCCTGG - Intergenic
905142116 1:35855708-35855730 TTGGTGAGGGGCTGGCTGCTTGG + Exonic
905655234 1:39682510-39682532 CTGGTGAGGGGCAGGGTCCCTGG - Exonic
905717138 1:40161634-40161656 CAGGTGAGGGGCTGACTGGCTGG + Exonic
907276019 1:53317036-53317058 CAGAGGAGGGGCTGTGTACCAGG - Intronic
907280547 1:53344309-53344331 CTGGTGAGGGGCTGGGTGAAGGG - Intergenic
907489011 1:54796968-54796990 GTGGTGAAGTGCTGTGGGCCAGG + Intronic
909294075 1:73923458-73923480 CTGGTGAGGGGCTGTTTTCGTGG - Intergenic
909630008 1:77761087-77761109 CAGGTGTGAGGCTCTGTGCCCGG - Intergenic
910496935 1:87840398-87840420 CTGGTGAGGAGCTCATTGCCTGG + Intergenic
911092724 1:94030597-94030619 CTGGATAGCTGCTGTGTGCCAGG + Intronic
912558300 1:110531925-110531947 CTGGGCAGTGGCAGTGTGCCAGG - Intergenic
912999441 1:114564879-114564901 TTGGTGAAGGGCTGTCTGTCAGG - Intergenic
913686623 1:121238152-121238174 GTGGTGAGTGGCTGCCTGCCAGG + Intronic
914038477 1:144025792-144025814 GTGGTGAGTGGCTGCCTGCCAGG + Intergenic
914150978 1:145042116-145042138 GTGGTGAGTGGCTGCCTGCCAGG - Intronic
915071970 1:153277338-153277360 CTGGTGAGGGGCTCTCTTTCTGG - Intergenic
915269511 1:154743513-154743535 CAGGTGAGGGGCTCTGAGGCAGG - Intronic
916076215 1:161201328-161201350 CTGCTGGTGGGCTGTGTCCCTGG + Intronic
916827625 1:168457700-168457722 GTGGTGTGGGGCTGTGGGGCTGG + Intergenic
917296606 1:173526115-173526137 CTCATGGGGGGCTGTGGGCCAGG - Intronic
918257641 1:182764128-182764150 CTGGTGAAGGACTATGTGACTGG - Intergenic
918621016 1:186605999-186606021 CAGATGGGGGGCTGTGTGGCAGG + Intergenic
919748941 1:201024700-201024722 CTGGTGAGGGGCCCTGTGAATGG - Intergenic
919829890 1:201532914-201532936 CTGGTGAGAGGGTGGGTGCTAGG - Intergenic
920473949 1:206256710-206256732 GTGGTGAGTGGCTGCCTGCCAGG + Intronic
921135419 1:212255244-212255266 CTGGTAAGGGGCTGTTACCCAGG + Intergenic
921850419 1:219927947-219927969 CTGGCGGAGGGCTGTGTCCCCGG - Exonic
922218373 1:223539213-223539235 CTGCGGATGGGCTGTCTGCCTGG + Intronic
922749972 1:228065719-228065741 CTGGTGAGAGGCTATCTGCAGGG - Intergenic
923025506 1:230200685-230200707 TTGGTGTGGGCCTGTGTGCAAGG - Intronic
924567712 1:245212057-245212079 GTGGGGAGGGGCAGTGTCCCTGG - Intronic
1063152248 10:3347387-3347409 GTGGTGGGTTGCTGTGTGCCAGG - Intergenic
1063429471 10:5976898-5976920 GTGGGGAGGAGCTGTGTCCCAGG - Intronic
1063456392 10:6185585-6185607 TGGGTGAGGGCCTGAGTGCCAGG - Intronic
1063787918 10:9407084-9407106 CTGCTGAGGCGCTCTGTGTCTGG - Intergenic
1066116228 10:32242829-32242851 CTCGTGAGTGGCTGTGGGCTGGG + Intergenic
1066973625 10:42342661-42342683 CAGGTGTGAGGCAGTGTGCCCGG - Intergenic
1068045843 10:51885237-51885259 CTTGTGAGTGGTTATGTGCCTGG - Intronic
1069493845 10:68885162-68885184 CTGGGGATGGGCTGTGTAGCAGG - Exonic
1069535602 10:69250425-69250447 CTGGTGAGGAGGTAAGTGCCAGG + Exonic
1071443276 10:85723221-85723243 CGAGTGATGGCCTGTGTGCCTGG - Intronic
1072508442 10:96093532-96093554 CTGGTGAGGGGCATTCTTCCTGG + Intergenic
1072806169 10:98425150-98425172 CTGCAGCGGGGCTGTGTCCCCGG - Intronic
1073180545 10:101580436-101580458 CAGGTGAGGGGCTGTGCGTGGGG + Intronic
1073453087 10:103621048-103621070 ATTGTGAGTGGCTGTGTGCCTGG + Intronic
1074111698 10:110427303-110427325 CTGGGGAGGGGCTGAGACCCTGG - Intergenic
1074427717 10:113367033-113367055 CTGGTGAGGACCTGTGTTCTGGG + Intergenic
1074433723 10:113416014-113416036 CTGGTGAGCTCCTTTGTGCCTGG - Intergenic
1075047718 10:119159364-119159386 CAGGTGAGGGGCTGTGTCAGAGG + Intronic
1076132831 10:128025774-128025796 CTGGGGAGGGGCTGCTTCCCTGG - Intronic
1076266667 10:129114100-129114122 CTGGTGAGGGCTTCAGTGCCAGG + Intergenic
1076549946 10:131271778-131271800 CTGGTGAGGGTCCCTGTGACCGG + Intronic
1076570832 10:131431952-131431974 CTAGAGAAGGGCTGTGTGCTGGG + Intergenic
1076995624 11:296253-296275 GTGGAGAGGGGCTGTGGGTCAGG + Intergenic
1076995645 11:296334-296356 GTGGAGAGGGGCTGTGGGTCAGG + Intergenic
1077110489 11:860007-860029 CTGGGGAGGGGCTCTGGGCGTGG + Intronic
1077243917 11:1526749-1526771 CTGGTGGGTAGCTGTGTGGCGGG - Intergenic
1077282256 11:1751077-1751099 CTGGGCAGAGGCTGTGTGGCAGG - Intronic
1077366701 11:2164144-2164166 CTGGTGAGGGGCTGGGTCCCGGG - Exonic
1079139974 11:17802114-17802136 CAGGAGAGGAGCTCTGTGCCTGG - Intronic
1081534096 11:43984922-43984944 CTGGGCAGGGGCAGTATGCCAGG + Intergenic
1081670356 11:44938998-44939020 CTGGTGGGGGGCTGATGGCCGGG - Intronic
1082177482 11:49077992-49078014 CAGGTGTGAGGCTCTGTGCCTGG + Intergenic
1083278444 11:61610898-61610920 CTGGTTGCGGGCTGTCTGCCTGG - Intergenic
1083580058 11:63818980-63819002 CTGGAGAGGGGCTCTCCGCCCGG - Exonic
1084174654 11:67417028-67417050 CTGAGAAGTGGCTGTGTGCCAGG + Intronic
1084188529 11:67488329-67488351 CTGGACAGGGGCTGACTGCCGGG - Intronic
1084945128 11:72634234-72634256 CTGGGGAGGGGCTCCCTGCCGGG + Intronic
1084970788 11:72770989-72771011 ATGGTGTGTGGCTCTGTGCCAGG + Intronic
1085118132 11:73948556-73948578 CTGATGTGGTGGTGTGTGCCTGG + Intergenic
1086902367 11:92382434-92382456 CTGCTGAGGCGCTGTCTCCCAGG + Intronic
1088322426 11:108567898-108567920 CAGGTAAGCTGCTGTGTGCCAGG - Intronic
1088978281 11:114835221-114835243 CTGGTGAGGGACTGCTTTCCTGG + Intergenic
1089754579 11:120677150-120677172 CTGGGAAGGGGCTGTGTAACAGG + Intronic
1090404685 11:126469585-126469607 CAGGCACGGGGCTGTGTGCCGGG - Intronic
1092282349 12:7108072-7108094 CTGGTGGGAGGCTGTGTCCTGGG + Intronic
1093966070 12:25327621-25327643 CAGGTGTGAGGCTCTGTGCCTGG - Intergenic
1095472324 12:42550153-42550175 TGGGTGAGCTGCTGTGTGCCAGG - Intronic
1096578891 12:52571821-52571843 CTGGTGAGGGGGCTGGTGCCTGG - Intronic
1096781986 12:53996878-53996900 CTGGGAAGGGGCTGTGGGCGAGG + Intronic
1097188041 12:57206057-57206079 ATGGTGGGGGTGTGTGTGCCAGG - Intronic
1098783655 12:74721955-74721977 CTGGTGAGGGGATGTTTGATTGG - Intergenic
1098908932 12:76189569-76189591 CAGGTGAGAGGCACTGTGCCCGG + Intergenic
1099168452 12:79336228-79336250 CTGGAGAGGGACTATGTGGCAGG - Intronic
1100645274 12:96522886-96522908 GTTGGGAGGGGCTGTGTGACTGG - Intronic
1101244703 12:102874588-102874610 TTGAGCAGGGGCTGTGTGCCAGG - Intronic
1101492664 12:105223558-105223580 GTGGAGAGAGGCTGTGAGCCAGG + Intronic
1102096056 12:110242308-110242330 CAGGTGAGAGCCAGTGTGCCCGG - Intergenic
1102191959 12:110995353-110995375 CAGGAGAGGGGCTGGGTGCAGGG + Intergenic
1102494007 12:113306710-113306732 CTGGTGGGGTGCTGTGTGAGGGG + Intronic
1103212096 12:119174678-119174700 CTGGGGAGGGGCTGGGGGCTGGG + Intergenic
1103703592 12:122860075-122860097 AAGGTGAGGGGCTGTGACCCGGG + Exonic
1103915283 12:124372768-124372790 CTGGTCAGGGGCTTTGTCTCAGG - Intronic
1104049401 12:125185990-125186012 CTGGAGAGGTGGTGTCTGCCGGG - Intergenic
1104715409 12:131012973-131012995 TTGGTGACCTGCTGTGTGCCAGG + Intronic
1104848174 12:131857637-131857659 CTGGGGAGGTGCTGTGTGCTGGG + Intergenic
1104848191 12:131857704-131857726 CTGGGGAGGTGCTGTGTGCTGGG + Intergenic
1104900935 12:132189213-132189235 CCGGTGAGGGGCTGTGCCTCCGG + Intergenic
1104998232 12:132672509-132672531 CCGGTGAGGGGCCGTGGGACAGG + Intronic
1105625748 13:22110961-22110983 CTGGTCAGGGGCAGTGTTTCAGG - Intergenic
1108361588 13:49672916-49672938 CGGGTGTGGTGGTGTGTGCCTGG + Intronic
1108429225 13:50337145-50337167 ATGGTGAGGTGCTGTCTGGCTGG + Intronic
1111091324 13:83452020-83452042 CTGGTGAGGGGCAGAGTGGATGG - Intergenic
1113074169 13:106451744-106451766 CTGGTGAGGTTCTTTGTGCTGGG - Intergenic
1113735409 13:112674914-112674936 CTGGTGAGGCCATGTGAGCCGGG - Intronic
1113785162 13:112998610-112998632 CTGGGGAACGGCTGTGTGTCTGG + Intronic
1113957047 13:114104587-114104609 CTGATGAGAGGCTTTGTGGCCGG - Intronic
1114082947 14:19217700-19217722 CTGCTGTGGGTCTGTGTGCAGGG - Intergenic
1114738116 14:25063826-25063848 CTGGTAAGGGGCTGTTTCCTGGG - Intergenic
1115369109 14:32592191-32592213 CTAGTTATGTGCTGTGTGCCAGG + Intronic
1118000561 14:61519139-61519161 CGGGTGTGGTGATGTGTGCCTGG + Intronic
1118323851 14:64768693-64768715 CGGGGGAGGGGCTGGGGGCCTGG - Intronic
1118689507 14:68324457-68324479 CATGTGCTGGGCTGTGTGCCAGG - Intronic
1118880339 14:69820141-69820163 AGGGTGATGGGCTGTGGGCCAGG + Intergenic
1120791998 14:88592776-88592798 CAGGTGTGGGCCTCTGTGCCAGG + Intronic
1121016456 14:90552227-90552249 CCGGTGAGGGGCTGAGTGAGTGG - Intronic
1121226037 14:92322796-92322818 GTGGGGAGGGGGTGTGTGGCGGG + Intronic
1121454499 14:94029727-94029749 CTGGAGCATGGCTGTGTGCCAGG + Intronic
1121613187 14:95294915-95294937 CTGGTGAGGGGCACTCTGGCTGG - Intronic
1122160626 14:99781527-99781549 CAGGTGAGGTGGTGTGAGCCTGG - Intronic
1122414371 14:101541851-101541873 CTGGGGAGGGGCTGGGGGCCAGG - Intergenic
1122487086 14:102088579-102088601 GTGGTGACCGGGTGTGTGCCTGG + Intronic
1122651546 14:103229548-103229570 CAGGCCAGGGCCTGTGTGCCAGG - Intergenic
1122803936 14:104247377-104247399 GTGGTCCGGGGCTGTGTGCTTGG + Intergenic
1122861408 14:104584246-104584268 CTGGCAAGGGGCTGTGGCCCTGG + Intronic
1122881425 14:104692131-104692153 CTGGGCAGGGTCTGTGTGCTGGG + Intronic
1123000731 14:105292836-105292858 CTGGGGAAGGGGTGTGGGCCTGG - Intronic
1123000740 14:105292855-105292877 CTGGGGAGGGGATGTGGGCCTGG - Intronic
1123061388 14:105596257-105596279 CTGGTGGGCGGCTGTGGGCTGGG + Intergenic
1123085842 14:105717168-105717190 CTGGTGGGCGGCTGTGGGCTGGG + Intergenic
1124238958 15:28014342-28014364 ATGGCCTGGGGCTGTGTGCCCGG - Intronic
1126106646 15:45151200-45151222 CTGGGGAGGGTCTGTGTCCATGG - Exonic
1127758234 15:62113441-62113463 CTGGTGAGAGGCTGTGGGGTAGG - Intergenic
1127900824 15:63339621-63339643 CTGGCGTGGGGCTGTGAGCCAGG + Intronic
1129190972 15:73937446-73937468 CTGGGGAGGAGCTGCGTGCGAGG - Intronic
1129228395 15:74183058-74183080 ATGGTGAGGGGCTGTGGCCTGGG - Intronic
1129316466 15:74748451-74748473 CTGGAGAGGGGCCGTGAGCCTGG + Intergenic
1129363344 15:75038421-75038443 CTGGTGAGGGGAAGTTTACCAGG + Intronic
1129551390 15:76453641-76453663 TTGGTAAGGTGGTGTGTGCCAGG + Intronic
1129872341 15:78948568-78948590 CTGGTGAAGGGCTGAGGTCCTGG - Intronic
1130073454 15:80668536-80668558 CTTGTGAGAGGCTGTCTGGCAGG - Intergenic
1130713641 15:86310473-86310495 CAGGTGAGTGGGTCTGTGCCTGG + Intronic
1130990336 15:88872168-88872190 CTGGTAAGCGGCTGTCTGCATGG - Intronic
1131231792 15:90665308-90665330 GTGGTGAGGAGCGCTGTGCCGGG - Intergenic
1131511815 15:93053355-93053377 CTGCTGCAGGTCTGTGTGCCTGG - Intronic
1131983796 15:98020918-98020940 CCCATGAGGGGCTGTCTGCCTGG - Intergenic
1132387084 15:101408347-101408369 CTGCTGAGGGGCTTTCTTCCTGG - Intronic
1132561065 16:594187-594209 TTGGTCAGGGTGTGTGTGCCCGG + Intronic
1132882999 16:2170602-2170624 CTGATGGGGGGCTGTGTGGAGGG - Exonic
1132883407 16:2172133-2172155 CGGGTGAGGGAGCGTGTGCCAGG + Intronic
1133133585 16:3693713-3693735 CAGGTGTGAGGTTGTGTGCCTGG - Intronic
1133200208 16:4199656-4199678 ATGGGGAGGGGCTGGGTGCCGGG - Intronic
1133301091 16:4783442-4783464 CGGGTGAGAGGCTGTGGGGCGGG - Exonic
1134022927 16:10933866-10933888 CTGGTGACAGGCTATGTGGCAGG + Intronic
1134071842 16:11265126-11265148 GTGGTGATGGGCTGTCTGCAGGG - Intronic
1135758344 16:25116541-25116563 CTGGTCTGGTGCTGTGGGCCAGG - Intronic
1136004420 16:27318833-27318855 GTGGGGAGGGGCTGTGTTCTGGG + Intronic
1136554768 16:31001360-31001382 GTGGCTAGGGGCTGGGTGCCGGG + Intronic
1137404597 16:48179540-48179562 CTGGTGGATGGCTCTGTGCCAGG + Intronic
1137518235 16:49169057-49169079 ATGATGAGGGGCTGAGAGCCAGG - Intergenic
1137722201 16:50633772-50633794 CTGGGGAGGGGCTCTATGTCTGG - Exonic
1138341297 16:56290719-56290741 CTGGAGAGGGGCCGGGTTCCAGG - Intronic
1138385316 16:56632429-56632451 CGCGGGAGGGGCTGTGCGCCGGG - Exonic
1138385889 16:56635520-56635542 CGCGTGAGGGGCTGTGCGCCCGG - Intergenic
1138559053 16:57789140-57789162 GAGATGCGGGGCTGTGTGCCTGG - Intronic
1139324459 16:66141357-66141379 GTGGGGAGAGGCTCTGTGCCTGG - Intergenic
1139515278 16:67449101-67449123 CTGGTAAGAGGCTTTGTCCCAGG - Intronic
1140355139 16:74298730-74298752 CAGGTGTGGTGGTGTGTGCCTGG + Intronic
1140661350 16:77193467-77193489 GTGGTGATGGGCTGGGTGGCTGG - Exonic
1141485885 16:84339995-84340017 GTGGCGAGGGGCTGTGGCCCTGG + Intergenic
1141493318 16:84389677-84389699 CTGGTGCTGGGCTCTGTGCTGGG + Intronic
1141601239 16:85127634-85127656 CTGATGACTGCCTGTGTGCCTGG + Intergenic
1141664729 16:85460115-85460137 CTGGTCAAGGGATGTGGGCCAGG - Intergenic
1141697782 16:85628289-85628311 CTCCTGAGGAGCTGTGAGCCTGG - Intronic
1141735767 16:85851564-85851586 GTGGTGATGGGGTGTGTGCAAGG - Intergenic
1141803304 16:86325129-86325151 CTGGTCATGGCCTGTGAGCCAGG + Intergenic
1142096106 16:88240823-88240845 CTGGGGAGGGGAAGTGGGCCGGG - Intergenic
1142196191 16:88740370-88740392 CTGGGAAGGGGCTGGGTGGCTGG - Intronic
1142201422 16:88762796-88762818 CTGGTCAGGGCTTGTGTGCAGGG - Intronic
1142210960 16:88808262-88808284 CTGAGGAGGGGCTGTGAGCCTGG + Exonic
1142276417 16:89121172-89121194 CCTGGGAGGAGCTGTGTGCCCGG - Intronic
1142352572 16:89586867-89586889 CTGGGGAGGGGCTGAGAGACGGG + Intronic
1142498954 17:321670-321692 CGGGGCAGGTGCTGTGTGCCGGG + Intronic
1142609147 17:1098702-1098724 CAAGTGAGGGGCAGTGTGGCAGG - Intronic
1143030731 17:3965518-3965540 CGGGTGAGGGGCTGTGTTGTTGG - Intergenic
1143465227 17:7132030-7132052 CTGGGGAGGGCCTGTGGGCGAGG + Intergenic
1143501758 17:7343415-7343437 CTGGCGGGGGGCTGAGAGCCTGG + Exonic
1143732975 17:8891492-8891514 CTGGGAGGGGACTGTGTGCCTGG + Intronic
1143742633 17:8965608-8965630 CTGGAGAGGGGCTCGGCGCCCGG - Exonic
1143768121 17:9150859-9150881 CTGGGGAGGGGCCGGGTGCCCGG + Intronic
1144454662 17:15408927-15408949 TTGGTGAGGTGCTGGGTGCCGGG + Intergenic
1144735544 17:17553440-17553462 CTGGTAAGGGCCTGTGTGTGTGG - Intronic
1144954599 17:19012710-19012732 CTGTTGAGAGGCTGAGTGGCTGG + Intronic
1147133478 17:38422002-38422024 CTGGGCAGGGGCTGGGAGCCTGG + Intergenic
1147170657 17:38616967-38616989 CTGTTCTGGGGCTGTGTGGCTGG - Intergenic
1147657493 17:42098955-42098977 CGGAGGAGGGGCTGTGTGGCAGG - Intergenic
1147716879 17:42514458-42514480 CTGGTGAGGGGCAGTGGGGCAGG + Exonic
1148129866 17:45256229-45256251 CCGGTGAGGGGGTGTGTGTGTGG + Intronic
1148136125 17:45293047-45293069 CTGGGGAGGCACTGTGTGCAGGG - Intronic
1148166925 17:45490398-45490420 CTGGTGAGGGGATGCGGGCGCGG + Intronic
1148196516 17:45717145-45717167 GTGGGGTGGGGCTGTGTGTCTGG - Intergenic
1148232351 17:45944395-45944417 CTTGTGAGTGGATGGGTGCCTGG - Intronic
1148441209 17:47712477-47712499 CAGGGGAGGGGCTGGGTTCCAGG + Intergenic
1148466161 17:47866439-47866461 CTGGGAAGGGGCTGGGAGCCAGG + Intergenic
1148547145 17:48527362-48527384 CTAGTGGGGGGCAGTGTGCCGGG - Intergenic
1149605714 17:57923706-57923728 CTGGTGGGGCGCTGGGTGGCAGG + Intronic
1150218956 17:63485078-63485100 CAGGGGAGGGGCAGGGTGCCAGG + Intronic
1150398104 17:64836802-64836824 CTGGTGAGGGGATGCGGGCGCGG + Intergenic
1151182487 17:72339383-72339405 CTGGGGAGGGGCTGTGAGGTTGG - Intergenic
1151484611 17:74390736-74390758 CAGGTGCGGGGGCGTGTGCCTGG - Intergenic
1151713263 17:75818555-75818577 CTGGAGAGGGGCTGGGGGCAAGG - Intronic
1151775804 17:76200961-76200983 CTGGGGTTGGGATGTGTGCCAGG - Intronic
1152252326 17:79218569-79218591 CTGGTTAGGGTCTGATTGCCGGG - Intronic
1152286327 17:79415263-79415285 AAGGTGAGAGTCTGTGTGCCAGG - Intronic
1152433633 17:80262414-80262436 CTGGAGAGGGGAGGTGTGCAGGG + Intronic
1152572068 17:81125235-81125257 CTGGGGAGGGACTGTGTGCGTGG + Intronic
1152574256 17:81133165-81133187 CCAGTGAGGAGCTGCGTGCCTGG - Intronic
1152750252 17:82059266-82059288 CTGGTGGGGGGCAGTGTGGCAGG + Intronic
1153793662 18:8602862-8602884 CTGGTGGGGGGCTGTGCCCTGGG + Intergenic
1154499658 18:14989376-14989398 CTGCTGTGGGTCTGTGTGCAGGG - Intergenic
1155171205 18:23267835-23267857 ATGGTGCGGGCCTGTGTGCCAGG - Intronic
1156335402 18:36166939-36166961 CTGGTGAGGGGTTGGTTGCCTGG + Intronic
1156460537 18:37319150-37319172 CAGGTGAGTCACTGTGTGCCTGG + Intronic
1160768959 19:821895-821917 CAGGTGAGGGGCTGTGGGGCTGG - Exonic
1161698964 19:5784745-5784767 CTGGTGGGGTTCTGTTTGCCTGG + Exonic
1162264915 19:9564222-9564244 CAGGTGTGGTGGTGTGTGCCTGG + Intronic
1162751244 19:12830592-12830614 CAGGTGAGGGGCTGAATGCGGGG - Intronic
1162798321 19:13097973-13097995 GTGGGGCGGGGCTGTGTGCGGGG - Intronic
1162873157 19:13600852-13600874 CTGGTGAGAAGCAGTGTGGCTGG - Intronic
1162910013 19:13843336-13843358 TTGGTGAGGGGCGGTTTGGCGGG + Intergenic
1163387868 19:17011257-17011279 TTGTTGAGGGGCAGTGGGCCAGG + Intronic
1163653570 19:18532624-18532646 ATGGGCAGGGGCTGTGTGCAGGG - Intronic
1163685193 19:18708538-18708560 CTGGTGAGGGGCTGCTGGGCTGG + Intronic
1163718054 19:18883886-18883908 CTGAGGAGGGGATGTGGGCCCGG - Intronic
1164254771 19:23517928-23517950 CTGGTGAGGGGCATTGGGTCAGG + Intergenic
1164584456 19:29457842-29457864 CTGGTGAGGGCCTTTGTGTTGGG + Intergenic
1165065139 19:33224411-33224433 CTGGCCAGGGGCTGTGTTCAGGG + Intronic
1165076190 19:33281204-33281226 CAGTGGAGGGGCTGGGTGCCAGG + Intergenic
1165856857 19:38884157-38884179 CTGTGGAGTGGCTGTGGGCCTGG - Intronic
1166381666 19:42358121-42358143 CTGGTGAGGGGCAGGGTGACAGG - Intronic
1166432643 19:42740341-42740363 CAGGTGATGCGCTGTGTGCAGGG + Exonic
1166435755 19:42765538-42765560 CAGGTGATGCGCTGTGTGCAGGG + Exonic
1166482569 19:43186362-43186384 CAGGTGATGTGCTGTGTGCAGGG + Exonic
1166485051 19:43205493-43205515 CAGGTGATGCGCTGTGTGCAGGG + Exonic
1166720950 19:44995478-44995500 GTGGACAGGGGTTGTGTGCCTGG - Intergenic
1166729373 19:45050110-45050132 GAGGCGAGGGCCTGTGTGCCTGG + Intronic
1167249820 19:48393866-48393888 CCGGTGAGGATCTGTGTGTCCGG + Intergenic
1167489659 19:49784727-49784749 CGGGTGGGGTGCTGTGTGCCTGG + Intronic
1167620518 19:50557502-50557524 CTGGTCACTTGCTGTGTGCCAGG - Intronic
1168255317 19:55161610-55161632 CAGGAGAGGGGCTGGGGGCCTGG - Intronic
925142411 2:1559252-1559274 CTGGTGAGGGGCCCTGTGTGGGG - Intergenic
925216040 2:2096739-2096761 CTGAGGATGGACTGTGTGCCAGG + Intronic
925313834 2:2906861-2906883 GGGGTGAGTGGCTGTGGGCCGGG - Intergenic
925384415 2:3452192-3452214 TTGGTGAGAGGCTGGGTTCCTGG + Intronic
925862143 2:8189442-8189464 ATGGGGAGGGGCTTTGTCCCGGG - Intergenic
925893036 2:8451441-8451463 CTGGTGTGGCCATGTGTGCCTGG - Intergenic
925907479 2:8547935-8547957 CTTCTCAGGGCCTGTGTGCCTGG + Intergenic
925972209 2:9113564-9113586 CTGGCCTGGGGCTGTGTCCCTGG + Intergenic
926146798 2:10401231-10401253 CTGGTGTGGTGCTGGATGCCTGG - Intronic
926198535 2:10777752-10777774 CTGGCGAGGAGATGTGAGCCAGG - Intronic
926220671 2:10933722-10933744 CTGGGGAGTGGCTGTGTTCCAGG - Intergenic
927146494 2:20169606-20169628 CTGGAGAGGGCGTGTGTCCCTGG - Intergenic
927203737 2:20593999-20594021 CTGCTGATGGGCTCTGTGACTGG + Intronic
927312979 2:21651300-21651322 CTGGTCAGGTGCTGTGAGCTAGG - Intergenic
927496876 2:23557021-23557043 TTGGTGAAGGGCCCTGTGCCAGG + Intronic
927598413 2:24418666-24418688 CAGGTGAGAGGCTGTGATCCAGG + Intergenic
928275329 2:29895491-29895513 CTGGTCTGTGGCTGTGAGCCTGG + Intronic
928414893 2:31083917-31083939 CTGGTGAAAGGCTGTGTGGTTGG + Intronic
928615064 2:33029618-33029640 CTGCTGAGTGACTGTGGGCCAGG - Intronic
928822646 2:35380364-35380386 CTGGTGAGAGCCTGTTTGCCAGG - Intergenic
928927846 2:36597255-36597277 CTGATGAGTGGGAGTGTGCCTGG - Intronic
929588470 2:43130596-43130618 GAGGTGAGGGGCTGAGTCCCAGG + Intergenic
931278922 2:60770763-60770785 CAGGTGTGGTGGTGTGTGCCTGG - Intronic
931487128 2:62705332-62705354 CTGGTGCGGGGCTGGGTTTCTGG - Intronic
931692376 2:64846189-64846211 CTGGTGAGGGGCGGGGTTCCAGG - Intergenic
931828198 2:66023341-66023363 GTGATGAAGGGCTGTGTGGCAGG + Intergenic
932162076 2:69469804-69469826 CTGATGTAGGACTGTGTGCCAGG + Exonic
932408945 2:71534009-71534031 TGGGTGTGGGGCTGAGTGCCAGG - Intronic
932620915 2:73264564-73264586 CTGGTGTGGGGATGTGTGTGGGG + Intronic
932621469 2:73266827-73266849 ATCGTGCGGGGCTGTGTGCTAGG - Intronic
932760400 2:74435969-74435991 CTGGTGAGGGGCTTTGGGAAAGG - Intronic
933942145 2:87253764-87253786 CTGGTGTGGGGATGGGTACCAGG + Intergenic
935009360 2:99117810-99117832 CTGGGGAGCAGCTGTGTGACTGG + Intronic
935803836 2:106727438-106727460 AAGGAGAGTGGCTGTGTGCCAGG + Intergenic
936244777 2:110817115-110817137 CTTGTGATGGGCTGGGTGCAGGG - Intronic
936338080 2:111607805-111607827 CTGGTGTGGGGATGGGTACCAGG - Intergenic
937368580 2:121282829-121282851 ATGTTGATGGGGTGTGTGCCGGG - Intronic
938483612 2:131681965-131681987 CTGGTGAGGCTGTGGGTGCCTGG + Intergenic
938493634 2:131778941-131778963 CTGCTGTGGGTCTGTGTGCAGGG + Intergenic
943358204 2:186885320-186885342 CTGAGGAAGGGGTGTGTGCCTGG + Intergenic
946179509 2:217941260-217941282 CTGTTGAGGGGCTCTGGGGCTGG - Intronic
947221481 2:227797021-227797043 CTGGTGTGGTGGTGTGCGCCTGG - Intergenic
948152754 2:235757320-235757342 CTGGAAGGGCGCTGTGTGCCAGG + Intronic
948456254 2:238105966-238105988 CAGCTGGGGAGCTGTGTGCCAGG - Intronic
948716268 2:239865493-239865515 GTGGTGAGGGGCGGAGTGCGCGG - Intergenic
948802614 2:240439735-240439757 CTGGTGAGGGGCTGTGTGCCAGG - Intronic
1168870740 20:1126045-1126067 ATGGTGAAGGGCTGTGTGAGTGG - Intronic
1169210663 20:3764674-3764696 CTGGTGCTGCGCTGAGTGCCGGG - Intronic
1169468593 20:5863464-5863486 CTGGTGCCGGGCAGTGTGCAGGG + Exonic
1171035462 20:21709498-21709520 CTGGGGAGCGGGTGTGAGCCTGG + Intronic
1171271984 20:23824731-23824753 CAGCTGTGGGGCTGTGTGCTGGG - Intronic
1171294387 20:24004785-24004807 CTTTTTAGGAGCTGTGTGCCAGG + Intergenic
1171386263 20:24771082-24771104 ATGGTGAAGGGCGGGGTGCCAGG + Intergenic
1171414417 20:24967975-24967997 CTGTTGCTGGGCTGTGTGTCTGG - Intronic
1172186599 20:33034910-33034932 CAAGTGAGGGGCTCTGTGGCTGG + Exonic
1172940336 20:38649679-38649701 CTGGTGAAGGGCTCTGTGCAGGG + Intronic
1172961601 20:38804456-38804478 CTGGAGAGGGCCTGGGGGCCTGG + Intergenic
1173133937 20:40422656-40422678 CTGATCAGGGGCTGTCTGCTGGG - Intergenic
1174303687 20:49600389-49600411 CTGGAAAGGGCCTGTCTGCCTGG - Intergenic
1174773448 20:53322630-53322652 CTGGTCAGGGGCTTTGTCACTGG - Intronic
1175900717 20:62358930-62358952 CAGGTGAGGGCCTGTGCCCCTGG - Intronic
1175959109 20:62626110-62626132 CTGGGGCGGGTCTGTGGGCCTGG + Intergenic
1176140460 20:63542635-63542657 CTGGTGTGGGGGGCTGTGCCTGG - Intronic
1176239606 20:64069829-64069851 TTGGGTAGGGGCTGTGGGCCTGG + Intronic
1176427960 21:6560400-6560422 CTGGGCAGGGGCTACGTGCCAGG - Intergenic
1176614265 21:9015429-9015451 CTGCTGTGGGCCTGTGTGCAGGG - Intergenic
1176909955 21:14552544-14552566 CTGGTGAGGGCCTGTTTCCTGGG - Intronic
1178372543 21:32038295-32038317 AGCATGAGGGGCTGTGTGCCCGG + Intronic
1179703451 21:43168717-43168739 CTGGGCAGGGGCTACGTGCCAGG - Intergenic
1179959780 21:44761796-44761818 CGTGTGAGTGGCTGTGTGCCTGG + Intergenic
1179984044 21:44911510-44911532 CGGGTGCCAGGCTGTGTGCCAGG + Intronic
1180187059 21:46145306-46145328 CTGGGGAGGGGCTGGGGACCAGG - Intronic
1180261288 21:46670845-46670867 CTGGTGAAGGGCTGTGGCCCAGG - Intergenic
1180497832 22:15904981-15905003 CTGCTGTGGGTCTGTGTGCAGGG + Intergenic
1180960961 22:19762161-19762183 CTCAGGAGGGCCTGTGTGCCTGG - Intronic
1180966232 22:19789248-19789270 CAGGAGAGGGGCTGGGTCCCGGG + Intronic
1181128818 22:20717534-20717556 CTGGGGAGGGGCTGGGGTCCTGG + Intronic
1181156577 22:20925654-20925676 CAGGTGAGTTGCTATGTGCCTGG - Intronic
1181307907 22:21927390-21927412 CTGGGGAGGGGCTGTGAGCGTGG + Intronic
1182587626 22:31354158-31354180 CAGGTAAGGTGGTGTGTGCCTGG + Intergenic
1182897847 22:33873605-33873627 CTGGTCAGTGGCTGTTTCCCAGG - Intronic
1183333960 22:37236258-37236280 CTGGGGAGGGGCCCTGTGGCAGG - Intronic
1183343223 22:37293643-37293665 CTGGTGAGGGGCTGGTTCCAGGG - Intronic
1183346875 22:37312919-37312941 CTGGGCAGGGGCCGTGTCCCGGG + Intronic
1183394273 22:37562307-37562329 CAGGTGAGGGGAGGTGAGCCTGG + Intronic
1183394889 22:37566145-37566167 CTTCTGAGGGGCTGGGAGCCGGG + Exonic
1183427917 22:37749445-37749467 GTGTAGAGGGGTTGTGTGCCTGG + Intronic
1183494607 22:38135468-38135490 GTGGAGGGTGGCTGTGTGCCAGG - Intronic
1183538347 22:38415904-38415926 CTGCTGAGGGGCTGAGGGGCTGG + Intergenic
1183653539 22:39172231-39172253 CCAGTGCGGGGCTCTGTGCCAGG - Intergenic
1184272687 22:43393550-43393572 TGGGGGAGGGGCTGTGGGCCAGG + Intergenic
1184310349 22:43637221-43637243 AGGGTGAGGGGCTTTCTGCCCGG + Intronic
1184460482 22:44635050-44635072 CTGGTGAGGGGCACAGTGCTGGG - Intergenic
1185077706 22:48692073-48692095 CTGGGATGGGGCAGTGTGCCAGG + Intronic
1185237808 22:49724924-49724946 CTGGTGTGAGGCTGTGGGACCGG - Intergenic
1185368051 22:50445954-50445976 CTGGTGAGGGGCAGAGAACCTGG - Exonic
1185370190 22:50457275-50457297 CTGGTGTGGGCCTCTCTGCCAGG + Intronic
950185893 3:10945350-10945372 TTGGTGGGGGGCTGAGTTCCTGG - Intergenic
953625255 3:44565622-44565644 CTGGGGAGGTGGTGTGTCCCTGG - Exonic
954177562 3:48856650-48856672 CTTGGGAGGGCCTGTCTGCCAGG + Intergenic
954330756 3:49888994-49889016 CTGGTGAGGGGATGTGAGCTTGG - Intronic
954533714 3:51342445-51342467 CATGTGAGGGGCTCTGTGTCAGG - Intronic
954708776 3:52494875-52494897 CTAGTGAGGGGATGTGGGTCTGG + Intergenic
954801764 3:53191131-53191153 CTGGTGTGGGCCACTGTGCCCGG - Intronic
956784090 3:72628097-72628119 GTGGCCAGGGGGTGTGTGCCTGG - Intergenic
960289028 3:115861543-115861565 CAGGTGAGGGTCTGTGTACAGGG - Intronic
961064134 3:123860208-123860230 CTGGTCTGGAGCCGTGTGCCGGG - Intronic
961447500 3:126987754-126987776 CTGGGAAGGGGCCGTGTGGCGGG + Intergenic
961455271 3:127020797-127020819 CTGGGCAGGGGCCGTGTGCTGGG + Intronic
961458241 3:127034689-127034711 CTATGGAGGGGCTGTGGGCCAGG + Exonic
961558610 3:127713549-127713571 CTGCTGAGGTGCTGGGTCCCTGG - Intronic
961648087 3:128403318-128403340 CAGGGGCGGGGCTGTGAGCCAGG + Intronic
961660002 3:128463559-128463581 CTGGTGAGGAGCTGGGGGCGGGG - Exonic
962091682 3:132250865-132250887 CTGGAGAGGGCCTGTGTTACAGG + Intronic
962450678 3:135513974-135513996 CTGGGGAGGGGCAGTGAGTCTGG - Intergenic
966874958 3:184316216-184316238 CAGGTGAGGGGCTGTGGGGAGGG + Exonic
966923873 3:184631922-184631944 CTGGTGAGGGACTGTGCAGCCGG - Intronic
966931567 3:184678913-184678935 CTGGAGAGGGGGTGTGGGGCTGG - Intronic
967313811 3:188131717-188131739 CTGGTGAGGGCTTTTGTGCTGGG + Intergenic
968610935 4:1556723-1556745 CGGGTGAGGTGCGGTGTGGCCGG - Intergenic
968691392 4:1992154-1992176 CTGCCGCGGGGGTGTGTGCCTGG + Intronic
968823565 4:2875956-2875978 CTTGTGAGGGGCTGTGGTCGGGG - Exonic
968981737 4:3853832-3853854 GTGCTGAGGGGCTGGGGGCCGGG - Intergenic
969364804 4:6688141-6688163 TTGGAGAGGAGCTGTGTGACTGG - Intergenic
969412438 4:7038049-7038071 CTGGTGAGGGAGTGTTTGCTTGG + Intergenic
969460429 4:7326108-7326130 GTGGTGAGGGGCTGTGTTCTGGG + Intronic
970072591 4:12178134-12178156 CTGACCAGAGGCTGTGTGCCAGG - Intergenic
970974223 4:22024480-22024502 CTGGTGAGGGCCAGTTTTCCTGG + Intergenic
971299373 4:25429094-25429116 CTGATGGGAGGCTGTTTGCCTGG + Intergenic
971307234 4:25494134-25494156 CAGGTGAGAGGCTCTGTGCCCGG + Intergenic
971329019 4:25667008-25667030 CTGGTCAGGGGCTGTGGCTCAGG - Intronic
972543367 4:40057517-40057539 CGTGTGAGTGGCTGTGTGTCTGG - Intronic
973530041 4:51827629-51827651 CTTGGGAGGGTCTATGTGCCAGG + Intergenic
976121479 4:81787603-81787625 ATGGTGACTGGCTGTGGGCCAGG - Intronic
977292801 4:95181583-95181605 CAGGGGTGGTGCTGTGTGCCTGG + Intronic
978088367 4:104683661-104683683 CTGGTCAAGGGCTGTGTGGAAGG + Intergenic
979065240 4:116123140-116123162 CTTGGGAGGGGCTGTATGCATGG + Intergenic
979479571 4:121200532-121200554 CTGGTCAGGGTATGTGTGCTCGG - Intronic
980956627 4:139435146-139435168 CAGGTGTGAGGCAGTGTGCCTGG + Intergenic
981081315 4:140642080-140642102 CGGAGGAGGGGGTGTGTGCCAGG + Intronic
984922373 4:184777188-184777210 CTGGTGTGAGTCAGTGTGCCTGG - Intronic
985492972 5:190005-190027 CTGGAAAGGGGCCGTGTGTCTGG + Intergenic
985832227 5:2242287-2242309 CTGGTGAGGGGCTCTTGGCCTGG + Intergenic
986744860 5:10734917-10734939 CCGGTGAGGGACAGTCTGCCTGG - Intronic
987335348 5:16893867-16893889 CTGGGGAGAGGCTGTGTCCTCGG - Intronic
990438679 5:55821851-55821873 CTGGTGGGTGGCTGTGTGCGGGG + Intergenic
990900103 5:60740269-60740291 TTGGTGAGGGGATGTTTTCCTGG - Intergenic
992788743 5:80194917-80194939 CAGGTGAGGAGCTGTGGCCCAGG - Intronic
995180804 5:109228595-109228617 CTGGTGAGGGCCTTTGTGAAGGG + Intergenic
995526861 5:113057181-113057203 CGTGGGAGGGGCTGGGTGCCAGG + Intronic
996726253 5:126675444-126675466 CTGGTGAGGGGGTATGGGCAGGG - Intergenic
997197716 5:131990808-131990830 GTGTGGAGGGGCTGTGTGGCAGG - Intronic
997694499 5:135850554-135850576 CTGGTGTGGGGCTGTGGCCCTGG - Intronic
998165013 5:139837836-139837858 AAGGAGAGGGGTTGTGTGCCGGG - Intronic
998353181 5:141514133-141514155 CTGCGGAGGGGCGGGGTGCCGGG + Intergenic
999297064 5:150466288-150466310 CTGCCGAGGGTCTGGGTGCCTGG + Intergenic
1002308534 5:178298541-178298563 CAGGTGTGGGGCTGTGAGCAGGG - Intronic
1002349025 5:178569815-178569837 GTGTGGAGGGGCTGTGTGGCAGG - Intronic
1003229194 6:4234963-4234985 CTGGTCGGGGGCTGTGGGGCTGG + Intergenic
1003482716 6:6547685-6547707 CTGGTGAGGATCAGTGTCCCGGG - Intergenic
1004516591 6:16326836-16326858 ATGAGCAGGGGCTGTGTGCCGGG + Exonic
1005283804 6:24302881-24302903 CTGCTGAGAGTGTGTGTGCCTGG - Intronic
1005813342 6:29532168-29532190 CTGGAGCTGGGCTGTGGGCCAGG - Intergenic
1005953212 6:30646519-30646541 CTGTGGAGGAGCTGTGTGCATGG - Exonic
1006334063 6:33411237-33411259 CTGGTGGGGGGCAGGGAGCCGGG + Intronic
1006354227 6:33544661-33544683 CTGGTGTGGTGGCGTGTGCCTGG + Intergenic
1006642354 6:35495976-35495998 CTGGTGAGGGGCCCTGATCCAGG - Intronic
1006840616 6:37025975-37025997 CTGTTCAGGGAATGTGTGCCCGG + Intronic
1008164568 6:48120231-48120253 CTGGTGAGGGACTTTCTGCTGGG - Intergenic
1008408331 6:51143968-51143990 CTGGTCAGGGGGTGGGGGCCTGG + Intergenic
1008628820 6:53344656-53344678 CTTGTGAGGGGCTCAGTGCAAGG + Intronic
1011622487 6:89256050-89256072 CAGGTGTGGTGGTGTGTGCCTGG - Intergenic
1012445028 6:99298344-99298366 CAGGTGTGGTGCTGTATGCCTGG - Intronic
1013106904 6:107033443-107033465 CTTGAGAGGAGCTGGGTGCCTGG + Intronic
1014232767 6:118922698-118922720 CTGATGATTGGCTGTGGGCCAGG - Intronic
1014778226 6:125534251-125534273 CTGGTGGGCTGCTGTTTGCCGGG + Intergenic
1015262913 6:131259035-131259057 CCGGGGAGGGGCTCTGAGCCAGG - Intronic
1015871724 6:137782227-137782249 CTGGCGTGGTGGTGTGTGCCTGG - Intergenic
1016713892 6:147203104-147203126 CCGGCGAGGGGCTGGGTGCGGGG + Intergenic
1018282289 6:162199902-162199924 CAGATGAGGAGCTGTGGGCCAGG - Intronic
1019140680 6:169940464-169940486 CTGGTGAGTGGCTGAGCCCCAGG + Intergenic
1019205928 6:170361933-170361955 CGGGTGTGGTGGTGTGTGCCTGG - Intronic
1019337304 7:491472-491494 CTGGTGCGTGGCTGGGTGACCGG + Intergenic
1019406037 7:884557-884579 GGGGGGAGGGCCTGTGTGCCAGG + Intronic
1019518595 7:1450530-1450552 CTGGTGAGGGGCGGCCTGTCAGG - Intronic
1019700986 7:2475015-2475037 CTGGGGAGGGGTTGTCTGCCTGG - Intronic
1020224829 7:6272234-6272256 CTGGCGAGGGTCTGGGTACCAGG - Intronic
1020436148 7:8164442-8164464 CTGGTGAGGGGTTGAGTGCTGGG + Intronic
1022113898 7:27246681-27246703 CTGGTGGGGGGCGGTGGGTCCGG - Intronic
1024542748 7:50492393-50492415 TTGGTGAGATGCTGTGTACCTGG - Intronic
1026049234 7:66931024-66931046 CTGGTGTGGTGGTTTGTGCCTGG + Intronic
1026461161 7:70616316-70616338 CTGCTGAGAGGCTCTGAGCCAGG - Intronic
1027237635 7:76307493-76307515 GTGGTCTGGGGCTCTGTGCCTGG - Intergenic
1027387295 7:77671295-77671317 CAGGTGTGAGCCTGTGTGCCTGG + Intergenic
1028622134 7:92836458-92836480 CAGGTGAGGAGCTGTGCGCTCGG - Intronic
1029550436 7:101234494-101234516 ATGGTGAGGGGCTGTTGGGCTGG - Intronic
1029732413 7:102447046-102447068 CTTGTGAGGGGCCGAGGGCCGGG + Exonic
1030297087 7:107940029-107940051 CTGCTGCGGGGCTCTGCGCCAGG + Exonic
1030598021 7:111562410-111562432 CGGGTGGGGGGCTGTGAGGCTGG - Intronic
1032668869 7:134065505-134065527 ATGGTGAGGTCCAGTGTGCCAGG - Exonic
1032723802 7:134572484-134572506 CAGGTGTGGTGGTGTGTGCCTGG + Intronic
1032806293 7:135358104-135358126 CTGGTAAGGGTCTGACTGCCAGG - Intergenic
1033299834 7:140176383-140176405 CTGGCGAGGGGCTGCGGACCCGG + Intronic
1034552703 7:151831795-151831817 CCGGTCAGGTGCTGTGTCCCTGG + Intronic
1034934003 7:155186863-155186885 GTGGTGGGGGTCTGTGTGGCTGG - Intergenic
1034939095 7:155218849-155218871 GTGGGGAGGGACTGTGAGCCAGG - Intergenic
1035263701 7:157676974-157676996 CAGGGGAGGGGCGGTGTGCGTGG - Intronic
1035528754 8:335064-335086 CTGGGGAGGGGCCCAGTGCCAGG + Intergenic
1037910896 8:22743038-22743060 GCGGTGAAGGGCTGTGTGCTGGG + Intronic
1038036578 8:23691366-23691388 GTGGTGAGGGGCTGTAGGCTAGG + Intergenic
1038501586 8:28049152-28049174 CTGGTGAGAAGCCGTGTCCCTGG + Intronic
1038997475 8:32940622-32940644 CTCGTGAGTGGCTGGCTGCCTGG + Intergenic
1039476291 8:37841021-37841043 CTGGGGTGGGGCTGGGGGCCGGG - Intronic
1040936401 8:52786269-52786291 CTGGTGAGGGGGTGAGTGTGGGG + Intergenic
1041190204 8:55345749-55345771 CTGGTGAGAGGTGGTGTGCTTGG + Intronic
1042714952 8:71762405-71762427 CCTTTGAGGGGCTTTGTGCCAGG + Intergenic
1044858358 8:96497698-96497720 CTGGTGGGGCTCTGTGTGACTGG - Intronic
1045184026 8:99817746-99817768 CTGGTCAAGAGATGTGTGCCTGG + Exonic
1045654814 8:104375981-104376003 CTGGAGAGGGTCAGTGGGCCTGG - Intronic
1046643561 8:116759870-116759892 CAAGTGTGGTGCTGTGTGCCTGG - Intronic
1047199173 8:122749455-122749477 CTGGTGGGGAGCTGTGTTTCTGG - Intergenic
1048341825 8:133546090-133546112 CTGGTGTGTGGCTCTGTGCCGGG - Intronic
1048579962 8:135722666-135722688 CTGGTGAGTGGGTGTGTGTGTGG + Intergenic
1048847056 8:138611815-138611837 CTAGAGAGGGGGTGTGTGGCAGG - Intronic
1049345023 8:142134150-142134172 ATGGGAAGGGGCTGTGAGCCAGG + Intergenic
1049404732 8:142447328-142447350 CTGGGGAGGGGCTGAGGGCTGGG + Intergenic
1049407257 8:142457307-142457329 CAGATGAAGGTCTGTGTGCCAGG + Intronic
1049463409 8:142740276-142740298 CTGGAGAGGGGCAGTGTCCAGGG + Intergenic
1049588340 8:143442058-143442080 CTGGCAAGGGACTGTGTGGCTGG - Intronic
1049640244 8:143712015-143712037 CGGGGGTGGGGCTGTGTGCCTGG + Intronic
1049755141 8:144308109-144308131 CTGGTGAAGGGCAGTGGGGCAGG - Intronic
1049819882 8:144627085-144627107 TTTGTGAGGGGCTGGGTTCCAGG - Intergenic
1050530750 9:6586945-6586967 CTGGTGAGGAGCTGTGGGCTGGG - Intronic
1050613458 9:7377142-7377164 CGGGCCAGGGGCTGTGAGCCAGG - Intergenic
1052585858 9:30426326-30426348 CTGGTGAGGGCATGTTTTCCTGG - Intergenic
1052856089 9:33407627-33407649 CTGGTCAGGGGCTGTGGGTCGGG + Intergenic
1052857308 9:33415352-33415374 CTGGGGTGGGGCAGTGAGCCGGG + Intergenic
1054702227 9:68424355-68424377 CTGGTGAGGGCCTGGCTTCCTGG + Intronic
1055602111 9:77930831-77930853 CTGGTGCTGGGCTGTGGTCCTGG - Intronic
1055661144 9:78505313-78505335 CTGGTGAGGGGCTCTCTTCCAGG - Intergenic
1055669502 9:78588678-78588700 CTGGTGAGAGGTTGGGGGCCAGG + Intergenic
1057314219 9:93958556-93958578 CTCGGGAGGGGGTGTGTCCCAGG - Intergenic
1059107815 9:111526403-111526425 CTGGTGAGGGACTGTAAGCCGGG + Intronic
1059994943 9:119899596-119899618 CTGCTGAGGGGCTTTCTCCCAGG - Intergenic
1060157680 9:121331446-121331468 CTGGTGAGGACCCGAGTGCCTGG + Exonic
1060231272 9:121827278-121827300 GGGGTGAGGGGCTGTGTGGCAGG - Intronic
1061418347 9:130460251-130460273 CTGGTGGGTGGCTGTCTCCCAGG - Intronic
1061512443 9:131069347-131069369 CTGTTAAGTGCCTGTGTGCCTGG + Intronic
1061516182 9:131091802-131091824 CAGGTGGGGGAGTGTGTGCCGGG - Exonic
1061774490 9:132951907-132951929 CCGGTGTGGTGGTGTGTGCCTGG - Intronic
1061838847 9:133346234-133346256 CTGCTCATTGGCTGTGTGCCAGG + Intronic
1061925396 9:133803744-133803766 CTGCTGAAGGGCTTTGTGACAGG - Intronic
1062024138 9:134332650-134332672 CTGGGTAGGGCCTGTGTGCCGGG + Intronic
1062033352 9:134371960-134371982 CTGGTGCAGGACTGGGTGCCAGG + Intronic
1062209848 9:135357505-135357527 CCTGTGTGGGGCTGTGAGCCGGG - Intergenic
1062460423 9:136660456-136660478 CTGGGGAGGGGCTGGGGGCAGGG + Intronic
1062468034 9:136690081-136690103 GTGGTGAGGGACTGGGAGCCTGG + Intergenic
1062469545 9:136696553-136696575 CTGCTGAGGGCCTGTGTTGCAGG - Intergenic
1186220206 X:7342088-7342110 CAGGTGAGGGCCACTGTGCCTGG + Intronic
1187939902 X:24371513-24371535 GTACTGAGGGGCGGTGTGCCCGG - Intergenic
1191779542 X:64850610-64850632 CTGTAGAGGGGCGGTGTGCAAGG - Intergenic
1192002707 X:67172356-67172378 CTAGAGAGGGTCTATGTGCCCGG + Intergenic
1192848222 X:74926639-74926661 CTGGGGAGGGATTGTGTGACAGG - Intergenic
1193020662 X:76789100-76789122 CTGAGGATGAGCTGTGTGCCAGG - Intergenic
1193532336 X:82670960-82670982 CTGAAGAGGGGTTGTTTGCCTGG + Intergenic
1196658340 X:118242786-118242808 CTGGTGAGGAGCTGTGTTGGTGG - Intergenic
1197086752 X:122486192-122486214 CTGGAGAGGGGATTTGTGGCAGG + Intergenic
1198252555 X:134894764-134894786 CTGGTGAGGGTCTGTGGGAATGG - Intronic
1198261543 X:134969345-134969367 CTGGTCAGGGACTGTTTTCCAGG - Intergenic
1198265128 X:135001801-135001823 CTGGTCAGGGACTGTTTTCCAGG + Intergenic
1198834579 X:140790156-140790178 CAGGTGTGGGCCAGTGTGCCTGG + Intergenic
1198839242 X:140839003-140839025 CTTGTGTGAGGCTGTTTGCCTGG + Intergenic
1199212055 X:145224058-145224080 CTGGATAGAGGCTGTCTGCCAGG - Intergenic
1199585868 X:149415243-149415265 CTAATGAGGGGGTTTGTGCCAGG + Intergenic
1199814521 X:151386082-151386104 CTGGACAGGGGCTGGCTGCCCGG - Intergenic
1200110597 X:153738860-153738882 CTGGAGGCGGGCTGTGTGCAGGG - Intronic
1200359739 X:155592177-155592199 CTTCTGAGGGGCTGGGTGCAGGG + Intronic