ID: 948804013

View in Genome Browser
Species Human (GRCh38)
Location 2:240445364-240445386
Sequence GGGGTGCTCTGGTGTTTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948804009_948804013 -5 Left 948804009 2:240445346-240445368 CCCAGTGATTGAGGAGTGGGGGT 0: 1
1: 0
2: 0
3: 15
4: 157
Right 948804013 2:240445364-240445386 GGGGTGCTCTGGTGTTTAGTGGG 0: 1
1: 0
2: 0
3: 12
4: 82
948804010_948804013 -6 Left 948804010 2:240445347-240445369 CCAGTGATTGAGGAGTGGGGGTG 0: 1
1: 0
2: 3
3: 22
4: 235
Right 948804013 2:240445364-240445386 GGGGTGCTCTGGTGTTTAGTGGG 0: 1
1: 0
2: 0
3: 12
4: 82
948804002_948804013 14 Left 948804002 2:240445327-240445349 CCCTGGGCACTTGTGACATCCCA 0: 1
1: 0
2: 0
3: 12
4: 160
Right 948804013 2:240445364-240445386 GGGGTGCTCTGGTGTTTAGTGGG 0: 1
1: 0
2: 0
3: 12
4: 82
948804003_948804013 13 Left 948804003 2:240445328-240445350 CCTGGGCACTTGTGACATCCCAG 0: 1
1: 0
2: 1
3: 20
4: 168
Right 948804013 2:240445364-240445386 GGGGTGCTCTGGTGTTTAGTGGG 0: 1
1: 0
2: 0
3: 12
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948804013 Original CRISPR GGGGTGCTCTGGTGTTTAGT GGG Intronic
900320429 1:2080861-2080883 GGGCTGGTCAGGTGTTTTGTGGG + Intronic
902334442 1:15746998-15747020 GGCGAGCTCTGGTGTCTCGTGGG + Exonic
903069689 1:20720997-20721019 GGGGTGCCCTGGTGATTCCTAGG + Intronic
903271380 1:22190505-22190527 GGGCTCTCCTGGTGTTTAGTAGG + Intergenic
905682713 1:39885684-39885706 GGGGTGATCGGGTGCTGAGTGGG - Intergenic
905808953 1:40898212-40898234 GGGCTGAGCTGGTGTTTCGTGGG - Intergenic
906652794 1:47524815-47524837 GGGGTGCTCAGGTGGAAAGTAGG + Intergenic
907221283 1:52908610-52908632 GGGTTGTTTTGTTGTTTAGTTGG - Intronic
907254250 1:53166407-53166429 GGGGTGGGCTCGTGTTTTGTAGG + Intergenic
1063120270 10:3100987-3101009 GGCATGCTCTGGTGGTCAGTGGG + Intronic
1068011729 10:51460117-51460139 GGGGTCCTCTGGCATTTAGTGGG - Intronic
1068232879 10:54193635-54193657 GGGATTCTCTGATGTATAGTGGG - Intronic
1072326235 10:94301484-94301506 GGGTTTCTCTGCTATTTAGTTGG - Intronic
1072663335 10:97376689-97376711 TGGGTGCTCTGGCATCTAGTGGG - Intronic
1075454596 10:122576971-122576993 TGGTGGCTCTGGAGTTTAGTTGG + Intronic
1077080536 11:722848-722870 GGGGAGCTCTGGTGAGGAGTGGG - Intronic
1089031214 11:115331348-115331370 GGGAGGCTCTTTTGTTTAGTTGG - Intronic
1104255596 12:127134245-127134267 GGGGTCCTCTGGTAGTAAGTTGG - Intergenic
1105956573 13:25288314-25288336 GGGTTGGTCTGGTGCCTAGTAGG - Intergenic
1109455451 13:62581970-62581992 GGGGTGTTCTGTTTTTTTGTTGG + Intergenic
1114712345 14:24791360-24791382 TGGGTGCTCTATTGTATAGTAGG + Intergenic
1117402638 14:55371841-55371863 GGGGTGCTCTCAAGTTTACTAGG + Intronic
1118037611 14:61884916-61884938 GGAGTCCTCTGGTTTTTAGTGGG - Intergenic
1124983545 15:34584303-34584325 GGGGTGCTAGGGTGGTTACTGGG - Intronic
1128210149 15:65892956-65892978 GGAGAGCCCTGGTGATTAGTGGG - Intergenic
1129691382 15:77715659-77715681 GGGCTGGGCTAGTGTTTAGTAGG - Intronic
1130366976 15:83249482-83249504 GGGGTGCTATGGCATTTAGTGGG + Intergenic
1136269452 16:29139823-29139845 GGGTGGCTCTGGTGTTAAGGAGG + Intergenic
1141920974 16:87135161-87135183 GGGGTGCTGTGATGATTAATAGG - Intronic
1142072931 16:88101093-88101115 GGGTGGCTCTGGTGTTAAGGAGG + Intronic
1142335165 16:89484197-89484219 GTGGTGCTCTGGGGTTTTTTTGG + Intronic
1145115298 17:20204476-20204498 GGGGTCCTCAGGTGTTTCGTAGG - Exonic
1148224557 17:45889605-45889627 GGGGAGCTCTGGAGTTAAATAGG + Intergenic
1149143800 17:53465657-53465679 GAGGGGCTCTGGTGCTTGGTAGG + Intergenic
1153909751 18:9696444-9696466 GGTGGGCTCTGGTGTTAAGCTGG + Intergenic
1157231419 18:45920034-45920056 GAGGTGATCAGGTGTTTGGTTGG - Intronic
1159130064 18:64271251-64271273 GGTGTGCTCTAGTCTTTAGGAGG + Intergenic
1160149184 18:76386205-76386227 GGGGGGCTGTGGTGTTTTGCTGG + Intronic
1167378005 19:49121989-49122011 GGAGTGTTCTGGTGTTTAGAAGG - Intronic
932341160 2:70963328-70963350 GGGGAGCTCTGGAGGGTAGTGGG - Intronic
933920609 2:87041509-87041531 TGGCTGCTCTGGTGTTGAGTAGG - Intergenic
933931015 2:87152277-87152299 TGGCTGCTCTGGTGTTGAGTAGG + Intergenic
934002388 2:87728389-87728411 TGGCTGCTCTGGTGTTGAGTAGG + Intergenic
936362107 2:111813155-111813177 TGGCTGCTCTGGTGTTGAGTAGG - Intronic
938797984 2:134734747-134734769 GGGGTGCACTGGTGTGTTTTTGG - Intergenic
941737253 2:168992466-168992488 AGGGTTCTCTGGAGTATAGTTGG + Intronic
948804013 2:240445364-240445386 GGGGTGCTCTGGTGTTTAGTGGG + Intronic
1170703780 20:18727226-18727248 GGGGTGAGGTGTTGTTTAGTGGG + Intronic
1172935442 20:38616809-38616831 GGGATGCTTTGGCGTCTAGTGGG + Intronic
1173737814 20:45374092-45374114 AGGGTGCTGTGGTGTCTGGTAGG + Intronic
1174530040 20:51204380-51204402 GGGATGCAGTGGTGATTAGTGGG - Intergenic
1174978951 20:55369998-55370020 GGGATGCTCTGGTGCCTGGTGGG - Intergenic
1182459699 22:30475081-30475103 AGTGTGCTCTGGGGTTTAGGGGG - Intergenic
1183523295 22:38309087-38309109 GGGGTGCCCTGGCATCTAGTGGG - Intronic
952116150 3:30183994-30184016 GGGTTCCACTGGAGTTTAGTTGG + Intergenic
952852273 3:37739206-37739228 GGGGTGTTCTTGAATTTAGTAGG - Intronic
953931623 3:47008657-47008679 GGGGGGCTTACGTGTTTAGTTGG - Exonic
955331983 3:58054783-58054805 GTGGTGCTGTGGTGTGTAGGTGG + Intronic
955332092 3:58055610-58055632 GTGGTGCTGTGGTGTGTAGTAGG + Intronic
959598342 3:108152024-108152046 TGGGTCCTCTGGTGGTTGGTGGG + Intergenic
960031940 3:113062926-113062948 GGGGTGCTGTGGTGATGACTTGG - Intergenic
962987260 3:140546996-140547018 TGGCTGCTCTGTTGTTTATTTGG + Intronic
967869491 3:194218331-194218353 GGGGGGCCCTGGAGTTTTGTTGG + Intergenic
967978998 3:195054261-195054283 AGGGTGCTCTGGTGGTCAGTTGG + Intergenic
973346421 4:49060439-49060461 GGGCTGGCCTGGTGTTTAGGTGG + Intronic
973842316 4:54874844-54874866 GGAGTGCAGTGGTGTTTACTTGG + Intergenic
975949778 4:79755979-79756001 GGGGTTCTCTTGTCTTTAATAGG + Intergenic
981722396 4:147814954-147814976 TGGGTGCTATGGTAATTAGTAGG - Intronic
993509967 5:88758817-88758839 GGGGTGCAGTGGTGTGTGGTAGG - Intronic
1000208886 5:159092120-159092142 GGGGAGGTCTGAGGTTTAGTGGG - Intronic
1001700835 5:173705522-173705544 GGGGGGCTCTGGGGTATAATCGG + Intergenic
1001988486 5:176095966-176095988 GGGCTGCCCTGGAGTTTAGGTGG + Intronic
1002228382 5:177742167-177742189 GGGCTGCCCTGGAGTTTAGGTGG - Intronic
1010166209 6:72917984-72918006 GGGGTGCTATTGCGTCTAGTGGG - Intronic
1010896559 6:81371780-81371802 GGGAAGCTCTGGTATTCAGTTGG + Intergenic
1013238077 6:108216329-108216351 GGGGTGCTATGTTGTCTAGTGGG - Intronic
1019505473 7:1388398-1388420 GGGGTGCTGTGGTGCATGGTGGG - Intergenic
1024523459 7:50327908-50327930 GGGGTCCTCTGGTGTGTGGGAGG + Intronic
1024922923 7:54578793-54578815 AGGATGCTCTGGTATTCAGTTGG - Intergenic
1026329436 7:69338954-69338976 GGGGTGCTCTGGTCTTCTGAGGG + Intergenic
1030757951 7:113312661-113312683 GAGGTGAGTTGGTGTTTAGTGGG + Intergenic
1031389483 7:121196005-121196027 GGGGGGAGATGGTGTTTAGTGGG + Intronic
1032779936 7:135157500-135157522 ACGCTGCTCTGGTGGTTAGTGGG + Intronic
1037793027 8:21964315-21964337 AGAGTGCTGTGGTGTGTAGTCGG + Intronic
1047466665 8:125122707-125122729 GAAGTGCTCTGCTGTTTAGATGG - Intronic
1048494430 8:134923332-134923354 TGGGTGCTCAGTTGTTTTGTAGG + Intergenic
1051856737 9:21576086-21576108 TGGGTGCTATGATGTTTATTGGG - Intergenic
1055454848 9:76462506-76462528 AGGGTGCACTGGCATTTAGTAGG - Intronic
1055588071 9:77777710-77777732 GGGGTTTTCAGGTGTTTATTAGG - Intronic
1056808572 9:89746732-89746754 GGATTGCTCTGGTGTTTTGGTGG - Intergenic
1186955521 X:14677733-14677755 GAGTTGCTCTGGTTTCTAGTGGG - Intronic
1188223369 X:27567397-27567419 TGGGTGCTCTGATGTTGGGTAGG + Intergenic
1190465580 X:50722450-50722472 GGGCTGCGCTGGGGTTTAGCAGG - Intronic
1192429312 X:71101749-71101771 GAGGTGCTGTGGTGATTAGGGGG - Intronic
1198821615 X:140654097-140654119 GTCATGCTCTGGAGTTTAGTTGG + Intergenic