ID: 948804568

View in Genome Browser
Species Human (GRCh38)
Location 2:240447902-240447924
Sequence CAACCAGGAAGCAGCTGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 206}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948804568_948804572 9 Left 948804568 2:240447902-240447924 CCGGCGCAGCTGCTTCCTGGTTG 0: 1
1: 0
2: 3
3: 19
4: 206
Right 948804572 2:240447934-240447956 GCGCTCACAGCACGCAGTGTCGG 0: 1
1: 0
2: 1
3: 7
4: 51
948804568_948804573 25 Left 948804568 2:240447902-240447924 CCGGCGCAGCTGCTTCCTGGTTG 0: 1
1: 0
2: 3
3: 19
4: 206
Right 948804573 2:240447950-240447972 GTGTCGGCGCTCCCATTCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 21

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948804568 Original CRISPR CAACCAGGAAGCAGCTGCGC CGG (reversed) Intronic
900786550 1:4653913-4653935 TGGCCAGGCAGCAGCTGCGCTGG + Intergenic
901499346 1:9641927-9641949 CAACTAGAAAGCTGCTGCCCTGG - Intergenic
901642711 1:10701177-10701199 CTGCCAGGGAGCAGCTGCCCAGG - Intronic
902554513 1:17239047-17239069 CAGCCAGGGAGCAGCAGGGCTGG + Intronic
902722519 1:18313384-18313406 CAGCCAGGAAGCGGCAGAGCTGG - Intronic
903421488 1:23220467-23220489 CAGTCAGGAAGCAGCTGGGAAGG + Intergenic
903571533 1:24309171-24309193 CAGCCAGCAAGCAGCAGAGCTGG + Intergenic
904111054 1:28126461-28126483 CAACCAAGAAGTAGCTGACCTGG + Intergenic
904617177 1:31756157-31756179 CAGCCAGGCTGCAGCTGCCCTGG - Exonic
904971950 1:34426246-34426268 CAACCAGGAAGCAGGGGCTCTGG - Intergenic
905342971 1:37291969-37291991 CATCTAGGAGGCAGCTGAGCTGG + Intergenic
906322610 1:44826565-44826587 CCAGCAGGAAGCAGCGCCGCAGG + Exonic
906662584 1:47593418-47593440 CAAACTGGAAACAGCTGCGGAGG - Intergenic
908443923 1:64183502-64183524 CAAGCAGGAAGCTGCTGCAGGGG + Intergenic
910393877 1:86772517-86772539 CAACCAGGAAAAAGATGCCCAGG - Intergenic
911053440 1:93691598-93691620 CAAGCAGGAGGCTGCTGAGCTGG - Intronic
911805530 1:102201785-102201807 TCACCAGGAAGCAGATGCACAGG + Intergenic
913267460 1:117059464-117059486 CACACAGGAAGCAGCAGCGCGGG + Intergenic
915360319 1:155282636-155282658 CAACCAGGAACCAGGTGCGCAGG - Exonic
916746467 1:167688535-167688557 CTACCAAGATGCAGCTGGGCGGG - Intronic
919005129 1:191889305-191889327 CAACCAGAAAACAGCTGGCCAGG - Intergenic
920925612 1:210338686-210338708 CAACCATGAAGCAGCAAAGCTGG + Intronic
922206898 1:223455930-223455952 CACCCAGTAAGTAGCAGCGCTGG - Intergenic
924083343 1:240421964-240421986 AAACCAGGAAGCTGGTGCTCAGG - Intronic
1062985375 10:1763778-1763800 GAAGCAGGAAGCAGCTGATCCGG + Intergenic
1067764680 10:49075915-49075937 AAACCAGGAGGCAGCTGGGAGGG - Intronic
1068629285 10:59283432-59283454 AAACCAGGAAGAAGCTGCTCAGG - Exonic
1069766142 10:70861780-70861802 CACCCAGCCAGCAGCTGCGGAGG + Intronic
1070325866 10:75388581-75388603 CAACCAAGAAGTAGCAGAGCTGG - Intergenic
1070604898 10:77891843-77891865 CAGCCAGCAAGCAGCAGAGCCGG - Intronic
1071027035 10:81126884-81126906 AAACCAGGTAGAAGCTGCGTGGG + Intergenic
1072552811 10:96492274-96492296 CAGGCAGGAAGAAGCTGCACAGG + Intronic
1074403606 10:113162530-113162552 CAAACAGGAAGCAGCTACAAAGG - Intronic
1075069049 10:119308761-119308783 GAACCAGGAAGCAGCTGGCCTGG - Intronic
1075071914 10:119325429-119325451 CTCCCAGGAACCAGCTGGGCAGG - Intronic
1075982203 10:126749655-126749677 CAACCAGCAAGTGGCTGAGCTGG - Intergenic
1076499433 10:130924624-130924646 CCAACAGGCATCAGCTGCGCTGG + Intergenic
1077216996 11:1399080-1399102 CAGCCAGGAAGGAGCTGGGCAGG + Intronic
1077475728 11:2789596-2789618 CACCCAGGACGCAGCTGGGAAGG + Intronic
1077492677 11:2869471-2869493 CGACCGGGACGCAGCGGCGCGGG + Intergenic
1077674205 11:4182855-4182877 CAGCCAGGAAGTAGCAGAGCTGG + Intergenic
1078557524 11:12342205-12342227 GAACCAGGACGCAGCTGCAATGG - Intronic
1078594368 11:12674261-12674283 CAACGGCGAAGCAGCCGCGCCGG + Intergenic
1079073894 11:17371434-17371456 CAGCCAGGAAGAAGCTACCCTGG + Intronic
1081613356 11:44576636-44576658 CAGCCAGGCAGCAGCAGAGCAGG - Intronic
1082747100 11:56976050-56976072 CAACCCAGAAACAGCTGCACTGG - Intergenic
1083174007 11:60938205-60938227 CAGCCAGGAGGCAGGTGAGCAGG - Intronic
1084025616 11:66447030-66447052 CTACCAGGAAGCAACTCCCCAGG + Intronic
1086306469 11:85485821-85485843 GCACCAAGAAGCAGCTGCTCAGG - Intronic
1086371485 11:86159682-86159704 TCACCAGGATGCAGCTGCTCTGG + Intergenic
1090520367 11:127472907-127472929 CATCTTGGAAGCAGCTGAGCTGG - Intergenic
1095098556 12:38160413-38160435 CTTCCCGGAAGCCGCTGCGCAGG + Intergenic
1095211402 12:39499110-39499132 CTACCAGGAAGCACCTGAGGTGG + Intergenic
1095421480 12:42028733-42028755 CAAACAGGAAGCAGCTGACAAGG - Intergenic
1096062860 12:48716683-48716705 CAACCAGAAGGCAGCGGCGAAGG + Exonic
1102440920 12:112963376-112963398 GGCCCAGGAAGCAGCAGCGCTGG + Exonic
1102813823 12:115846200-115846222 CAGCCAGGAAGCAGCAGAGTGGG + Intergenic
1103402701 12:120654246-120654268 CAAAGAGGAAGCAGCTACTCAGG - Intronic
1103786552 12:123436970-123436992 CAAACAGAAAGCAGCTGCTGGGG + Intergenic
1103899824 12:124297581-124297603 CAGCCAGGAAGCGGCTGTGCTGG + Intronic
1104535883 12:129617684-129617706 GAACCAGGAAGCAGGTCCTCTGG - Intronic
1104684632 12:130776730-130776752 CAAACAGGAAGTAGCAGTGCAGG + Intergenic
1104707069 12:130955446-130955468 CAACCAGGAAGCATCAGGACGGG + Intronic
1104943430 12:132405259-132405281 CAATCAGGGAGCAGCTCCCCAGG - Intergenic
1105593537 13:21815561-21815583 CAACCAGTAAGTGGCTGAGCAGG + Intergenic
1106471455 13:30059633-30059655 CATCCAGGAAGTAGCATCGCAGG - Intergenic
1106701058 13:32229056-32229078 CAACCCAGAAGCAGCTGCCAAGG + Intronic
1110186623 13:72682863-72682885 AAACCAGGGAGCAGCTTAGCTGG + Intergenic
1111370899 13:87314836-87314858 CCAACAGCAAGCAGCTGAGCTGG - Intergenic
1113925947 13:113941747-113941769 CACCCAGAAGGCAGCTGCGCAGG + Intergenic
1114426021 14:22623675-22623697 CAATCAGAAAGCGGCTGCACAGG + Intergenic
1118760427 14:68877675-68877697 CAGCCAGGAAGCAGCAGAACTGG + Intronic
1120782777 14:88500898-88500920 CACCCAGGAAGCAGATGCAGAGG + Intronic
1121137312 14:91510318-91510340 CACCCAGGGAGCAGCTGCAGGGG + Intronic
1121360005 14:93248236-93248258 CAACTAGTAAGCAGCAGAGCCGG + Intronic
1122299274 14:100722862-100722884 CATCCAGGAGACAGCTGGGCAGG - Intergenic
1122816457 14:104316466-104316488 CAACCTGGAAGCACCTGTGACGG - Intergenic
1129737365 15:77973821-77973843 CAGCCAGGAAGCAGAAGGGCTGG + Intergenic
1129848707 15:78779804-78779826 CAGCCAGGAAGCAGAAGGGCTGG - Intronic
1132311317 15:100860009-100860031 CAACCCGGGAGCAGCTTAGCTGG - Intergenic
1132722600 16:1324075-1324097 CAGCCTGCAAGCAGCTGCCCAGG - Intronic
1135250932 16:20900554-20900576 CAACCCGGAGGGAGCTGGGCTGG + Intronic
1135828095 16:25748162-25748184 CAGCCAGGATGCAGCAGCTCTGG - Intronic
1139307985 16:66004307-66004329 CAGCCAGGAAGCAGCAGAGCTGG + Intergenic
1139681073 16:68563744-68563766 GAACAAGGGAGGAGCTGCGCTGG - Exonic
1139761332 16:69187032-69187054 CCTCCCGGAAGCGGCTGCGCCGG + Intronic
1141234418 16:82202144-82202166 CCACCAAGCAGCAGCTGAGCAGG + Intergenic
1141526638 16:84616177-84616199 CAGCCAGGAAGCAGCCGTTCAGG + Intronic
1141749717 16:85950183-85950205 CACACAGGAAGCTGCTGAGCAGG + Intergenic
1141945215 16:87305006-87305028 CAGGCAGGAAGGAGCTGCACTGG + Intronic
1143765778 17:9136876-9136898 CCACGAGGAAGGAGCTGGGCAGG - Intronic
1143973849 17:10815523-10815545 GAACCTGAAAGCAGCTGCTCTGG + Intergenic
1145274770 17:21422879-21422901 CAAGCAGGAAGGAGCTGAGGAGG + Intergenic
1146153550 17:30499027-30499049 AAGCCAGTAAGCAGCTGCCCGGG - Intronic
1148230883 17:45933772-45933794 CAGACAGGAAGAAGCTGCTCTGG + Intronic
1149495380 17:57114164-57114186 CAACCAAGAAGCAACTGCGGAGG - Intronic
1149626126 17:58082413-58082435 CACCCAGGAAGCAGCCCCTCTGG - Intergenic
1151572956 17:74936275-74936297 CACGCAGGAAGCGGCTGCCCCGG + Intronic
1151785875 17:76274782-76274804 CAGCCAGGAAGCGGCAGAGCTGG - Intronic
1151885643 17:76921800-76921822 CAGCCAGGAAGGAGCAGAGCTGG - Intronic
1152438388 17:80289802-80289824 AAACCAGGAAGCAGATGTCCAGG + Exonic
1159957407 18:74529608-74529630 CAACGAGGAACCACCTGCCCAGG - Intergenic
1160032999 18:75278658-75278680 CAACCAGGCAGCAGCAGGCCAGG - Intronic
1160367315 18:78337514-78337536 AAATCAGGATGCAGGTGCGCTGG - Intergenic
1160426254 18:78781241-78781263 CAGTCAGGGTGCAGCTGCGCTGG - Intergenic
1160897156 19:1408206-1408228 CAACCAGGAAGCGGCGGCGGGGG - Intronic
1161323055 19:3650080-3650102 CAACCAGGGTGTAGCTGCGGGGG - Intronic
1161648228 19:5467522-5467544 CAGCCAGGAAGCATCTGAGGAGG - Intergenic
1161994607 19:7704537-7704559 CAACCAGGAGGGGGCTGGGCTGG - Intergenic
1166043568 19:40217057-40217079 CTACCTAGAAGCAGCTCCGCGGG + Intronic
1166703687 19:44896586-44896608 CAGCCAGGAAGCAGAGGAGCTGG + Intronic
1167453371 19:49585159-49585181 CAACCAGGCAGCTGCTGGGATGG - Intronic
1168124719 19:54277123-54277145 CAGCCAGGAAGCGGCAGAGCTGG + Intronic
1168177267 19:54634425-54634447 CAGCCAGGAAGCGGCAGAGCTGG - Intronic
1168181573 19:54665584-54665606 CAGCCAGGAAGCGGCAGAGCTGG - Intronic
925517172 2:4695774-4695796 CAACCAGAAAGCAGCTTAACTGG + Intergenic
925900014 2:8502580-8502602 CAGCCAGGAAGGGGCTGAGCTGG - Intergenic
927562515 2:24084064-24084086 CACCCAGCAGGCAGCTGCGCTGG - Intronic
928303678 2:30147798-30147820 CGAGCAGGAAACAGCTGAGCGGG - Intronic
931652729 2:64483106-64483128 CATCCAGGAAGTGGCAGCGCTGG - Intergenic
931807251 2:65819168-65819190 AAACCAGAAAGCAGCTGCCATGG - Intergenic
931867141 2:66425720-66425742 GAAGCAGAAAGCAGCAGCGCGGG + Intergenic
932684313 2:73855092-73855114 CAACTATGAATCAGCTGCCCAGG + Intronic
934968506 2:98743978-98744000 CAACTAGGAAGTAGCTGAGCTGG + Intergenic
935746582 2:106194363-106194385 CCAGCAGGAAGCAGGCGCGCGGG - Intergenic
936343849 2:111660267-111660289 CAATCAGGAAGCCTCTGAGCTGG - Intergenic
944430559 2:199629075-199629097 GAAGCAGGAAGCAGCAGTGCAGG + Intergenic
948459702 2:238123284-238123306 CACCAAGGAAGCAGCTGTTCAGG + Intronic
948804568 2:240447902-240447924 CAACCAGGAAGCAGCTGCGCCGG - Intronic
1171173792 20:23036464-23036486 CTTCCAGGAGGCAGCAGCGCAGG - Exonic
1172213032 20:33214353-33214375 CAGCCAGGAAGAGGCTGAGCTGG - Intergenic
1173197965 20:40931580-40931602 CAACCTAGAAGCAGCTGCACAGG + Intergenic
1174104623 20:48153414-48153436 CATCCATGGAGCATCTGCGCCGG - Intergenic
1174294652 20:49537023-49537045 CAGCAAGGAAGCAGCAGCGCAGG + Intronic
1175608322 20:60329653-60329675 CAGCCAGAAAGCAGCAGAGCAGG + Intergenic
1179905974 21:44423620-44423642 GAAAGAGGAAGCAGCTGAGCTGG - Intronic
1182024747 22:27109127-27109149 TGCCCAGGAAGCAGCAGCGCAGG + Intergenic
1182308226 22:29386264-29386286 CTGCCAGGAAGCTGCTGAGCTGG + Intronic
1182487218 22:30646752-30646774 CAGACAGGAGGCAGCTGAGCAGG - Exonic
1183096708 22:35556374-35556396 CAGCCAGGAAGGAGCAGAGCTGG + Intergenic
1183189911 22:36315490-36315512 TAAACAGGAAGCACCTGCCCAGG + Intronic
1183545822 22:38454578-38454600 CAACGAGGATGCAGCTGGGGAGG + Intronic
1183695386 22:39418982-39419004 CAACCAGTAAGCGGCAGTGCTGG - Intronic
1183719824 22:39556391-39556413 CAGTCAGGAAGCAGCAGAGCTGG + Intergenic
1184417292 22:44359702-44359724 CCACCAGGAAGCGGCTGAACTGG - Intergenic
1185061467 22:48609205-48609227 CACCCAGGAACCTGCTGAGCTGG - Intronic
1185185409 22:49396433-49396455 CAGCCTGGAAGGAGCTGCTCGGG - Intergenic
1185246277 22:49774969-49774991 GAACCAGGAAGCACCTGCCCGGG + Intronic
949382766 3:3464413-3464435 CAACCAAGAAGTAGCAGAGCTGG - Intergenic
949618952 3:5788318-5788340 CAACCTGGAAGCAGAGGCACAGG - Intergenic
950214653 3:11150782-11150804 GAACAAGGAAGCAGTTGGGCTGG + Intronic
953849012 3:46450914-46450936 CTGCCAGGCAGCAGCTGCACGGG - Intronic
956438819 3:69260412-69260434 CACCCAGCCAGCAGCTGCGGAGG + Intronic
964055108 3:152445494-152445516 CAACCAGGCTGCAGCTGCACAGG + Exonic
965944924 3:174229048-174229070 CAGCCAGGAAGTAGCAGAGCTGG - Intronic
967548627 3:190763105-190763127 ATACCAGGAAGCAGCAGCGAGGG + Intergenic
968285173 3:197504397-197504419 CAACCAGGAAGTTGCAGAGCAGG + Intergenic
968912041 4:3481342-3481364 CAACCAGGCAGCTGCTGCCTGGG - Intronic
969240688 4:5895041-5895063 GAGCCAGGATGCAGCTGCGGTGG - Intergenic
969323785 4:6428848-6428870 CAACCAGGAAGTGGCAGAGCGGG + Intronic
969358810 4:6648170-6648192 CAGGCAGGAAGCATCTGAGCGGG + Intergenic
969592384 4:8129355-8129377 CAAGCTGGAGGCAGCTGAGCTGG - Intronic
969681390 4:8645276-8645298 CAGCCAGGAAGCAGTGGAGCTGG - Intergenic
972641133 4:40926051-40926073 CAACCAGTTCGCAGCTGCTCAGG - Intronic
975431230 4:74293589-74293611 CAACCAGGAATCAAGTGCTCCGG - Intronic
975573899 4:75844161-75844183 CAAACAGGAAGCTGCTGCTGGGG + Intergenic
977659241 4:99563702-99563724 GAACCAGGGAGCAGCTGGGTAGG + Intronic
982133065 4:152247653-152247675 CAGCCAGGATGCAGCGGCCCCGG + Intergenic
984123545 4:175776581-175776603 CAACAACGAAGAAGCTGCCCCGG + Intronic
984275745 4:177607337-177607359 CGGCCAGCAAGCAGCTGCGGAGG - Intergenic
986151541 5:5134235-5134257 CAGCCAGGACGCAGATGCACAGG + Intergenic
986593633 5:9397350-9397372 CAACCAGGAAGTGGCTGAGCTGG - Intronic
987381345 5:17288816-17288838 CAACCAGGAGCCAGCTGGGGAGG + Intergenic
995596950 5:113757500-113757522 CAACCAGGCAGCAGTTCTGCAGG - Intergenic
997346880 5:133198591-133198613 AAAGCAAGAAGCAGCTGCGAGGG + Exonic
1000062683 5:157671057-157671079 CATTCAGGAAGCAGCCGCTCCGG + Intronic
1001102087 5:168822743-168822765 CATCCAGGGAGCAGGTGAGCAGG + Intronic
1001537025 5:172505179-172505201 CAGCCAGCAAGCAGCAGAGCTGG - Intergenic
1001724550 5:173886155-173886177 CAGCTAGGAAGCAGCAGAGCTGG + Intergenic
1002203696 5:177547890-177547912 CAACCATGCAGCTGCTGTGCTGG + Intronic
1007664427 6:43505964-43505986 CACACAGGAAACAGCTGTGCGGG - Exonic
1007685727 6:43666286-43666308 CAGGCAGGCAGCAGCTGGGCTGG + Intronic
1007756467 6:44102778-44102800 CCACCAGTCAGCAGCTGAGCTGG + Intergenic
1013811516 6:114049817-114049839 CATCCAGGCAGCAGCTGACCCGG + Intergenic
1018901887 6:168055795-168055817 CAAGCAGGAGGCATCTGCTCGGG + Exonic
1019390120 7:782051-782073 GAAACCGGACGCAGCTGCGCGGG - Intronic
1019430932 7:999306-999328 CATGCTGGAATCAGCTGCGCCGG + Intronic
1019485150 7:1285884-1285906 CAAGCAGGGAGCGGCTGTGCTGG - Intergenic
1019792424 7:3024870-3024892 AGACCAGGAAGCAGCTACCCAGG + Intronic
1019932750 7:4234582-4234604 CAACCAGGGACCAGCTTTGCCGG - Intronic
1020145040 7:5635624-5635646 CCACCAGGGAGATGCTGCGCTGG + Intronic
1020261476 7:6532812-6532834 CAACCAGGGAGCAGACGCCCAGG + Intronic
1022698038 7:32728780-32728802 CCCCCAGGAAACAGCTGCGCGGG - Intergenic
1022801366 7:33780311-33780333 CAACCTGGACCCAGCTGCCCTGG + Intergenic
1023875475 7:44284090-44284112 CAGCCTGACAGCAGCTGCGCAGG + Intronic
1025148649 7:56527169-56527191 CACCCAGGAAGCAGCTCCTATGG + Intergenic
1029364148 7:100106579-100106601 GAACCAGGCAGCAGCTGCTTCGG - Intronic
1032037817 7:128532179-128532201 CAGCCAGGAAGCAGGAGCGATGG - Intergenic
1034429898 7:151036031-151036053 CATTCAGGAGGCAGCTGGGCTGG - Intronic
1035045352 7:155962103-155962125 CAAGCAGGAAGCAGCTGAGCAGG - Intergenic
1035230913 7:157464970-157464992 CACACAGGAAGCACCTGCTCAGG - Intergenic
1037816853 8:22116979-22117001 CATCCAGGTAGCAGCTGCCTGGG + Exonic
1037892649 8:22631601-22631623 GAACAGGGAAGCAGCTGCCCAGG - Intronic
1039413380 8:37374257-37374279 CAGCCAGAAAGCAGCTCCTCAGG + Intergenic
1039912088 8:41833925-41833947 CAGCCAGGAAGAGGCTGCGGAGG + Intronic
1041231412 8:55756839-55756861 CAACCAGCAAGCAGCCTGGCAGG + Intronic
1044020257 8:87096949-87096971 CAAGCAAGAAGCAGCAGCTCAGG + Intronic
1047338326 8:123956796-123956818 CAGCCAGGAAGCAACAGCGTTGG + Intronic
1047583453 8:126242572-126242594 GATCCAGGCAGCAGCTGCACAGG + Intergenic
1047760668 8:127951716-127951738 CATCCAGGAAGCAGCTGAGCTGG + Intergenic
1049315198 8:141962273-141962295 CAACTACGAGGCAGCTGTGCTGG + Intergenic
1049671464 8:143871978-143872000 CATCCAGGCAGCCGCAGCGCAGG + Exonic
1049852541 8:144840781-144840803 CAGCCAGGAGGCAGCTGAGGGGG + Intronic
1051117255 9:13710014-13710036 CAACTAGTAAGCAGCAGAGCTGG + Intergenic
1051250713 9:15156118-15156140 TAAACAAGAAGCAGCTGCGAGGG - Intergenic
1057079042 9:92158658-92158680 CAACCTCGAAGAAGCTGAGCAGG - Intergenic
1057262049 9:93590455-93590477 CATCCAGGAAGCACCTGCCCTGG - Intronic
1058816801 9:108691830-108691852 CCACAAGGAAGCAGGTGGGCAGG + Intergenic
1059486377 9:114630204-114630226 CAGCCAGGAAACAGCAGAGCTGG + Intronic
1061518974 9:131106232-131106254 GAGCCAGCAAGCAGCTGTGCTGG - Exonic
1062274657 9:135725033-135725055 CACCCAGGAGGCAACTGCGTGGG + Intronic
1062453083 9:136623613-136623635 CAACAAGGAAGGAACTGCTCTGG + Intergenic
1062474216 9:136719476-136719498 CAACGAGGCAGCAGCAGTGCAGG + Intronic
1187961511 X:24570604-24570626 GAACCAGGAAGCAGCCCAGCTGG - Intronic
1189381453 X:40505414-40505436 CAACCAGGAGGAAGCTGCATTGG - Intergenic
1192190571 X:68988926-68988948 CATCCAGGAAGCAGCAGATCAGG + Intergenic
1192226504 X:69231855-69231877 CCACCAGGAAGCAGAGGAGCTGG + Intergenic
1193586188 X:83324480-83324502 CAACCAGTAAGCAGCCAAGCAGG + Intergenic
1195964650 X:110419006-110419028 CAACTAGGAATCAGCTACCCAGG - Intronic