ID: 948805630

View in Genome Browser
Species Human (GRCh38)
Location 2:240452587-240452609
Sequence CCGGACTGCCCGCGGAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 35}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948805615_948805630 27 Left 948805615 2:240452537-240452559 CCTGCACCAAGGCCTGGGCCCGC 0: 1
1: 0
2: 2
3: 37
4: 436
Right 948805630 2:240452587-240452609 CCGGACTGCCCGCGGAGAACAGG 0: 1
1: 0
2: 0
3: 3
4: 35
948805621_948805630 9 Left 948805621 2:240452555-240452577 CCCGCTTAGCTGCAGTGGGGAGC 0: 1
1: 0
2: 1
3: 13
4: 171
Right 948805630 2:240452587-240452609 CCGGACTGCCCGCGGAGAACAGG 0: 1
1: 0
2: 0
3: 3
4: 35
948805613_948805630 29 Left 948805613 2:240452535-240452557 CCCCTGCACCAAGGCCTGGGCCC 0: 1
1: 2
2: 3
3: 68
4: 1085
Right 948805630 2:240452587-240452609 CCGGACTGCCCGCGGAGAACAGG 0: 1
1: 0
2: 0
3: 3
4: 35
948805617_948805630 15 Left 948805617 2:240452549-240452571 CCTGGGCCCGCTTAGCTGCAGTG 0: 1
1: 0
2: 1
3: 8
4: 117
Right 948805630 2:240452587-240452609 CCGGACTGCCCGCGGAGAACAGG 0: 1
1: 0
2: 0
3: 3
4: 35
948805616_948805630 21 Left 948805616 2:240452543-240452565 CCAAGGCCTGGGCCCGCTTAGCT 0: 1
1: 0
2: 1
3: 9
4: 184
Right 948805630 2:240452587-240452609 CCGGACTGCCCGCGGAGAACAGG 0: 1
1: 0
2: 0
3: 3
4: 35
948805622_948805630 8 Left 948805622 2:240452556-240452578 CCGCTTAGCTGCAGTGGGGAGCC 0: 1
1: 0
2: 1
3: 51
4: 181
Right 948805630 2:240452587-240452609 CCGGACTGCCCGCGGAGAACAGG 0: 1
1: 0
2: 0
3: 3
4: 35
948805614_948805630 28 Left 948805614 2:240452536-240452558 CCCTGCACCAAGGCCTGGGCCCG 0: 1
1: 0
2: 3
3: 31
4: 257
Right 948805630 2:240452587-240452609 CCGGACTGCCCGCGGAGAACAGG 0: 1
1: 0
2: 0
3: 3
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948805630 Original CRISPR CCGGACTGCCCGCGGAGAAC AGG Intronic
902600771 1:17539378-17539400 GGGGTCTCCCCGCGGAGAACCGG + Intergenic
913059134 1:115188766-115188788 CCTGACTGCCAGCTGAAAACAGG + Intergenic
1083677043 11:64332092-64332114 TGGGAGTGCCCGGGGAGAACAGG + Intergenic
1086380394 11:86245847-86245869 CCGTCCTGTCCGCGGAGACCGGG + Intronic
1090075512 11:123578088-123578110 CAGGACTGCCCCCTGAGTACCGG + Intronic
1091693358 12:2611748-2611770 CCTGACTGCCCACGGAGAGGTGG + Intronic
1093993796 12:25619684-25619706 CCGTCCTGCCCACGGAGCACTGG - Intronic
1117387497 14:55230739-55230761 CCTGACTGCCTGCGCACAACAGG + Intergenic
1118109148 14:62696436-62696458 CCTGCCTGCCCGAGGAGAAAAGG - Intergenic
1128743513 15:70098710-70098732 CCCGGCTGCCCGTGGACAACAGG + Intergenic
1132942478 16:2514826-2514848 TCGGAGAGCCCGCGGAGACCCGG + Intronic
1135115057 16:19717254-19717276 ACGTACTGCCCGCGGATAATGGG + Intronic
1143905653 17:10207265-10207287 CCGGACTGCAAGGGGAGAACTGG - Intergenic
1147155929 17:38544482-38544504 CAGGCCTGCCCGCGGGGCACTGG + Intronic
1151772938 17:76177060-76177082 CCAGACTGCCCGTGAAGCACCGG + Intronic
1152152168 17:78608933-78608955 CCGGACTGTCCCTGGAGCACAGG - Intergenic
1152432074 17:80254078-80254100 CGGGACTGCCCGGGCAGAACGGG - Intergenic
1152844849 17:82593457-82593479 CCGCACAGCACGCGGTGAACAGG - Intronic
1155075255 18:22348752-22348774 CCGCACTGGGCGCGGAGAAGAGG - Intergenic
1163157928 19:15449394-15449416 GGGCACTGCCCGCGGGGAACGGG + Intronic
1167430829 19:49453474-49453496 CGGGACTCCCCGCGAAAAACCGG - Intronic
927126174 2:20013497-20013519 ACTGACTGCCTGCGGAGACCAGG + Intergenic
941537767 2:166743155-166743177 CAGGACTGACCTCGGAGAAGAGG + Intergenic
947753074 2:232542867-232542889 CCTGCCTGCCCGCAGAGAATGGG + Exonic
948805630 2:240452587-240452609 CCGGACTGCCCGCGGAGAACAGG + Intronic
1176035912 20:63036346-63036368 GCTGACTGCCCGAGGAGACCAGG - Intergenic
961665130 3:128489644-128489666 CCGGCCTGGCCGCGGAGGCCCGG - Intronic
977065305 4:92305675-92305697 CGGGACTGGCCGCGGCGAGCAGG + Intronic
978777140 4:112515692-112515714 CAGGACCGCCCGCGGAGGGCAGG - Intronic
981948243 4:150375229-150375251 CAGGACTGCAGGAGGAGAACGGG - Intronic
1001203315 5:169738893-169738915 CCAGGCTGCCCGCAGAGGACAGG - Intronic
1006173780 6:32109830-32109852 CCAGACTGCCAGGGGAGAACTGG - Intronic
1017324529 6:153130774-153130796 CCAGAGTTCCCGCGGAGAGCGGG - Intronic
1021162935 7:17298696-17298718 CCGGACCGCCAGCTCAGAACAGG + Exonic
1033647476 7:143316310-143316332 ACGGACTGCCCTCTGAGAATGGG + Exonic
1040807226 8:51408307-51408329 CCAAACAGCCCCCGGAGAACCGG + Exonic
1044343036 8:91070129-91070151 CCAGACTGCGAGCGGAGAAGCGG - Intergenic
1061584696 9:131558232-131558254 CCGGAATGTCCACGGAAAACTGG + Intergenic
1200747545 Y:6915792-6915814 CCGGACTCCCAGCAGAAAACTGG - Intronic