ID: 948806063

View in Genome Browser
Species Human (GRCh38)
Location 2:240453807-240453829
Sequence CGTCGCCGCCCTGGGGGTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 119}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948806063_948806073 15 Left 948806063 2:240453807-240453829 CCGGGACCCCCAGGGCGGCGACG 0: 1
1: 0
2: 0
3: 15
4: 119
Right 948806073 2:240453845-240453867 CCGAGCCTTTGTTCCGCCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 26
948806063_948806074 16 Left 948806063 2:240453807-240453829 CCGGGACCCCCAGGGCGGCGACG 0: 1
1: 0
2: 0
3: 15
4: 119
Right 948806074 2:240453846-240453868 CGAGCCTTTGTTCCGCCGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 36
948806063_948806075 17 Left 948806063 2:240453807-240453829 CCGGGACCCCCAGGGCGGCGACG 0: 1
1: 0
2: 0
3: 15
4: 119
Right 948806075 2:240453847-240453869 GAGCCTTTGTTCCGCCGCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 40
948806063_948806077 21 Left 948806063 2:240453807-240453829 CCGGGACCCCCAGGGCGGCGACG 0: 1
1: 0
2: 0
3: 15
4: 119
Right 948806077 2:240453851-240453873 CTTTGTTCCGCCGCCGGGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948806063 Original CRISPR CGTCGCCGCCCTGGGGGTCC CGG (reversed) Intronic
900362068 1:2293911-2293933 CCGCGCCACCATGGGGGTCCAGG + Intronic
902336853 1:15758953-15758975 GGGCGCCGCGCCGGGGGTCCCGG - Intronic
904158282 1:28503017-28503039 CGTTTCAGCCCTGGTGGTCCAGG + Intergenic
904211046 1:28887216-28887238 GGTCGCCCCCCAGGTGGTCCAGG - Intronic
905202136 1:36322555-36322577 CGTCGTCGTCCTCGGGCTCCAGG + Exonic
905752391 1:40477349-40477371 CGCTGCAGCCCTGGCGGTCCCGG - Exonic
906321506 1:44820310-44820332 CGGCGCCGCCCACGGGGTGCGGG - Intronic
907883907 1:58576271-58576293 CGTCGCCGGCATGGCCGTCCTGG - Exonic
919724610 1:200873595-200873617 CCTCGCCGCACTGGCTGTCCTGG - Exonic
919892084 1:201982873-201982895 CGGCGGCGCCCTCGGGCTCCAGG - Exonic
1062809360 10:450673-450695 TGTCGTCACCCTGGGGGTCTTGG - Intronic
1067436931 10:46284901-46284923 CGCCGCCGCCCTCTGGCTCCTGG + Intergenic
1069024213 10:63521935-63521957 CGGCACCGCCCTGCGGGCCCGGG + Intronic
1069474565 10:68721384-68721406 CGTCGCCGCCCGGGGCCGCCGGG - Intronic
1070320833 10:75353465-75353487 GGTGGCTGCCCTGAGGGTCCTGG - Intergenic
1071531486 10:86392926-86392948 GGTCTCCTCCCTGTGGGTCCTGG + Intergenic
1072705805 10:97679958-97679980 CTTCCCAGACCTGGGGGTCCTGG + Intronic
1073509564 10:104034707-104034729 CCTCGAGGCCCTGGGGGACCAGG + Exonic
1074121737 10:110498367-110498389 CGTCGCGGCCGTGGTGGTGCTGG + Exonic
1076373595 10:129969405-129969427 CGTCGCCCCGCTGCGGGGCCGGG - Intergenic
1083256198 11:61496764-61496786 CATCGCTTCCCTGGGGGTCTCGG + Intergenic
1089466614 11:118689994-118690016 CGGGGACGCCCTGGGGGTACGGG + Intergenic
1089605616 11:119639730-119639752 CCTCCCCACCCTGGGGGACCAGG - Intronic
1091445984 12:544323-544345 CGTCTCCGCCCTGCAGTTCCGGG + Exonic
1092193335 12:6535132-6535154 CGTCCCCCACCTAGGGGTCCGGG - Intronic
1092650646 12:10631338-10631360 TTTCCCCGCCCTGGGGATCCCGG + Intronic
1096250067 12:50025299-50025321 CGTGGCCGCCGCGGGGGTCCGGG - Intronic
1096526349 12:52212463-52212485 CCTCCCAGCCCTGGGGGCCCTGG - Intergenic
1096622684 12:52874327-52874349 CGGCGCCGCCCTGGGGCCCCCGG - Intergenic
1096994098 12:55828414-55828436 CATGGCCCCCCAGGGGGTCCAGG - Exonic
1102937585 12:116910917-116910939 CGCCGCCGCTCTAGGGTTCCGGG - Intergenic
1103464803 12:121133390-121133412 CGCCTCCTCCCTGGGGATCCAGG - Intronic
1104924994 12:132309337-132309359 CGCAGCCGCCCTGGAGGTCGAGG + Intronic
1107079280 13:36357091-36357113 TGTGGTTGCCCTGGGGGTCCAGG + Intronic
1113378046 13:109782654-109782676 TGGCGCCGCGGTGGGGGTCCGGG + Exonic
1113656874 13:112072939-112072961 CGCCGCTGTCCTTGGGGTCCCGG + Intergenic
1113912806 13:113852288-113852310 CGTCCCCGTGCTGGGGGTTCCGG + Intronic
1115474482 14:33800380-33800402 CGCCGCCGCCCTGCGGGGACGGG - Exonic
1117424473 14:55580413-55580435 CGGCGCCGGCCGCGGGGTCCTGG + Intronic
1119420612 14:74505837-74505859 CGTCGCCACCCTGTAGCTCCTGG + Intronic
1122150323 14:99722070-99722092 GGTGGAGGCCCTGGGGGTCCTGG + Intronic
1125503128 15:40251954-40251976 CCTAGCCGCTCTGGGGGTGCGGG + Exonic
1129450378 15:75648007-75648029 CCTCTCCGCCCTGCGGGGCCCGG - Exonic
1132251968 15:100341298-100341320 CGTCGCCGCCGTCGGGGCCCGGG + Exonic
1132826536 16:1908129-1908151 CCTCACAGCCCTGGGAGTCCAGG - Intergenic
1133241331 16:4416181-4416203 CTGCGCCGCCTCGGGGGTCCCGG + Intronic
1135607422 16:23836376-23836398 CGGCGCTGCCCTCGGGGGCCCGG - Intronic
1136453954 16:30370097-30370119 CGCCGCCGCCCCGGGGTTCCCGG - Exonic
1136910594 16:34141548-34141570 CCACGCCGCCCTGGGGACCCGGG + Intergenic
1139364833 16:66427048-66427070 CGCCGCCGCCGAGGGGGGCCGGG + Intergenic
1139528155 16:67528989-67529011 CGGCGCCGCCCGGTGGGTCCGGG + Intronic
1143490951 17:7284976-7284998 CTTCACCTCCCTGGGTGTCCCGG + Intronic
1143639880 17:8189847-8189869 CGGCGCCCCCCTGCGGCTCCCGG + Exonic
1146034059 17:29390718-29390740 CGTCGCCGCCTCGGGGGAACCGG - Exonic
1146907083 17:36624725-36624747 TGTCCCGGCCCTGGGGGTCCTGG + Intergenic
1148397733 17:47323819-47323841 CGCCACCGCCCAGGGGCTCCGGG - Intronic
1149678499 17:58487738-58487760 CGCCGCCGCCCGCGGGGCCCCGG - Exonic
1151930846 17:77230489-77230511 TGTCTCCTCCCTCGGGGTCCTGG - Intergenic
1152383192 17:79952781-79952803 CGACGCCGGCCTGCGGTTCCCGG - Exonic
1152587064 17:81193876-81193898 ACTCCCCGCCCTGAGGGTCCTGG + Intronic
1155002907 18:21704310-21704332 CGCCCGCCCCCTGGGGGTCCCGG - Intronic
1160505859 18:79426602-79426624 TGCCGCCCCTCTGGGGGTCCGGG - Intronic
1160985730 19:1837695-1837717 GATCGCAGCCCTGGGGGTCGAGG - Intronic
1161473445 19:4472585-4472607 CGGCCCCGCCCTGGGGGTCTGGG + Intronic
1161473621 19:4473091-4473113 CGCCGACGGTCTGGGGGTCCCGG + Intronic
1161773015 19:6241582-6241604 CGTCCCAGCCTTGGAGGTCCTGG + Intronic
1162199490 19:9010319-9010341 CGTCGGTGCCCTGGGTGTGCAGG + Intergenic
1162340198 19:10087175-10087197 CGTCGCGGCTCTGGGTGGCCTGG + Intronic
1163557638 19:18001606-18001628 GGTCGCGGCCGAGGGGGTCCCGG - Intronic
1165657953 19:37550161-37550183 CGTCCCCGCCAAGGTGGTCCTGG - Intergenic
1166802623 19:45467805-45467827 CCTCGGGGCCCTGGGGGTCTCGG - Intronic
925927046 2:8678255-8678277 CCTCTCCGCCCTGGGGGAGCCGG - Intergenic
932494892 2:72141357-72141379 CCTGGCTGCCCTGGTGGTCCTGG - Intronic
932624173 2:73284608-73284630 CGGCGCCGCCCTAGGGGTGTAGG + Intergenic
932892478 2:75609036-75609058 CTGCGCTGCCCTGGGGCTCCTGG + Intergenic
947917812 2:233845527-233845549 TGGCGCTGCCCTGGGGGACCTGG + Intronic
948806063 2:240453807-240453829 CGTCGCCGCCCTGGGGGTCCCGG - Intronic
1168904591 20:1392986-1393008 CGCCGCCGCCATGGGAGTGCAGG - Exonic
1171382736 20:24745802-24745824 GGTCCCTGCCCTGGAGGTCCTGG - Intergenic
1173023493 20:39287205-39287227 CATCGCAGGCCTGGAGGTCCAGG + Intergenic
1175295817 20:57908026-57908048 CGTACTGGCCCTGGGGGTCCTGG - Intergenic
1175402859 20:58710538-58710560 CTTGGCCGCCCTGGGGGACCAGG + Intronic
1176113320 20:63420518-63420540 CGTCGCCACGCTGGGGTTCCTGG - Intronic
1176207114 20:63895206-63895228 CGCCGCCGCCCGGGGTCTCCAGG + Exonic
1182360652 22:29744578-29744600 CATCCCAGCCTTGGGGGTCCAGG - Intronic
1183335776 22:37244993-37245015 TGAGGCCGCCCTGGGGGACCAGG + Intergenic
1183619497 22:38964423-38964445 CCTGGGAGCCCTGGGGGTCCTGG + Intronic
1184004305 22:41697341-41697363 CGCTGCCGGCCTGGGGGTCCTGG - Exonic
1184059815 22:42074729-42074751 AGTGGCCTCACTGGGGGTCCTGG - Intronic
1184289105 22:43488887-43488909 CCTCACCACCCTGAGGGTCCAGG - Intronic
1184865021 22:47197451-47197473 CGCCCCCGCCCTGTGGGTGCCGG + Intergenic
1185313821 22:50170427-50170449 CGCCGCCGCCCCCGGGGTCAGGG - Intergenic
950316395 3:12004941-12004963 CGCCGCCGCCCTCGGGGGTCGGG + Intronic
953858201 3:46517997-46518019 AGTGGTCACCCTGGGGGTCCTGG - Exonic
958714630 3:97764688-97764710 CCACGCCTCCCCGGGGGTCCTGG - Exonic
968534407 4:1113969-1113991 CGTGGGGGCCCTGGGGGCCCGGG + Intergenic
969214508 4:5711311-5711333 CGTCGCCGCCCTGGCGGGGACGG + Exonic
969379154 4:6782920-6782942 GCTCGCCGCCGTGGGGCTCCGGG + Intronic
969575302 4:8033120-8033142 CGGCTCTGCCGTGGGGGTCCTGG + Intronic
973854996 4:55002503-55002525 CGTGCCCACCCTGGGGGTCTGGG - Intergenic
980550336 4:134327443-134327465 CATCGACGCCCGGGGGGACCTGG + Intergenic
982712211 4:158768951-158768973 CGCCGCCGCCGTGGGGCTGCGGG + Intergenic
985537578 5:473599-473621 CGTCCCCCCGCCGGGGGTCCCGG + Intronic
986320976 5:6632814-6632836 CCTCGCAGGCCTCGGGGTCCGGG + Intronic
994021939 5:95037209-95037231 TGGCTACGCCCTGGGGGTCCAGG - Intronic
998142904 5:139709893-139709915 CGACGGGGCGCTGGGGGTCCGGG + Intergenic
998254664 5:140575434-140575456 CCTGGCCACCTTGGGGGTCCAGG + Intronic
999230609 5:150059740-150059762 CGACGCCTCCCTCGGGGTCCTGG + Exonic
999262239 5:150245247-150245269 CGTCCTCGCCCTGTGGGCCCTGG - Intronic
1002082085 5:176743299-176743321 CGTCCCTGCCCCGGGGGTGCGGG + Intergenic
1003084961 6:3053693-3053715 CGGCTCCGCCCTGGGGGACCAGG + Intergenic
1010781129 6:79947267-79947289 CATCGCCGCGATGGGGCTCCTGG - Exonic
1018727890 6:166627482-166627504 CAGCGCCGCCCTGTGGTTCCAGG + Intronic
1019291073 7:250594-250616 CCTCCCCACCCTGGGAGTCCAGG + Intronic
1020071212 7:5228164-5228186 CGCCGCCCTCCTGGGGGTCCAGG - Exonic
1020080275 7:5282949-5282971 CGTCGCCGCGCTCGTGGACCGGG + Exonic
1029449729 7:100634028-100634050 CGGCGCCGCCCTGGTGGTGATGG - Intronic
1034275519 7:149822160-149822182 AGTAGCAGCCCTGGGTGTCCAGG - Intergenic
1034338342 7:150337557-150337579 TGTCGCTGGCCTGGCGGTCCAGG - Exonic
1034545930 7:151789396-151789418 CGTCCTTGCCCTGGGGGTCCAGG + Intronic
1035169416 7:157009484-157009506 CGTCTCATGCCTGGGGGTCCGGG + Intronic
1039904180 8:41774108-41774130 CTTCCCTGCCCAGGGGGTCCTGG - Intronic
1040386538 8:46918231-46918253 CGTCTCCTGCCTGGAGGTCCTGG - Intergenic
1041588270 8:59546753-59546775 CATCCCTGCCCTGGGGGTCAGGG - Intergenic
1047225691 8:122953838-122953860 CGTCGCTACCCTGGCCGTCCCGG - Exonic
1049582894 8:143420832-143420854 CGTCTCTGCCCTCTGGGTCCTGG - Intronic
1052966580 9:34345043-34345065 TGTCACTGACCTGGGGGTCCAGG - Intergenic
1057139103 9:92716119-92716141 CCTCACCGCCCTGGGAGCCCTGG - Intronic
1057245619 9:93451906-93451928 CGCCGCCGCCATGGGCGTGCAGG + Exonic
1060224519 9:121782921-121782943 CCTCGCCTCCTTGGGGGGCCCGG + Intronic
1061824865 9:133251921-133251943 CGTGGCCGCACTAGGGGTGCTGG - Intronic
1062626044 9:137441849-137441871 GGCCGCCGCCGTCGGGGTCCGGG + Intergenic
1187154705 X:16712290-16712312 CGCCGAGGCCCTGGGGGTCTGGG + Intronic
1187281291 X:17860477-17860499 CGTCGGCGCCCCGGGAGCCCCGG - Intronic
1199793819 X:151177424-151177446 CGCCGCGGCCCTGGGGCTCCAGG + Intronic