ID: 948806063

View in Genome Browser
Species Human (GRCh38)
Location 2:240453807-240453829
Sequence CGTCGCCGCCCTGGGGGTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 119}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948806063_948806075 17 Left 948806063 2:240453807-240453829 CCGGGACCCCCAGGGCGGCGACG 0: 1
1: 0
2: 0
3: 15
4: 119
Right 948806075 2:240453847-240453869 GAGCCTTTGTTCCGCCGCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 40
948806063_948806073 15 Left 948806063 2:240453807-240453829 CCGGGACCCCCAGGGCGGCGACG 0: 1
1: 0
2: 0
3: 15
4: 119
Right 948806073 2:240453845-240453867 CCGAGCCTTTGTTCCGCCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 26
948806063_948806074 16 Left 948806063 2:240453807-240453829 CCGGGACCCCCAGGGCGGCGACG 0: 1
1: 0
2: 0
3: 15
4: 119
Right 948806074 2:240453846-240453868 CGAGCCTTTGTTCCGCCGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 36
948806063_948806077 21 Left 948806063 2:240453807-240453829 CCGGGACCCCCAGGGCGGCGACG 0: 1
1: 0
2: 0
3: 15
4: 119
Right 948806077 2:240453851-240453873 CTTTGTTCCGCCGCCGGGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948806063 Original CRISPR CGTCGCCGCCCTGGGGGTCC CGG (reversed) Intronic