ID: 948806233

View in Genome Browser
Species Human (GRCh38)
Location 2:240454413-240454435
Sequence GTCCGAGAGCAGATGGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 159}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948806229_948806233 -8 Left 948806229 2:240454398-240454420 CCGGAGCTGGTTGGGGTCCGAGA 0: 1
1: 0
2: 2
3: 4
4: 93
Right 948806233 2:240454413-240454435 GTCCGAGAGCAGATGGGCCAGGG 0: 1
1: 0
2: 1
3: 21
4: 159
948806228_948806233 -5 Left 948806228 2:240454395-240454417 CCACCGGAGCTGGTTGGGGTCCG 0: 1
1: 0
2: 0
3: 7
4: 61
Right 948806233 2:240454413-240454435 GTCCGAGAGCAGATGGGCCAGGG 0: 1
1: 0
2: 1
3: 21
4: 159
948806221_948806233 11 Left 948806221 2:240454379-240454401 CCGGAGGATGCCACAGCCACCGG 0: 1
1: 1
2: 0
3: 13
4: 171
Right 948806233 2:240454413-240454435 GTCCGAGAGCAGATGGGCCAGGG 0: 1
1: 0
2: 1
3: 21
4: 159
948806224_948806233 1 Left 948806224 2:240454389-240454411 CCACAGCCACCGGAGCTGGTTGG 0: 1
1: 0
2: 2
3: 23
4: 891
Right 948806233 2:240454413-240454435 GTCCGAGAGCAGATGGGCCAGGG 0: 1
1: 0
2: 1
3: 21
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948806233 Original CRISPR GTCCGAGAGCAGATGGGCCA GGG Intronic
901828679 1:11879125-11879147 GTCTGAGAGCAGCTGCACCAAGG - Intergenic
902386090 1:16076758-16076780 GTCACAGGGCAGATGGGCTATGG - Intergenic
902408493 1:16199436-16199458 GTAGGAGAGGAGATAGGCCAGGG - Intronic
903305095 1:22407778-22407800 GTCAGAGAGGAGAGTGGCCATGG + Intergenic
904824497 1:33265619-33265641 GGCAGAGGGCAGAGGGGCCATGG + Intronic
906860489 1:49353823-49353845 GTCAGAGAGAAGACTGGCCATGG + Intronic
907630722 1:56079314-56079336 GTCCAAGAGCATATTGGCTAAGG + Intergenic
907872371 1:58454701-58454723 GGCCTAGAGCAGAGGGGACAAGG - Intronic
908391000 1:63683576-63683598 GTTCGAGACCAGCTTGGCCATGG - Intergenic
909433554 1:75616069-75616091 GGCCGAGAGCAGAGGGGCGGCGG - Intergenic
913671055 1:121097656-121097678 GCCCGAGAGCAGGCGGGCCCGGG - Intergenic
916294291 1:163199959-163199981 GTTTGAGAGCAGGTGGGGCATGG - Intronic
917140820 1:171833623-171833645 GACAGAAAGCAGCTGGGCCAAGG - Intergenic
922904190 1:229161421-229161443 GTTCGAGACCAGACTGGCCAAGG - Intergenic
923024558 1:230194487-230194509 GTCAGAGAGGGGATGGGCCCAGG - Intronic
1063471922 10:6294813-6294835 ATCCAAGAGCAGATGGGAAATGG - Intergenic
1070125002 10:73613999-73614021 GTTCGAGACCAGCTAGGCCATGG + Intronic
1072206426 10:93208967-93208989 TTCCAAGACCTGATGGGCCACGG - Intergenic
1073107736 10:101042116-101042138 GTCAGAGAAAAGATTGGCCAGGG + Intergenic
1075102850 10:119518329-119518351 GTCCCCGAGTTGATGGGCCAAGG - Intronic
1076523593 10:131096195-131096217 GGCCAGGAGAAGATGGGCCAGGG + Intronic
1076624929 10:131815943-131815965 GTCAGAGAGCCCATGGGGCAGGG + Intergenic
1076864759 10:133161116-133161138 GTCCATGAGCAGAAGCGCCAGGG - Intronic
1076903101 10:133349610-133349632 GTCCCAGAGCTGCGGGGCCACGG - Intronic
1078428322 11:11268878-11268900 GTCCAGGTGCAGATGGGCCATGG + Intergenic
1083176719 11:60954720-60954742 GCCCCAGAGCTGGTGGGCCATGG + Intergenic
1084514580 11:69629556-69629578 GTCTGAGAGCAGAGCTGCCAGGG - Intergenic
1084946302 11:72640651-72640673 GTCAGAGAGGAGTTGGGGCAGGG - Intronic
1088587097 11:111368920-111368942 CTCCGATGACAGATGGGCCATGG - Intronic
1088620800 11:111681296-111681318 GTCTGTGAGCAGAAGGCCCAAGG + Intronic
1089213023 11:116819266-116819288 GAGCGAGAGCAGCTGGGGCAGGG + Intergenic
1091921153 12:4305936-4305958 GTCCAAGAGCAGCTGGGCCTAGG - Intergenic
1092947639 12:13471827-13471849 GCCCAAGTGCAGATGGGCTAGGG - Intergenic
1093091638 12:14928107-14928129 GTCCAAGAGCAGATGGCCTAAGG - Intronic
1093369402 12:18349058-18349080 TTCCCAGAGCAGATGATCCAAGG + Intronic
1093937771 12:25019493-25019515 GTCAGAGAGAAGTTTGGCCAGGG - Intergenic
1094745614 12:33341286-33341308 GTCAGAGAGGAGATGAGCCGTGG - Intergenic
1095089153 12:38087942-38087964 GCCTGAGAGCAGACAGGCCAGGG - Intergenic
1096600350 12:52724465-52724487 GCCCCAGAGCAGAGGGGCCTCGG - Intergenic
1096653737 12:53075521-53075543 GTAGGAGAGCAGAAGGGACAGGG + Intronic
1104114794 12:125738845-125738867 GTTGCAAAGCAGATGGGCCAGGG + Intergenic
1108594457 13:51937750-51937772 GGCCGAGGGCAGAGGGGGCAAGG - Intronic
1109589749 13:64462835-64462857 GTCAGAGAGGAGATCAGCCATGG + Intergenic
1109776540 13:67048386-67048408 GGCCCTGAGCATATGGGCCAGGG - Intronic
1112261519 13:97882099-97882121 GTCAGTGAGTAGATCGGCCACGG - Intergenic
1113403474 13:110017425-110017447 CTCTGAGAGCAGGTGAGCCAAGG + Intergenic
1117252424 14:53950756-53950778 TTCCGGGAGCAGGTGGACCAGGG - Exonic
1121277812 14:92679574-92679596 GTCCCAGGGCAGAGGGGCAAGGG + Intronic
1121392615 14:93589224-93589246 GGACGAGAGCAAATGGGCAAAGG + Intronic
1121635302 14:95449988-95450010 CTCCAAGAGCCGCTGGGCCAGGG + Exonic
1122573235 14:102723084-102723106 TTCCCAGAGCAGATGAGCCTGGG + Intronic
1122634486 14:103123661-103123683 GTCCGGGCGCAGAGGGGCCAAGG + Exonic
1124530045 15:30497954-30497976 GTTGGAGAACAGATTGGCCACGG + Intergenic
1124768614 15:32509734-32509756 GTTGGAGAACAGATTGGCCACGG - Intergenic
1129339224 15:74873888-74873910 GTCCCAAAGCTGATGGGCCCAGG - Intergenic
1129767437 15:78179196-78179218 CTAGGAGAGCAGATGGCCCAGGG - Intronic
1131211072 15:90497046-90497068 GTCCCAGAGCAGATGGTACTTGG + Intronic
1132463252 16:65965-65987 GCCCCAGAGCAGATAGGCCAGGG + Intronic
1132480010 16:162723-162745 GACCTAGAGCACATGGGCCCTGG - Intronic
1132727709 16:1345925-1345947 GTGGGAGAGGAGATGGGGCAGGG + Intronic
1133076317 16:3283594-3283616 GTCCTGGCGCAGATGGGCCACGG + Exonic
1135198940 16:20420049-20420071 AGCCGAGAGCAGATGTGCCTTGG + Intronic
1138455893 16:57120511-57120533 GTCTGAGAGCAGATGGGACTGGG + Intronic
1139801911 16:69529783-69529805 GTTCCCGAGCAGATGGCCCAGGG + Intergenic
1140932137 16:79637608-79637630 GTCTGAGTTCAGATGTGCCAGGG - Intergenic
1141065073 16:80907746-80907768 GTCACAGAGCAAAAGGGCCAGGG - Intergenic
1141134708 16:81457844-81457866 GGCCAAGAGCCGGTGGGCCACGG + Intronic
1142610755 17:1108359-1108381 GCCCCAGAGCGGGTGGGCCAGGG + Intronic
1142692439 17:1614896-1614918 GTCCAAGAGCAGGTGGGCCTGGG + Intronic
1142848918 17:2695006-2695028 GTCGGCGGGCAGGTGGGCCACGG + Exonic
1144023086 17:11254265-11254287 ATCCCACAGCAGAGGGGCCAAGG - Intronic
1147122457 17:38343683-38343705 GGCAGAGAGCGGATGGGCCGTGG + Exonic
1147671756 17:42180659-42180681 GGCCGAGAGCACGGGGGCCAAGG - Intronic
1149374436 17:56030241-56030263 GACAGAGACCAGATGGCCCATGG + Intergenic
1151955695 17:77379147-77379169 GACCAAGGGCTGATGGGCCAAGG + Intronic
1152400512 17:80063701-80063723 GTCCGAGACCAGCCTGGCCATGG - Intronic
1152708658 17:81859289-81859311 TTCCGAGATCAGGTTGGCCAAGG - Exonic
1160127454 18:76189539-76189561 GTCCGAGAGGAGATCGGCCCAGG + Intergenic
1161348091 19:3777899-3777921 GTCCGAGAGCAGATCACCAAAGG + Intergenic
1161356312 19:3821146-3821168 GTTCCAGAGCAGACGGGCAAGGG - Intronic
1161784775 19:6317410-6317432 GTCCAAGGACAGATGGGACAGGG + Intronic
1163400149 19:17087220-17087242 GTCGGAGAGCACTTGGGCCACGG + Intronic
1164058388 19:21642869-21642891 GTCCGAGACCAGCCTGGCCAAGG - Intergenic
1167679891 19:50912695-50912717 GGCCAGGAGCAGAGGGGCCAAGG + Intergenic
925715838 2:6783447-6783469 GTCAGAGAGCACATTGGTCAGGG - Intergenic
927240286 2:20915024-20915046 GTCTGATAGCAGACAGGCCATGG - Intergenic
927864090 2:26577673-26577695 GGCCGAGAGCAGGTGCCCCATGG - Intronic
928948546 2:36793420-36793442 GTCCCTGAGCAGATTGGCCCAGG + Intronic
932360228 2:71099016-71099038 TTTGGGGAGCAGATGGGCCAAGG - Intergenic
933184595 2:79264959-79264981 GAAGCAGAGCAGATGGGCCAGGG - Intronic
933425941 2:82112481-82112503 GTCAGAGAGGAGATCGGCTATGG + Intergenic
933637050 2:84720026-84720048 GTCTGAGAGGAGAAGGGCTAGGG + Intronic
935410525 2:102757188-102757210 GTCCAAGAGTAGATGAGCCTGGG - Intronic
936524097 2:113231292-113231314 GTCCCAGAGCAGCTGGGACCAGG + Intronic
937155226 2:119714264-119714286 ATCCTACAGCAGATCGGCCATGG - Intergenic
941996427 2:171605775-171605797 GTCAGAGAGGAGTTTGGCCAGGG - Intergenic
946361929 2:219224095-219224117 GACCGTGTGCAGGTGGGCCAGGG - Exonic
947635956 2:231680932-231680954 CTCCGAGCGCAGCTGGGCCGGGG + Intergenic
948581313 2:238988886-238988908 GTGAGTGAGCAGATGGGACAGGG - Intergenic
948806233 2:240454413-240454435 GTCCGAGAGCAGATGGGCCAGGG + Intronic
1169959635 20:11144861-11144883 GTCCCGGAGCAGATGTTCCATGG + Intergenic
1172401330 20:34654257-34654279 GTTCGAGAGCAGCCTGGCCAAGG + Intronic
1174286602 20:49478535-49478557 TTCTGAGAGCAGCAGGGCCAGGG - Intronic
1175840775 20:62025819-62025841 GACAGAAAGCAGATGGGACAAGG + Intronic
1176062028 20:63176647-63176669 CTCCGAGGGCAGATGGCGCAGGG + Intergenic
1177901618 21:26924177-26924199 GTCCTAGAGCAGGCGAGCCATGG + Exonic
1182662878 22:31937354-31937376 GACCTTGAGAAGATGGGCCACGG + Intronic
1183195661 22:36351879-36351901 TACCGAGAGCAGAAGGGGCAGGG + Intronic
1184856648 22:47150019-47150041 CACCAGGAGCAGATGGGCCAGGG + Intronic
1185032796 22:48453563-48453585 CTGAGAGAGCAGATGGGGCAAGG + Intergenic
1185369698 22:50455380-50455402 GTCTGAGAGCAGCTGCACCAAGG + Exonic
950465479 3:13150904-13150926 GTGTGAAAGCAGATGGTCCAGGG + Intergenic
952109759 3:30109033-30109055 GTCAGAGAGGAGTTCGGCCAGGG + Intergenic
952865823 3:37854563-37854585 CTCCCAGAGCAGAGGGGGCAGGG - Intergenic
953187608 3:40653148-40653170 GGCTGAGGGCAGATGGGGCAAGG + Intergenic
954121564 3:48503229-48503251 GTCAGAGAGCATTTGTGCCATGG - Intronic
959773981 3:110134780-110134802 GTCAGAGAGGAGATTGGCCATGG + Intergenic
961895828 3:130167058-130167080 GTCTGGCAGAAGATGGGCCAGGG + Intergenic
962433967 3:135347462-135347484 GTCAGAGAGCTGATGAGGCAAGG - Intergenic
963065572 3:141261028-141261050 GTCCTAGAGGAGAAGGGGCAAGG - Intronic
963439687 3:145322244-145322266 ATCAGAAAGCAGATGGGCCTTGG + Intergenic
968540755 4:1167228-1167250 GGCTGAGAGCAGACGGGACACGG + Exonic
968954991 4:3713751-3713773 GTGGGAGAGCAGATTGGCCTCGG - Intergenic
969708855 4:8831344-8831366 GTCAGAGAGCACATGGCTCAGGG - Intergenic
970539299 4:17061113-17061135 GTCAGTGAGCAGATGGACCATGG + Intergenic
980459702 4:133092501-133092523 TTCCGCCAGCAGATGTGCCAGGG + Intergenic
980971191 4:139568715-139568737 GTCCTGGAGCAGCTGGGCCTGGG + Intronic
981362761 4:143866490-143866512 GTCAGAGAGGAGATAGGCCATGG + Intergenic
981373495 4:143987290-143987312 GTTGGAGAGGAGATAGGCCATGG + Intergenic
981382596 4:144090561-144090583 GTCAGAGAGAAGATAGGCCATGG + Intergenic
984873638 4:184348847-184348869 GTCCTTGAGCACATGGGACATGG + Intergenic
985631380 5:1015841-1015863 GTCCAACAGGAGAGGGGCCACGG - Intronic
985681264 5:1257088-1257110 GGCCGAGATGCGATGGGCCACGG - Intronic
987932139 5:24415140-24415162 GTTAGAGAGGAGATCGGCCACGG - Intergenic
991321404 5:65377261-65377283 GTCATAGAGCACATGGGCAAAGG - Intronic
993773532 5:91962442-91962464 GTCAGAGAGGAGATTGGCCATGG + Intergenic
997023131 5:130025697-130025719 CTCCCATAGCAGAAGGGCCAGGG + Intronic
997468355 5:134102946-134102968 GTCCCAGAGAAGGTGGGACAGGG + Intergenic
997976901 5:138446149-138446171 GTCCTAGCCCAGATGGACCAAGG + Exonic
999280455 5:150361921-150361943 ATCCAAGAGCAGTGGGGCCATGG + Intronic
1006511269 6:34522664-34522686 GTCTGTGAGCTGCTGGGCCAGGG + Intronic
1007026131 6:38576631-38576653 GTGGGAGATCAGATGGGTCATGG + Intronic
1008393662 6:50981975-50981997 GTCAGAGAACAGATAGGCAATGG - Intergenic
1011491844 6:87900813-87900835 GTCAGAGAGGAGATAGGCCATGG - Intergenic
1012743704 6:103055104-103055126 GTTGGAGAGGAGATTGGCCAGGG - Intergenic
1013099075 6:106973339-106973361 GTCGGAGAGAAGATGGGGCGGGG + Intronic
1017074815 6:150607804-150607826 GTCAGGGAGCAGATGGGAAATGG + Intronic
1018815215 6:167325292-167325314 TCCCGAGAGCACAGGGGCCAGGG + Intronic
1018926347 6:168209522-168209544 CTCCGAGAGCAGTGGGGCCAGGG - Intergenic
1019710004 7:2513850-2513872 GTCTGAGGCCAGCTGGGCCATGG - Intronic
1020210176 7:6153065-6153087 GTTCGAGACCAGCTTGGCCAAGG + Intronic
1020389890 7:7646730-7646752 GTCAGAGAGGAGATTGGCCATGG - Intronic
1021991696 7:26147423-26147445 GTTCGAGACCAGCTTGGCCAGGG + Intergenic
1025219807 7:57097474-57097496 GTTCGAGAGCAGCCTGGCCAAGG + Intergenic
1033646408 7:143308175-143308197 GTGCAGGTGCAGATGGGCCATGG + Intergenic
1038257796 8:25966648-25966670 CTCAAAGAGGAGATGGGCCAAGG - Intronic
1039039682 8:33395399-33395421 GTCAGAGAGGAGTTCGGCCAGGG + Intronic
1039290451 8:36088925-36088947 GTCAGAGAGGAGTTTGGCCAGGG - Intergenic
1044732435 8:95240044-95240066 GTCTGAAAGCAGATGGGAGAGGG + Intergenic
1045259210 8:100557621-100557643 GTCAGAGAGCTAATGGGCCCAGG - Intronic
1047643637 8:126846949-126846971 GGCCTAGAACAGCTGGGCCAAGG + Intergenic
1048344362 8:133565817-133565839 GGCCCGGAGCAGATGGGCCAGGG + Intronic
1049071280 8:140357765-140357787 GCCGGAGTGCAAATGGGCCATGG + Intronic
1049710173 8:144059851-144059873 ATCCTGGAGCAGGTGGGCCAGGG - Exonic
1056950278 9:91036035-91036057 GGCCAACAGCAGATGGGCCCAGG + Intergenic
1057077874 9:92148724-92148746 GGCCGGGATAAGATGGGCCAGGG + Intergenic
1057909259 9:99005232-99005254 GTCAGTGAGCAGCTGGGCCCTGG + Intronic
1058574300 9:106383437-106383459 TTCCTGGAGCAGATGGGGCATGG - Intergenic
1060423449 9:123485942-123485964 GTCACAGAGCCCATGGGCCAGGG - Intronic
1060553297 9:124495736-124495758 GGCCAAAAGCAGATGGGTCACGG + Intronic
1061118611 9:128629659-128629681 TTCTGAGAGCAGATGGGCTCTGG - Intronic
1061624244 9:131831773-131831795 GTCTTAGTGCAGAAGGGCCAAGG - Intergenic
1061724568 9:132575073-132575095 GTCCCACAGCAAATGGGGCAAGG - Intergenic
1062041426 9:134405970-134405992 TTCCTGGAGGAGATGGGCCAGGG - Intronic
1062490868 9:136804324-136804346 GGCCGTGAGCTGAGGGGCCACGG + Intronic
1185909063 X:3965687-3965709 GTCGGAGAGGAGATAGGCCATGG + Intergenic
1186031735 X:5376067-5376089 GTCAGAGAGGAGATGGGCCATGG + Intergenic
1186039241 X:5457793-5457815 GTCAGAGAGGTGATTGGCCATGG - Intergenic
1188437550 X:30179603-30179625 GTCAGAGAGGAGATCGGCCACGG + Intergenic
1194671831 X:96742865-96742887 GTTCGAGACCAGCTTGGCCACGG - Intronic
1198118307 X:133566103-133566125 GTCCATGAACAGATTGGCCATGG + Intronic
1199682110 X:150232488-150232510 TTCCAAGACCTGATGGGCCATGG - Intergenic