ID: 948806583

View in Genome Browser
Species Human (GRCh38)
Location 2:240455822-240455844
Sequence CCTGTGGCCCCGGCCTGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 314}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948806577_948806583 0 Left 948806577 2:240455799-240455821 CCATCTCATGTCCAGGACCACAA 0: 1
1: 0
2: 0
3: 8
4: 238
Right 948806583 2:240455822-240455844 CCTGTGGCCCCGGCCTGCGCCGG 0: 1
1: 0
2: 1
3: 25
4: 314
948806576_948806583 6 Left 948806576 2:240455793-240455815 CCTCTGCCATCTCATGTCCAGGA 0: 1
1: 0
2: 2
3: 28
4: 305
Right 948806583 2:240455822-240455844 CCTGTGGCCCCGGCCTGCGCCGG 0: 1
1: 0
2: 1
3: 25
4: 314
948806574_948806583 10 Left 948806574 2:240455789-240455811 CCGGCCTCTGCCATCTCATGTCC 0: 1
1: 0
2: 6
3: 45
4: 512
Right 948806583 2:240455822-240455844 CCTGTGGCCCCGGCCTGCGCCGG 0: 1
1: 0
2: 1
3: 25
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948806583 Original CRISPR CCTGTGGCCCCGGCCTGCGC CGG Intronic
900147882 1:1166318-1166340 CCTGTGGCCCCTCCTTGCTCAGG - Intergenic
900214086 1:1471954-1471976 CCCTCGGCCCCGGGCTGCGCGGG - Exonic
900221635 1:1512338-1512360 CCCTCGGCCCCGGGCTGCGCGGG - Exonic
900294762 1:1943358-1943380 CCTGTGGGCCCGGCATGGGCCGG - Intronic
900300546 1:1974651-1974673 CATGTGGCCCCGGGCAGGGCTGG - Intronic
900466103 1:2826248-2826270 CCTGGGGCCCAGGGCTGCGGGGG - Intergenic
900542757 1:3212352-3212374 CCTCTGGCCCTGGCCTGAGTGGG + Intronic
900577919 1:3393568-3393590 TCTGCGGACCCAGCCTGCGCCGG - Intronic
900592969 1:3468016-3468038 CCTGGGACCCCGGCCAGGGCAGG + Intronic
900916056 1:5639478-5639500 CCTGAGACCCCTGCCTGGGCTGG - Intergenic
901234774 1:7661881-7661903 CCCGTGGCGCCCGCCTGCCCCGG - Intronic
901301253 1:8201443-8201465 CCTGTGGTCCTGCCCTGCCCAGG + Intergenic
901490981 1:9596083-9596105 CCTGTGTCCCTGCCCTGCCCCGG + Intronic
901633273 1:10658234-10658256 CCTGTGGCCAGGCCCTGCGTCGG + Intronic
901642543 1:10700171-10700193 CCTGTGGCCCCAGCCCGGGCGGG + Intronic
902501850 1:16916146-16916168 TCTGTTGCCCAGGCCTGAGCTGG - Intronic
902695102 1:18134814-18134836 ACTGAGGCCCCGGTCTGAGCAGG - Intronic
902848866 1:19137096-19137118 CCTGTTGCCCAGGCCTGATCTGG - Intronic
903240706 1:21980945-21980967 CCTGTGGCCCCGGGCAGCTGGGG + Intronic
903244449 1:22005568-22005590 CCTGTGGCCCTGGGCAGCGGGGG + Intronic
904055146 1:27665107-27665129 CCCTTGGGACCGGCCTGCGCAGG - Intergenic
906140633 1:43531632-43531654 CGTGCGGTCCCGGGCTGCGCCGG + Intronic
906696791 1:47828580-47828602 CCTCTGGCCTCGGCATGCTCTGG - Intronic
909931089 1:81501591-81501613 GCTGTGGCCCCCGGCTGCGGAGG + Intronic
910818959 1:91325227-91325249 CCTGTGGCCACGACCTTCACTGG - Intronic
912717535 1:111992339-111992361 CCTCTGGTCCCGGCCTGGCCGGG + Intergenic
914066850 1:144250429-144250451 CCGGTGCCCCCGGCCCGCCCGGG - Intergenic
914112303 1:144715925-144715947 CCGGTGCCCCCGGCCCGCCCGGG + Intergenic
914214005 1:145608064-145608086 CCTGTGGCCCCAGCGTGCTGTGG + Exonic
914465949 1:147928467-147928489 CCTGTGGCCCCAGCGTGCTGTGG + Exonic
920850612 1:209625778-209625800 CCTGTGGTCAGGGCCTGGGCTGG - Exonic
922507560 1:226135396-226135418 GCCCTGGGCCCGGCCTGCGCAGG - Intergenic
922985871 1:229865563-229865585 CCTGCGGCCCCGGGCTGTGAGGG + Intergenic
923016014 1:230127194-230127216 GCTGTGAGCCCCGCCTGCGCTGG + Intronic
923372784 1:233328876-233328898 CCTGTGGAGCCCGCCTGGGCTGG - Intronic
923546731 1:234928782-234928804 CCTGTGCCACGGGCCTGCCCCGG - Intergenic
1063380916 10:5585282-5585304 CATGTGGCCTCGGGCTGCTCTGG - Intergenic
1064553048 10:16521393-16521415 CCTGTGGCTGCAGCCGGCGCCGG + Exonic
1066685377 10:37976520-37976542 CCTCTGCTCCCGGCCCGCGCCGG + Exonic
1067088021 10:43253076-43253098 CCTGTGGGCCCTCCCTGGGCTGG - Intronic
1069905663 10:71730767-71730789 CCAGTGGCCCCAGCCTGAGAGGG + Intronic
1069921449 10:71818141-71818163 ACTGTGGCCCTGGCCTGGCCTGG - Intronic
1070281098 10:75049485-75049507 CCTGAGGCCCTGGCCTGGCCTGG - Intronic
1070570708 10:77637914-77637936 CCGCTCGCCCCGGGCTGCGCTGG + Intronic
1070835684 10:79445622-79445644 ACTGCGGCCCCGGCGCGCGCAGG + Exonic
1072059862 10:91798931-91798953 CCTGTGGGCCCCGGCTGCGCAGG - Intronic
1072192099 10:93084410-93084432 CCTGTGGCCCTGAGCTGCTCAGG - Intergenic
1073217953 10:101847039-101847061 TCTGTGTCCCCTGCCTGCACTGG - Exonic
1075375426 10:121974813-121974835 CCGCTGTCCCCGCCCTGCGCCGG - Intronic
1075736503 10:124667656-124667678 CCTGTGACCCCGGGCGGGGCTGG - Intronic
1076156718 10:128210731-128210753 CCTGCGGCCCCTGCCTGTCCCGG + Intergenic
1076319237 10:129565979-129566001 CCTGTGGCTCCAGCCTGCCTGGG - Intronic
1076495963 10:130898105-130898127 CAGGTGGCCCCTGCCTGCCCTGG + Intergenic
1076603619 10:131675297-131675319 CCGGTGGCCCCTGGCTGCCCTGG - Intergenic
1076695302 10:132244458-132244480 CCTGTTGCCCCCGCCTCTGCTGG - Intronic
1076796087 10:132799134-132799156 CCTTTGGCCAAGGCCGGCGCTGG + Intergenic
1077541696 11:3149536-3149558 ACTGTCCCCACGGCCTGCGCGGG - Intronic
1077580513 11:3414365-3414387 CCTGTGTCCCTGGCCACCGCTGG + Intergenic
1079699049 11:23520668-23520690 CCTGGTGCACCGGCCAGCGCAGG - Intergenic
1080452115 11:32386264-32386286 CCTGTGGCCCAGGCTTGAGGCGG - Intergenic
1081703356 11:45165520-45165542 CATGTGCCCCCCGCCTGGGCTGG - Intronic
1081793390 11:45804436-45804458 CCTGTGTCCCCGGGCCGCGAAGG - Exonic
1081993503 11:47349922-47349944 CCTGTCGCCCCTGCCTTTGCAGG - Exonic
1083260096 11:61518180-61518202 CGTTTGGCCCCGGCCTGGCCAGG - Exonic
1083662891 11:64260007-64260029 CCTGTGGCCCTGTCCTCTGCAGG + Exonic
1083882216 11:65554232-65554254 GCTCAGGCCCCGGCCTGAGCAGG - Exonic
1084086305 11:66856905-66856927 CCCGAGGCCCGGGCCGGCGCGGG - Intronic
1084237444 11:67797194-67797216 CCTGTGTCCCTGGCCACCGCTGG + Intergenic
1084459447 11:69288191-69288213 CCTGTGTGCCGGGCCTGAGCAGG + Intergenic
1084660770 11:70545071-70545093 CCAGTGGCCCTTGCCTGCCCTGG - Intronic
1084724904 11:70935166-70935188 CCTGTTGCTCCGTCCTGCCCAGG + Intronic
1084791317 11:71476949-71476971 CCTGTGGCCACAGCCTACGACGG - Intronic
1085396799 11:76210506-76210528 CCGGGTGCCCCGGCCTGCCCAGG + Intronic
1085524848 11:77158152-77158174 CCTGGGGCCCCGGGCTGGCCTGG + Intronic
1087189035 11:95232493-95232515 CCTGTGGCCACGGCCATGGCCGG - Intronic
1088495825 11:110430331-110430353 CCGGGGACCCCGGCCCGCGCCGG - Intronic
1090704427 11:129323707-129323729 CCTGTGGTCCCAGCCTATGCAGG + Intergenic
1092172864 12:6384378-6384400 CCTCTGCCCCCGGCCTGGCCTGG + Exonic
1092408106 12:8234786-8234808 CCTGTGTCCCTGGCCACCGCTGG + Intergenic
1096650819 12:53061140-53061162 GCTGTTGCCCCGGCCCGGGCAGG - Exonic
1100393689 12:94165985-94166007 CATGTGGCCCAGTCCTGGGCAGG - Intronic
1103328011 12:120134462-120134484 GCTGTGGGCCGAGCCTGCGCTGG - Intronic
1103594500 12:122015912-122015934 CCTGTAGTCCCGGCCTCCTCAGG + Intergenic
1104775744 12:131389267-131389289 CCTGAGGCCCCGGGCTGAGCTGG + Intergenic
1105403881 13:20118454-20118476 CCTGAGCACCCGGCCTGCCCAGG + Intergenic
1105408640 13:20151578-20151600 CCTGGAGCCCCGGTCTGCTCTGG - Intronic
1105874733 13:24541546-24541568 CCTCTGGCCCCGGGCTGTGTGGG + Intergenic
1106616129 13:31329679-31329701 CCTGTGCGCCTAGCCTGCGCAGG + Exonic
1108386475 13:49903908-49903930 CCTGTAGTCCCAGCCTGCTCTGG - Intergenic
1108585434 13:51866331-51866353 CCAGTGACCCCAGCCTGTGCGGG + Intergenic
1108713752 13:53058903-53058925 CCTGTGGCCCTCTCCTGCACAGG + Intergenic
1112208193 13:97346728-97346750 CCTGCGGCCCCGGCCACCGCGGG - Intronic
1113175059 13:107554515-107554537 CCTGGGTCCCCGGGCTGCACAGG - Intronic
1113569945 13:111346408-111346430 GCAGAGGCCCCGGCCTGTGCAGG - Intergenic
1115651169 14:35403984-35404006 CCCGCGGCCCCGGCGGGCGCCGG + Intronic
1119623568 14:76151786-76151808 CCTGTGGCTCCGCCCACCGCGGG + Intergenic
1119775000 14:77242804-77242826 GCTGTGGACCCAGCCTGCCCTGG - Intronic
1121546940 14:94769714-94769736 CCCGTGGGCCCGGCCTGCTGCGG - Exonic
1121546965 14:94769813-94769835 CCCGTGGCCCCCGGCGGCGCGGG - Exonic
1122514477 14:102297607-102297629 GCTCTGGCCCCGGCCAGCCCAGG - Intronic
1122601777 14:102925241-102925263 CCTGGGGCCCCCGCGTGTGCGGG + Intronic
1122640223 14:103155476-103155498 CCTGGGGTCCCGGCCTGTCCTGG - Intergenic
1122640236 14:103155512-103155534 CCTGGGGTCCCGGCCTGTCCTGG - Intergenic
1122640250 14:103155548-103155570 CCTGGGGTCCCGGCCTGTCCTGG - Intergenic
1122829359 14:104388219-104388241 CCTCTGGCCCCGGCAGGGGCTGG + Intergenic
1123706454 15:22954559-22954581 CCTGTGCCCCCGGCCTCCCCAGG + Intronic
1124637621 15:31375061-31375083 CCTTAGGCCCCGGCCTGGACTGG + Exonic
1127788756 15:62379700-62379722 CCTGTGGTCCCAGCCTCCGAAGG + Intergenic
1129288008 15:74541229-74541251 GCTGTGGCCCCCGGCTGCGGAGG + Exonic
1130992935 15:88887318-88887340 CCTGGGGCCCCAGCCTGGCCCGG - Exonic
1131367891 15:91854623-91854645 AGTGTGGCCCTGGCCTGAGCCGG + Intronic
1131525334 15:93147890-93147912 CCTGTGTGCCAGGCCTGCGAAGG + Intergenic
1132070874 15:98775651-98775673 CCTGTGGCCCCTGCTGGTGCTGG + Intronic
1132243784 15:100279335-100279357 CCTGTGGCCTGGGCCAGCCCAGG + Intronic
1132556776 16:576074-576096 CCTGCGGCCCCAGGCTGTGCTGG + Intronic
1132759728 16:1502775-1502797 CCCGTGGCCCTGGCCAGTGCAGG + Intronic
1132804594 16:1769643-1769665 CCTGAGGCCTGGGCCTGCCCTGG - Exonic
1132897976 16:2237930-2237952 CCTGTGGCGCCCGCCTGCGCCGG + Exonic
1133295973 16:4752475-4752497 CCTGTGGCCGGGGCTTCCGCCGG - Exonic
1134263890 16:12676161-12676183 CCTGTGGCCCAGGACTGCCAGGG + Intronic
1135077987 16:19410740-19410762 CCTGTTGCCGCTGCTTGCGCTGG - Exonic
1138384984 16:56630171-56630193 CCTGTGGCCCTGGCCACAGCTGG + Intergenic
1140273020 16:73483222-73483244 CCTCTGGGCCAGGCGTGCGCTGG - Intergenic
1140478753 16:75251496-75251518 CCTGGGGCCCCGGCTCTCGCGGG + Intronic
1140566537 16:76049205-76049227 CCTGGGGCCCCAGCCTGCATTGG - Intergenic
1140806612 16:78537862-78537884 CCTCTGGCCTCGGCCTTCTCCGG + Intronic
1140872476 16:79120019-79120041 CCAGTGGCCGTGGCCTGGGCAGG + Intronic
1141839493 16:86565773-86565795 CCCGTGGCCCAGGCCGGCGCCGG - Intergenic
1141890734 16:86924902-86924924 CCTGTGGCCCCAGCCTTTCCTGG - Intergenic
1142238294 16:88933156-88933178 CCTGTGGCCCCGGCCCTGCCTGG + Intronic
1142297323 16:89234016-89234038 CCTGTGGCCTCTGCCTCCCCTGG + Exonic
1142395671 16:89829810-89829832 CCTGAGGCGCAGGCTTGCGCTGG + Intronic
1142420494 16:89966717-89966739 GCTGTGGCCCCAGCCTGAGGAGG + Exonic
1142847818 17:2690652-2690674 CCTGGGGCCCCCGCTGGCGCGGG + Exonic
1142850155 17:2700894-2700916 TCTGAGGCCCCCGCCTGCTCCGG + Intronic
1143114405 17:4574382-4574404 CCTGTTGCCCCAGGCTGAGCTGG - Intergenic
1143366449 17:6411764-6411786 CCATTGCGCCCGGCCTGCGCTGG - Intronic
1145264189 17:21371678-21371700 CCCGTGGCCCCGCCCTCTGCGGG - Intergenic
1145912899 17:28552642-28552664 CCTGGGGCCCCGGCCGGGGGCGG - Exonic
1146053416 17:29569065-29569087 CCTGTGGCCTCTGCCTCCGCAGG + Exonic
1146371340 17:32266817-32266839 CCTCTGACCCCGGCCGGAGCAGG + Intronic
1147326308 17:39671425-39671447 AGTGTGGCCCCTGCCTGCCCTGG + Exonic
1147867205 17:43560845-43560867 CCTGTAGCAGCGGCCTGCCCTGG - Intronic
1149636784 17:58177289-58177311 GCTGTGGCCCAGGCCTCCGAGGG - Intergenic
1149746860 17:59107004-59107026 CCTCCGGCCCTAGCCTGCGCAGG + Intergenic
1150347559 17:64415773-64415795 CCGGTGCCCACGGCCTGCGGAGG + Intergenic
1150639917 17:66942568-66942590 GCTGTGGCTCCAGCCTGCTCCGG - Intergenic
1152458381 17:80428781-80428803 CCTGTGTCCCCTGCCTTCCCTGG - Intronic
1152592987 17:81222768-81222790 GCTGCGCCCCCGGCCCGCGCAGG - Exonic
1152682663 17:81677122-81677144 CCTGTGTTCCCAGCCAGCGCTGG - Intergenic
1152702171 17:81824567-81824589 CCTGCGTCCCATGCCTGCGCTGG - Exonic
1152738507 17:82008899-82008921 TCCCTGGCCCCGGCCAGCGCAGG - Intronic
1152762118 17:82114295-82114317 CCTCTGGCCCCCACCTCCGCAGG - Intronic
1152825732 17:82463600-82463622 CCAGTGGCCCCTGTCTGCCCGGG - Intronic
1152879734 17:82808204-82808226 CCTGTGGGCTCGGGCTGTGCAGG + Intronic
1153997537 18:10454862-10454884 CCTGAAGCCCCGGCCTGGCCCGG + Exonic
1154374914 18:13801093-13801115 CCCGTGGCCACTCCCTGCGCTGG + Intergenic
1158546113 18:58398861-58398883 CCTTGGGCCCCGACCTGCCCGGG + Intronic
1160157230 18:76442980-76443002 CTCGTGGCCCCGGCCGGCCCTGG + Exonic
1160200114 18:76788947-76788969 GCTGTGGCCTCGGCCAGCCCAGG + Intergenic
1160499735 18:79395802-79395824 CCTGCTGCCCGGGCCCGCGCGGG - Intergenic
1160579348 18:79874845-79874867 CCTGAAGTCCCGGCCTGCGCTGG - Intronic
1160605721 18:80048240-80048262 GCTGTGGCCCCCTCCAGCGCTGG - Intronic
1160674171 19:380003-380025 CCTGTGACGCCGTCCTGGGCAGG + Intergenic
1160706176 19:531370-531392 CCCGCGGCCCCGCCCCGCGCCGG + Intergenic
1161065892 19:2237063-2237085 CCTGAGGCCCCGCGCTGGGCGGG + Intronic
1161134911 19:2613964-2613986 GCTGTGGCCGTGGCCTTCGCTGG - Intronic
1161321888 19:3645244-3645266 TCTGTGGGCCAGGCCTGTGCAGG + Intronic
1161535914 19:4818364-4818386 CCTGTGCCCATGGCCTGCACAGG - Exonic
1161681995 19:5684769-5684791 GCTGTGGGCCAGGCCTGTGCCGG + Intronic
1162042515 19:7979310-7979332 CCAGGGGCCCAGGCCTGGGCAGG - Intronic
1162445228 19:10718588-10718610 CCTGGGGCCCGGGCCTGCTCCGG - Intronic
1162495147 19:11019355-11019377 CCTCAGGCCCCGGCCGCCGCTGG + Intronic
1162808662 19:13151720-13151742 CCTGGGGCTCCAGCCTGCTCCGG + Intronic
1162932039 19:13962258-13962280 CCTGAGCCCCGGGCCGGCGCAGG - Exonic
1162964577 19:14149861-14149883 CCTGCGGCCCGGGCCAGCCCGGG - Exonic
1162971331 19:14182984-14183006 CCCTTGCCCCCGGCCTGGGCTGG + Intronic
1163218883 19:15899956-15899978 CCTGAGCCCCCGGCCTCCGTAGG + Intergenic
1163252164 19:16132401-16132423 CCGGTGGCCGCGGCGTGGGCGGG - Exonic
1163595363 19:18218248-18218270 CCTGTGCCCTCTGCCTGCTCAGG - Exonic
1163767377 19:19171025-19171047 CCTGTGGGTCTGGCCTGTGCTGG - Intronic
1164083263 19:21878932-21878954 CCTGTGGGCAGGGCCTGTGCAGG - Intergenic
1164721043 19:30431756-30431778 CCAGAGGCCCTGGCCTCCGCAGG - Intronic
1164829764 19:31311459-31311481 CCTGTGGCCTCCGACTGCACAGG + Intronic
1165080255 19:33302602-33302624 CCTCTGTCCCCGGGCTGCGGCGG + Intergenic
1166377500 19:42335946-42335968 CATGTGGCCGTGGCCTGGGCCGG + Exonic
1166532233 19:43549992-43550014 CCTGAGGCCCCAGCCTACTCAGG + Intronic
1166746847 19:45145735-45145757 CTTGTGGCCCCGGCCCGGGCTGG - Exonic
1167117841 19:47498345-47498367 CCAGGGGCCCCTGCCTGCCCTGG - Intronic
1167251112 19:48398868-48398890 CCTGTGGCCCCGCCCCGCCCCGG - Intronic
1167533196 19:50031748-50031770 CCTGTGTTCCTGGCCTGTGCTGG - Intronic
1167561962 19:50231352-50231374 CCAGTGGCCCCTGCCTGCTCTGG + Intronic
1168335154 19:55593144-55593166 CCCGCGGCCCAGGCCTGCGCTGG + Exonic
925034767 2:676926-676948 TCTGTGGCCCGGGCTTGGGCTGG - Intronic
925037250 2:697755-697777 CCTGTGGCCCTGACGTGCCCTGG + Intergenic
926125618 2:10270073-10270095 CCTGTGGCTCCGGCTTTGGCTGG + Intergenic
927105510 2:19820185-19820207 ACTGTGGCCCCTGCTTGCACTGG + Intergenic
927558014 2:24049687-24049709 CCAGTGGCCCCTCCCCGCGCAGG + Intronic
927880273 2:26685438-26685460 CCTGAGGTCCAGGCCTGGGCAGG - Intergenic
929748122 2:44680513-44680535 CCTGTGGACCCAGGCTGAGCTGG - Intronic
931541025 2:63328849-63328871 CCTGTAGCCCCAGCCTACTCAGG - Intronic
932779076 2:74548948-74548970 CCTGGGCGCCCAGCCTGCGCGGG + Intronic
933722293 2:85405834-85405856 CCTGTGACTCAGGCCTGAGCTGG + Intronic
934117224 2:88809380-88809402 CCTGAGGCCCCAGCATGTGCTGG - Intergenic
934755582 2:96822431-96822453 CCTGTGGCCCCAGCTTACTCAGG - Intronic
936006314 2:108892160-108892182 TCTGTGGCCACAGCCTGGGCTGG + Intergenic
936160670 2:110082023-110082045 CCTGAGGCCCCAGCATGTGCTGG - Intergenic
936183994 2:110289331-110289353 CCTGAGGCCCCAGCATGTGCTGG + Intergenic
937245180 2:120487961-120487983 CCTGAGGTGCCGGCCAGCGCGGG - Intergenic
937905525 2:127051066-127051088 CCTGTGGCCCCTGCTGGTGCTGG - Intronic
939996635 2:148926320-148926342 GCTGTGGCCCCGGGGTGCGGCGG + Intronic
946245973 2:218387691-218387713 CCTCTGGCCGCGGGCTGCGGGGG + Intronic
946370688 2:219279615-219279637 CTCTTGGCCCCGGCCTGCGGGGG + Intronic
947960923 2:234236485-234236507 CCTGTGGCCCTTGCCTGGGTTGG + Intergenic
948403539 2:237701533-237701555 CCTGAGCCCCCAGCCTGAGCCGG + Intronic
948505994 2:238427209-238427231 CCCGTGGACCCGGCCAGCCCGGG - Intronic
948800310 2:240430423-240430445 TGTGTGCCGCCGGCCTGCGCTGG - Intergenic
948806583 2:240455822-240455844 CCTGTGGCCCCGGCCTGCGCCGG + Intronic
1168777841 20:462549-462571 CCGCTGGCCCCGCCCCGCGCCGG + Exonic
1169143574 20:3238976-3238998 CCACCGGCCCCGGCCCGCGCAGG + Intronic
1171439271 20:25147866-25147888 CCTGTGGCGCCGTCCAGCCCTGG - Intergenic
1171439715 20:25150251-25150273 CCTGTGCCCCAGGCCAGCCCAGG + Intergenic
1172547267 20:35771873-35771895 ACTGTGGCAACGGCCTGCGCAGG - Intergenic
1173263514 20:41457682-41457704 CCTGTGCCCCCGCCCTGCTGTGG + Intronic
1173843560 20:46174445-46174467 CCTGGGGCCCCGGCGTGTGCTGG + Exonic
1175161817 20:57013882-57013904 TCTGTAGCCCCGGACTGCGCGGG - Intergenic
1175863903 20:62164358-62164380 CCTGTAGCCCAGGCCTGAGCTGG - Intronic
1176111835 20:63414382-63414404 CCTGTGGCCACAGCCTGCCGGGG - Intronic
1176217381 20:63954685-63954707 CCAGGGGCCCCGGTCTGCCCTGG - Intronic
1176290966 21:5044393-5044415 CCTGTGTCCCCGACATGCACGGG - Intergenic
1178491047 21:33052127-33052149 CCTGTGGCCCCAGCCGGCCCCGG + Intergenic
1179866289 21:44219248-44219270 CCTGTGTCCCCGACATGCACGGG + Intergenic
1179912105 21:44455844-44455866 CCTGTGCGCGCGGCCCGCGCTGG - Intronic
1181043799 22:20205228-20205250 CCTGTGACCCCGTCCTGAGTGGG - Intergenic
1181056314 22:20262034-20262056 CCTGTGGCCACAGCCGGCCCCGG - Intronic
1181793116 22:25283059-25283081 CCAGCTGCCCCGGCCCGCGCTGG + Intergenic
1181831716 22:25565157-25565179 CCAGCTGCCCCGGCCGGCGCCGG + Intronic
1183492084 22:38122164-38122186 CCTGTGGGCCAGGCCTGTGTTGG - Intronic
1184131535 22:42519572-42519594 CCCGTGGCCCCAGGCTCCGCAGG - Intronic
1184141757 22:42581788-42581810 CCCGTGGCCCCAGGCTCCGCAGG - Intergenic
1184775449 22:46620757-46620779 CCCCTGGCCCCGGGCTGCGCAGG - Intronic
1185205405 22:49535353-49535375 CCTGTGGCCCCGGCCCTGTCTGG - Intronic
954003908 3:47577980-47578002 CCTGGAGCCCCGGCCCGCCCCGG + Intronic
954035861 3:47850845-47850867 CCTCTGGTCCCGGCCTTCTCAGG + Intronic
954294272 3:49665466-49665488 TCTGTGGCCCCTGCCTCTGCGGG - Intronic
954378010 3:50205131-50205153 CCTTTGCTCCCGGCCTGCCCCGG + Intergenic
954389316 3:50260503-50260525 CCTGCTGCCCCTGCCTGCGAGGG + Intergenic
954459496 3:50618221-50618243 CCTGTGGCCCCTGCCTGTCTGGG + Intronic
957053388 3:75426960-75426982 CCTGTGTCCCTGGCCACCGCTGG + Intergenic
961301438 3:125924584-125924606 CCTGTGTCCCTGGCCACCGCTGG - Intergenic
961674282 3:128555418-128555440 CCGGGTGCCCCGGCCTCCGCCGG - Intergenic
964041661 3:152268738-152268760 CCTGTGGCCCGGGGAAGCGCGGG + Exonic
964549186 3:157867949-157867971 ACTGTTGCCCAGGCCTGCTCTGG + Intergenic
964743232 3:159988759-159988781 CCTGGGTCCCCGGCCTTAGCCGG - Exonic
966860691 3:184229772-184229794 GCAGTGGCCGCGGCCCGCGCAGG - Intronic
966912875 3:184569163-184569185 GCTGGAGCCCCGGCCTGCTCCGG + Intronic
966985396 3:185175505-185175527 CCTCTGGCCCAGCCCTGCCCAGG + Intergenic
967794992 3:193590306-193590328 CCTGTGGCCCCGCCCAGAGGTGG - Intronic
968123642 3:196143202-196143224 CCCGTGGTCCCTGCCAGCGCTGG - Intergenic
968512280 4:1001006-1001028 CCTGGGGCCCTGGCCGGGGCGGG + Intronic
968702383 4:2063106-2063128 CCTCTGGCCCCGGCCTCTCCTGG - Intronic
968884744 4:3321751-3321773 TCTGAGGCCCAGGCCTGGGCAGG + Intronic
968903504 4:3441780-3441802 TCTCTGGCCTCGGCCTGCACTGG - Intergenic
968996181 4:3947275-3947297 CCTGTGTCCCTGGCCACCGCTGG + Intergenic
969757801 4:9161415-9161437 CCTGTGTCCCTGGCCACCGCTGG - Intergenic
969817785 4:9698963-9698985 CCTGTGTCCCTGGCCACCGCTGG - Intergenic
974562733 4:63542084-63542106 TTTGTGGCCCCTGCCTGCTCAGG + Intergenic
976629158 4:87219931-87219953 CCTGGAGCCGCGGCCTGCGGGGG - Intronic
976704793 4:88008374-88008396 GCGATGGCCCCGGCCGGCGCCGG - Intronic
977969573 4:103198205-103198227 CCTGCGGCGCCGCCCTGAGCCGG - Intronic
979278198 4:118836206-118836228 CCGGTGGCCCCGCCCCGCGGCGG - Intronic
985630648 5:1012341-1012363 GCCGTGGCCCTGGCCTGCACGGG + Intronic
985811671 5:2094745-2094767 CCTGTGGCCGGGGCCAGGGCTGG - Intergenic
998052752 5:139049666-139049688 CCTGTAGCCCCAGCCTACTCAGG + Intronic
998143216 5:139711252-139711274 CCCGGTGCCCCGGCCCGCGCTGG - Intergenic
998174836 5:139895311-139895333 CCTGTATCCCAGCCCTGCGCTGG - Intronic
998553352 5:143099301-143099323 CCTGTGCCCCCCACCTGCCCAGG - Intronic
1001506517 5:172284119-172284141 CCGGTGGCCCCGCCCTTCTCCGG - Intergenic
1002196571 5:177504571-177504593 CCTGTGCCCCTGACCTGTGCAGG - Exonic
1002198305 5:177512978-177513000 ACTCTGGCCCCGGCCTGGCCTGG + Intronic
1003187907 6:3849196-3849218 CCTGTGGGGCGGGCCAGCGCGGG - Intergenic
1003567003 6:7230423-7230445 ACTGCGGCCGCGGCCTGGGCGGG + Exonic
1008848473 6:55996234-55996256 CCTGTGGCCCCCACCAGCCCAGG + Intergenic
1008880809 6:56378456-56378478 CCTGTGGCCACTGCCTCGGCAGG - Intronic
1017163481 6:151388246-151388268 CCCGTGGCACCAGCCTGCACAGG - Intronic
1017497570 6:154995328-154995350 ACTGTGGCCGCGGCCGCCGCAGG + Intronic
1018091220 6:160348219-160348241 CCTGTGGCCCGGGGCTGCTGCGG + Intergenic
1018185289 6:161261299-161261321 CATGTGGCCCAGGACTGTGCCGG - Intronic
1018465200 6:164037907-164037929 CCTGTGGCACCCACCTGCCCTGG - Intergenic
1019082489 6:169444520-169444542 CGTGTGGCCCCTGCCGGCTCTGG - Intergenic
1019373498 7:676389-676411 CCTGCGGCTCCTGCCTGTGCCGG - Intronic
1019417953 7:935781-935803 CCTGTGGGGCCGGCCTCTGCTGG - Intronic
1019487597 7:1296468-1296490 GCTGTGGGCCAGGCCTGAGCTGG + Intergenic
1019577799 7:1745913-1745935 CCTGGCGCCGCCGCCTGCGCAGG - Exonic
1019681938 7:2355225-2355247 CCTGGGGCCTCGCCCTGTGCCGG - Exonic
1020013070 7:4816841-4816863 CCTGTGGCCCTGGCCAGCTTGGG - Intronic
1020080520 7:5283616-5283638 CCTGTGGCCCCTGCATGCATCGG + Intronic
1025198399 7:56948564-56948586 CCTGTGGCCCCTGCATGCATCGG - Intergenic
1025673551 7:63628369-63628391 CCTGTGGCCCCTGCATGCATCGG + Intergenic
1028571410 7:92291604-92291626 ACTGTGGCCTGGGCCTGGGCTGG + Intronic
1032970384 7:137156312-137156334 CCTGTGGCCTCTGCCTAGGCTGG + Intergenic
1033673088 7:143511638-143511660 GCGGTGGCCCCGGCGTGCTCAGG + Intergenic
1034223039 7:149460299-149460321 CGTCGGGCCCCGGCCTGCTCGGG + Intronic
1034519031 7:151604512-151604534 CCTATGGCCCCAGCCTACTCAGG + Intronic
1034803583 7:154068506-154068528 CCAGTGGCCCCGGCCTTGGAGGG + Intronic
1034964667 7:155383807-155383829 CATCTGGCCCCAGCCTGCACAGG - Intronic
1035294686 7:157860182-157860204 CCTGAGGCCCCAGCCTGTGGTGG + Intronic
1035629144 8:1095090-1095112 CCTGGGGCAGCAGCCTGCGCTGG + Intergenic
1036381057 8:8236743-8236765 CCTTTGTCCCTGGCCAGCGCTGG - Intergenic
1036848516 8:12185885-12185907 CCTGTGTCCCTGGCCACCGCTGG + Intronic
1036869876 8:12428166-12428188 CCTGTGTCCCTGGCCACCGCTGG + Intronic
1037784085 8:21892288-21892310 CCAGTGGCCCCTGTCTGAGCAGG - Intergenic
1047364544 8:124200255-124200277 CCTGTGGCCCTGGCTTGCCCTGG + Intergenic
1047709235 8:127534050-127534072 CCTGTGGCTTCAGCCTGCACAGG + Intergenic
1049272164 8:141701561-141701583 CCTGGGGCCGGGGCCAGCGCAGG - Intergenic
1049419467 8:142510555-142510577 CCCGCGCCCCCGGCCCGCGCGGG - Intronic
1049602659 8:143515121-143515143 CCTGGGGCCCAGGCCTGCCATGG + Intronic
1049610597 8:143553129-143553151 CCTGAAGTCCCGCCCTGCGCGGG + Intergenic
1049686286 8:143940524-143940546 CCGGAGGCCCCAGCCAGCGCAGG - Intronic
1049711280 8:144064466-144064488 CCTGTAGCCCTGGCCTGCCCTGG - Intergenic
1049801971 8:144522121-144522143 CCTGTCGCCCCGCCCTTCGCGGG + Exonic
1053067187 9:35077012-35077034 CCTGTGTCCACGGCCTGTGTTGG - Exonic
1053139860 9:35675778-35675800 CGGGTGTCCCCAGCCTGCGCGGG + Exonic
1053161201 9:35814683-35814705 CTCGGCGCCCCGGCCTGCGCAGG + Intronic
1056765607 9:89442895-89442917 CCTGGGCCCCGGGCCTGGGCTGG + Intronic
1060184887 9:121558289-121558311 TCTGTGGCCCCTGCTTGCCCTGG + Intergenic
1061231489 9:129318422-129318444 CCTGTGGGCAGGGCCCGCGCTGG + Intergenic
1061368736 9:130186180-130186202 CCTGTGGCCCCAGCATCCGCAGG - Intronic
1062110243 9:134778306-134778328 CCTGTGGGCCCGGGCAGCCCAGG - Intronic
1062134252 9:134916383-134916405 CCTGGGGCCCCGGGCAGCCCCGG + Exonic
1062141883 9:134963762-134963784 CCAGAGGCCCCGGCCTCTGCTGG + Intergenic
1062503074 9:136859493-136859515 CCTGGGGCCGCTGCCTGGGCTGG + Intronic
1062636062 9:137492523-137492545 CCCATGGCCCCGCCCTGTGCTGG - Intronic
1185462332 X:339209-339231 CCTCTGGCCTCTGCCTGCACGGG - Intronic
1188004169 X:25005826-25005848 CCGGTGGCCCCGGGCGGCTCCGG - Intronic
1189197850 X:39166812-39166834 CCTATGGCCCAGGCCCGCGCAGG - Intergenic
1190745603 X:53320458-53320480 GCTGTGGCCTCCGCCGGCGCCGG + Exonic
1193697206 X:84723819-84723841 CCTGTAGCCCCTGCTTGCACAGG + Intergenic
1195997124 X:110742365-110742387 GATGTGGCCCTGGCCTGTGCAGG - Intronic
1198480057 X:137033057-137033079 CCTGCCGCCCCGGCCACCGCGGG + Intergenic
1199982296 X:152927775-152927797 CCTGAGCCCCAGGCCTGCCCTGG - Intronic