ID: 948807306

View in Genome Browser
Species Human (GRCh38)
Location 2:240458628-240458650
Sequence CTGAGGATGGGGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2301
Summary {0: 1, 1: 1, 2: 14, 3: 232, 4: 2053}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948807306_948807323 13 Left 948807306 2:240458628-240458650 CCTTCCTCCTTCCCCATCCTCAG 0: 1
1: 1
2: 14
3: 232
4: 2053
Right 948807323 2:240458664-240458686 CAAGGGGTGCCTTTCGGGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 69
948807306_948807317 -4 Left 948807306 2:240458628-240458650 CCTTCCTCCTTCCCCATCCTCAG 0: 1
1: 1
2: 14
3: 232
4: 2053
Right 948807317 2:240458647-240458669 TCAGACATGGGCCCAGGCAAGGG 0: 1
1: 0
2: 1
3: 16
4: 213
948807306_948807320 7 Left 948807306 2:240458628-240458650 CCTTCCTCCTTCCCCATCCTCAG 0: 1
1: 1
2: 14
3: 232
4: 2053
Right 948807320 2:240458658-240458680 CCCAGGCAAGGGGTGCCTTTCGG 0: 1
1: 0
2: 0
3: 11
4: 202
948807306_948807314 -10 Left 948807306 2:240458628-240458650 CCTTCCTCCTTCCCCATCCTCAG 0: 1
1: 1
2: 14
3: 232
4: 2053
Right 948807314 2:240458641-240458663 CCATCCTCAGACATGGGCCCAGG 0: 1
1: 0
2: 2
3: 23
4: 235
948807306_948807316 -5 Left 948807306 2:240458628-240458650 CCTTCCTCCTTCCCCATCCTCAG 0: 1
1: 1
2: 14
3: 232
4: 2053
Right 948807316 2:240458646-240458668 CTCAGACATGGGCCCAGGCAAGG 0: 1
1: 0
2: 2
3: 23
4: 406
948807306_948807324 14 Left 948807306 2:240458628-240458650 CCTTCCTCCTTCCCCATCCTCAG 0: 1
1: 1
2: 14
3: 232
4: 2053
Right 948807324 2:240458665-240458687 AAGGGGTGCCTTTCGGGCCTGGG 0: 1
1: 0
2: 3
3: 8
4: 86
948807306_948807318 -3 Left 948807306 2:240458628-240458650 CCTTCCTCCTTCCCCATCCTCAG 0: 1
1: 1
2: 14
3: 232
4: 2053
Right 948807318 2:240458648-240458670 CAGACATGGGCCCAGGCAAGGGG 0: 1
1: 2
2: 1
3: 23
4: 294
948807306_948807322 8 Left 948807306 2:240458628-240458650 CCTTCCTCCTTCCCCATCCTCAG 0: 1
1: 1
2: 14
3: 232
4: 2053
Right 948807322 2:240458659-240458681 CCAGGCAAGGGGTGCCTTTCGGG 0: 1
1: 0
2: 2
3: 14
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948807306 Original CRISPR CTGAGGATGGGGAAGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr