ID: 948809567

View in Genome Browser
Species Human (GRCh38)
Location 2:240467700-240467722
Sequence GAGGTCCCCGGTTGCTGGTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948809564_948809567 -9 Left 948809564 2:240467686-240467708 CCGCACAGTGGACGGAGGTCCCC 0: 1
1: 0
2: 0
3: 13
4: 88
Right 948809567 2:240467700-240467722 GAGGTCCCCGGTTGCTGGTCAGG 0: 1
1: 0
2: 1
3: 7
4: 72
948809558_948809567 24 Left 948809558 2:240467653-240467675 CCGCTTAGTGCTGCTTTGCTTTT 0: 1
1: 0
2: 5
3: 45
4: 452
Right 948809567 2:240467700-240467722 GAGGTCCCCGGTTGCTGGTCAGG 0: 1
1: 0
2: 1
3: 7
4: 72
948809561_948809567 -4 Left 948809561 2:240467681-240467703 CCGTCCCGCACAGTGGACGGAGG 0: 1
1: 0
2: 0
3: 2
4: 60
Right 948809567 2:240467700-240467722 GAGGTCCCCGGTTGCTGGTCAGG 0: 1
1: 0
2: 1
3: 7
4: 72
948809563_948809567 -8 Left 948809563 2:240467685-240467707 CCCGCACAGTGGACGGAGGTCCC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 948809567 2:240467700-240467722 GAGGTCCCCGGTTGCTGGTCAGG 0: 1
1: 0
2: 1
3: 7
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948809567 Original CRISPR GAGGTCCCCGGTTGCTGGTC AGG Exonic