ID: 948811666

View in Genome Browser
Species Human (GRCh38)
Location 2:240481561-240481583
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 307}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948811666_948811669 -8 Left 948811666 2:240481561-240481583 CCTGTCCTGCACCAGTCCCCTCT 0: 1
1: 0
2: 2
3: 23
4: 307
Right 948811669 2:240481576-240481598 TCCCCTCTCCATCACCTCGATGG 0: 1
1: 0
2: 1
3: 9
4: 154
948811666_948811681 17 Left 948811666 2:240481561-240481583 CCTGTCCTGCACCAGTCCCCTCT 0: 1
1: 0
2: 2
3: 23
4: 307
Right 948811681 2:240481601-240481623 TGCTCAGGGTTTATGAGGTGGGG 0: 1
1: 0
2: 1
3: 19
4: 164
948811666_948811671 -7 Left 948811666 2:240481561-240481583 CCTGTCCTGCACCAGTCCCCTCT 0: 1
1: 0
2: 2
3: 23
4: 307
Right 948811671 2:240481577-240481599 CCCCTCTCCATCACCTCGATGGG 0: 1
1: 0
2: 0
3: 6
4: 103
948811666_948811679 15 Left 948811666 2:240481561-240481583 CCTGTCCTGCACCAGTCCCCTCT 0: 1
1: 0
2: 2
3: 23
4: 307
Right 948811679 2:240481599-240481621 GTTGCTCAGGGTTTATGAGGTGG 0: 1
1: 0
2: 1
3: 11
4: 142
948811666_948811678 12 Left 948811666 2:240481561-240481583 CCTGTCCTGCACCAGTCCCCTCT 0: 1
1: 0
2: 2
3: 23
4: 307
Right 948811678 2:240481596-240481618 TGGGTTGCTCAGGGTTTATGAGG 0: 1
1: 0
2: 1
3: 21
4: 156
948811666_948811676 3 Left 948811666 2:240481561-240481583 CCTGTCCTGCACCAGTCCCCTCT 0: 1
1: 0
2: 2
3: 23
4: 307
Right 948811676 2:240481587-240481609 TCACCTCGATGGGTTGCTCAGGG 0: 1
1: 0
2: 0
3: 2
4: 46
948811666_948811675 2 Left 948811666 2:240481561-240481583 CCTGTCCTGCACCAGTCCCCTCT 0: 1
1: 0
2: 2
3: 23
4: 307
Right 948811675 2:240481586-240481608 ATCACCTCGATGGGTTGCTCAGG 0: 1
1: 0
2: 0
3: 2
4: 47
948811666_948811680 16 Left 948811666 2:240481561-240481583 CCTGTCCTGCACCAGTCCCCTCT 0: 1
1: 0
2: 2
3: 23
4: 307
Right 948811680 2:240481600-240481622 TTGCTCAGGGTTTATGAGGTGGG 0: 1
1: 0
2: 0
3: 12
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948811666 Original CRISPR AGAGGGGACTGGTGCAGGAC AGG (reversed) Intronic