ID: 948811668

View in Genome Browser
Species Human (GRCh38)
Location 2:240481572-240481594
Sequence CGAGGTGATGGAGAGGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 523
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 478}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948811668_948811678 1 Left 948811668 2:240481572-240481594 CCAGTCCCCTCTCCATCACCTCG 0: 1
1: 0
2: 2
3: 42
4: 478
Right 948811678 2:240481596-240481618 TGGGTTGCTCAGGGTTTATGAGG 0: 1
1: 0
2: 1
3: 21
4: 156
948811668_948811680 5 Left 948811668 2:240481572-240481594 CCAGTCCCCTCTCCATCACCTCG 0: 1
1: 0
2: 2
3: 42
4: 478
Right 948811680 2:240481600-240481622 TTGCTCAGGGTTTATGAGGTGGG 0: 1
1: 0
2: 0
3: 12
4: 147
948811668_948811682 23 Left 948811668 2:240481572-240481594 CCAGTCCCCTCTCCATCACCTCG 0: 1
1: 0
2: 2
3: 42
4: 478
Right 948811682 2:240481618-240481640 GTGGGGATGCCAACAAGAATAGG 0: 1
1: 0
2: 1
3: 9
4: 107
948811668_948811683 24 Left 948811668 2:240481572-240481594 CCAGTCCCCTCTCCATCACCTCG 0: 1
1: 0
2: 2
3: 42
4: 478
Right 948811683 2:240481619-240481641 TGGGGATGCCAACAAGAATAGGG 0: 1
1: 0
2: 0
3: 9
4: 168
948811668_948811675 -9 Left 948811668 2:240481572-240481594 CCAGTCCCCTCTCCATCACCTCG 0: 1
1: 0
2: 2
3: 42
4: 478
Right 948811675 2:240481586-240481608 ATCACCTCGATGGGTTGCTCAGG 0: 1
1: 0
2: 0
3: 2
4: 47
948811668_948811676 -8 Left 948811668 2:240481572-240481594 CCAGTCCCCTCTCCATCACCTCG 0: 1
1: 0
2: 2
3: 42
4: 478
Right 948811676 2:240481587-240481609 TCACCTCGATGGGTTGCTCAGGG 0: 1
1: 0
2: 0
3: 2
4: 46
948811668_948811684 29 Left 948811668 2:240481572-240481594 CCAGTCCCCTCTCCATCACCTCG 0: 1
1: 0
2: 2
3: 42
4: 478
Right 948811684 2:240481624-240481646 ATGCCAACAAGAATAGGGCCTGG 0: 1
1: 0
2: 0
3: 27
4: 181
948811668_948811679 4 Left 948811668 2:240481572-240481594 CCAGTCCCCTCTCCATCACCTCG 0: 1
1: 0
2: 2
3: 42
4: 478
Right 948811679 2:240481599-240481621 GTTGCTCAGGGTTTATGAGGTGG 0: 1
1: 0
2: 1
3: 11
4: 142
948811668_948811681 6 Left 948811668 2:240481572-240481594 CCAGTCCCCTCTCCATCACCTCG 0: 1
1: 0
2: 2
3: 42
4: 478
Right 948811681 2:240481601-240481623 TGCTCAGGGTTTATGAGGTGGGG 0: 1
1: 0
2: 1
3: 19
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948811668 Original CRISPR CGAGGTGATGGAGAGGGGAC TGG (reversed) Intronic