ID: 948811671

View in Genome Browser
Species Human (GRCh38)
Location 2:240481577-240481599
Sequence CCCCTCTCCATCACCTCGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 103}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948811666_948811671 -7 Left 948811666 2:240481561-240481583 CCTGTCCTGCACCAGTCCCCTCT 0: 1
1: 0
2: 2
3: 23
4: 307
Right 948811671 2:240481577-240481599 CCCCTCTCCATCACCTCGATGGG 0: 1
1: 0
2: 0
3: 6
4: 103
948811664_948811671 21 Left 948811664 2:240481533-240481555 CCTCTGCTTTAGGAGGAAAAAGA 0: 1
1: 0
2: 3
3: 31
4: 467
Right 948811671 2:240481577-240481599 CCCCTCTCCATCACCTCGATGGG 0: 1
1: 0
2: 0
3: 6
4: 103
948811662_948811671 28 Left 948811662 2:240481526-240481548 CCAGTCTCCTCTGCTTTAGGAGG 0: 1
1: 0
2: 0
3: 23
4: 247
Right 948811671 2:240481577-240481599 CCCCTCTCCATCACCTCGATGGG 0: 1
1: 0
2: 0
3: 6
4: 103
948811665_948811671 -3 Left 948811665 2:240481557-240481579 CCTTCCTGTCCTGCACCAGTCCC 0: 1
1: 0
2: 1
3: 42
4: 408
Right 948811671 2:240481577-240481599 CCCCTCTCCATCACCTCGATGGG 0: 1
1: 0
2: 0
3: 6
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948811671 Original CRISPR CCCCTCTCCATCACCTCGAT GGG Intronic