ID: 948811676

View in Genome Browser
Species Human (GRCh38)
Location 2:240481587-240481609
Sequence TCACCTCGATGGGTTGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 46}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948811667_948811676 -2 Left 948811667 2:240481566-240481588 CCTGCACCAGTCCCCTCTCCATC 0: 1
1: 1
2: 5
3: 42
4: 426
Right 948811676 2:240481587-240481609 TCACCTCGATGGGTTGCTCAGGG 0: 1
1: 0
2: 0
3: 2
4: 46
948811666_948811676 3 Left 948811666 2:240481561-240481583 CCTGTCCTGCACCAGTCCCCTCT 0: 1
1: 0
2: 2
3: 23
4: 307
Right 948811676 2:240481587-240481609 TCACCTCGATGGGTTGCTCAGGG 0: 1
1: 0
2: 0
3: 2
4: 46
948811665_948811676 7 Left 948811665 2:240481557-240481579 CCTTCCTGTCCTGCACCAGTCCC 0: 1
1: 0
2: 1
3: 42
4: 408
Right 948811676 2:240481587-240481609 TCACCTCGATGGGTTGCTCAGGG 0: 1
1: 0
2: 0
3: 2
4: 46
948811668_948811676 -8 Left 948811668 2:240481572-240481594 CCAGTCCCCTCTCCATCACCTCG 0: 1
1: 0
2: 2
3: 42
4: 478
Right 948811676 2:240481587-240481609 TCACCTCGATGGGTTGCTCAGGG 0: 1
1: 0
2: 0
3: 2
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948811676 Original CRISPR TCACCTCGATGGGTTGCTCA GGG Intronic