ID: 948811676

View in Genome Browser
Species Human (GRCh38)
Location 2:240481587-240481609
Sequence TCACCTCGATGGGTTGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 46}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948811665_948811676 7 Left 948811665 2:240481557-240481579 CCTTCCTGTCCTGCACCAGTCCC 0: 1
1: 0
2: 1
3: 42
4: 408
Right 948811676 2:240481587-240481609 TCACCTCGATGGGTTGCTCAGGG 0: 1
1: 0
2: 0
3: 2
4: 46
948811666_948811676 3 Left 948811666 2:240481561-240481583 CCTGTCCTGCACCAGTCCCCTCT 0: 1
1: 0
2: 2
3: 23
4: 307
Right 948811676 2:240481587-240481609 TCACCTCGATGGGTTGCTCAGGG 0: 1
1: 0
2: 0
3: 2
4: 46
948811667_948811676 -2 Left 948811667 2:240481566-240481588 CCTGCACCAGTCCCCTCTCCATC 0: 1
1: 1
2: 5
3: 42
4: 426
Right 948811676 2:240481587-240481609 TCACCTCGATGGGTTGCTCAGGG 0: 1
1: 0
2: 0
3: 2
4: 46
948811668_948811676 -8 Left 948811668 2:240481572-240481594 CCAGTCCCCTCTCCATCACCTCG 0: 1
1: 0
2: 2
3: 42
4: 478
Right 948811676 2:240481587-240481609 TCACCTCGATGGGTTGCTCAGGG 0: 1
1: 0
2: 0
3: 2
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948811676 Original CRISPR TCACCTCGATGGGTTGCTCA GGG Intronic
910491848 1:87781307-87781329 TCATCTCTACTGGTTGCTCATGG - Intergenic
911249635 1:95560014-95560036 TCAACTCCACGGGTAGCTCATGG + Intergenic
912255302 1:108052467-108052489 TCACTTCGATTGGGTGTTCAGGG + Intergenic
1074925045 10:118059959-118059981 CACCCTCGATGGGTGGCTCAAGG - Intergenic
1078186847 11:9059059-9059081 TCACATCGATGGGTTCTTTAAGG + Intronic
1078949105 11:16108741-16108763 CCACCTCAGTGGGTTGCTGAGGG - Intronic
1079381112 11:19938353-19938375 TCATCTAGATGGGTGGCTCAGGG + Intronic
1083705566 11:64511990-64512012 TCATCTCTATGGTTTGCTGAAGG + Intergenic
1085291097 11:75399988-75400010 TCAACTTGAAGGGTTGCTGACGG + Intronic
1105957706 13:25300291-25300313 TCACCTTGGTGGGTCGCCCATGG - Intergenic
1112355855 13:98674536-98674558 TTACCTCCAAGGGCTGCTCAGGG + Intergenic
1115336737 14:32249778-32249800 TCACCCTGATGGGTGGCTCATGG - Intergenic
1120594730 14:86419590-86419612 TCACCAAAATGGATTGCTCATGG - Intergenic
1120939370 14:89932224-89932246 ACACCTCCATAGGTGGCTCATGG + Intronic
1121409127 14:93737398-93737420 TCACCTGGATGAGCTGGTCATGG + Intronic
1147538046 17:41333699-41333721 TCACCTACATGATTTGCTCATGG + Intergenic
1151194180 17:72420260-72420282 GCAGTTCGATGGCTTGCTCAGGG + Intergenic
1159585104 18:70276644-70276666 TTACCTCCAAGGGTTTCTCAGGG - Intergenic
1162765738 19:12918420-12918442 TCACCTCGATGTGCTGCTGCGGG + Intronic
926312097 2:11682207-11682229 TCACCTCCAGGGGGCGCTCAAGG - Intronic
932502076 2:72191842-72191864 TCAGATGGATGAGTTGCTCATGG + Intronic
934104168 2:88680852-88680874 TTACCCTGATGGGTAGCTCACGG + Intergenic
934972371 2:98773831-98773853 TCACCCCGATGCCTTGCCCAGGG - Intergenic
936476322 2:112843131-112843153 TCACCTCCATGACTGGCTCATGG + Intergenic
948811676 2:240481587-240481609 TCACCTCGATGGGTTGCTCAGGG + Intronic
1175263158 20:57687390-57687412 TGACCTGGTTGGGTTGCTCTGGG - Intronic
1175840847 20:62026284-62026306 TCACGTCCCTGTGTTGCTCACGG - Intronic
961238559 3:125389929-125389951 TCACTTGGATGGGATGATCAGGG + Intergenic
964015483 3:151940390-151940412 TCATCTCAATTGGTTGTTCAAGG + Intergenic
965948701 3:174276909-174276931 CCACCTCTATAGGTTTCTCAGGG + Intronic
966096372 3:176208602-176208624 TCATCTGGATGGTTTGTTCAAGG + Intergenic
991432484 5:66562725-66562747 TCTCCTAGATGGGTTTTTCAAGG - Intergenic
996670456 5:126112177-126112199 TGACATCGATGGGTTTATCAGGG + Intergenic
997097512 5:130929708-130929730 TCACCTAGTTGGGTGGCACAGGG - Intergenic
1003687029 6:8314808-8314830 TCACCTAGTTGGGTGGCACAGGG + Intergenic
1003838827 6:10099260-10099282 TCACCTCCTTGGGTCCCTCAAGG + Intronic
1006405101 6:33840479-33840501 CTACCTCATTGGGTTGCTCAAGG + Intergenic
1012054894 6:94393823-94393845 TCACCTCCAAGGGTTCCTGATGG - Intergenic
1018645941 6:165948636-165948658 TCACCTCGATGGTTTCTTGATGG - Intronic
1026166105 7:67911194-67911216 CCACCTTGAGGGGTTTCTCATGG - Intergenic
1028850758 7:95534629-95534651 TCTCCTCTGTGGGTTGCTGATGG + Intronic
1032588751 7:133172893-133172915 TCACATCTGTGGGTAGCTCAAGG - Intergenic
1059947861 9:119430394-119430416 TCAACTCAAGGGCTTGCTCAAGG + Intergenic
1062416821 9:136455394-136455416 TCCCCTCCATGGGCTCCTCAGGG + Intronic
1190062845 X:47222080-47222102 TGACCTAGATGGATTGCTGAAGG - Intronic
1193286582 X:79721940-79721962 TCACCCTAATGGGTGGCTCATGG + Intergenic
1193605847 X:83567155-83567177 TCACCTAGTTGGGTGGCACAGGG + Intergenic
1194215284 X:91123692-91123714 TCACCCTGAGGGGTGGCTCATGG + Intergenic
1194413388 X:93581115-93581137 TCACCATGATGGGTTGCTTGTGG - Intergenic