ID: 948815709

View in Genome Browser
Species Human (GRCh38)
Location 2:240509391-240509413
Sequence AATCCTAACCTGCTGTGGAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 129}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948815709_948815721 28 Left 948815709 2:240509391-240509413 CCACTCCACAGCAGGTTAGGATT 0: 1
1: 0
2: 1
3: 14
4: 129
Right 948815721 2:240509442-240509464 ATGTCCCTGGCACACTGGGTGGG 0: 1
1: 0
2: 1
3: 15
4: 168
948815709_948815718 23 Left 948815709 2:240509391-240509413 CCACTCCACAGCAGGTTAGGATT 0: 1
1: 0
2: 1
3: 14
4: 129
Right 948815718 2:240509437-240509459 GGACTATGTCCCTGGCACACTGG 0: 1
1: 0
2: 1
3: 14
4: 158
948815709_948815722 29 Left 948815709 2:240509391-240509413 CCACTCCACAGCAGGTTAGGATT 0: 1
1: 0
2: 1
3: 14
4: 129
Right 948815722 2:240509443-240509465 TGTCCCTGGCACACTGGGTGGGG 0: 1
1: 0
2: 2
3: 21
4: 231
948815709_948815719 24 Left 948815709 2:240509391-240509413 CCACTCCACAGCAGGTTAGGATT 0: 1
1: 0
2: 1
3: 14
4: 129
Right 948815719 2:240509438-240509460 GACTATGTCCCTGGCACACTGGG 0: 1
1: 0
2: 0
3: 10
4: 112
948815709_948815716 15 Left 948815709 2:240509391-240509413 CCACTCCACAGCAGGTTAGGATT 0: 1
1: 0
2: 1
3: 14
4: 129
Right 948815716 2:240509429-240509451 AAGGAGCCGGACTATGTCCCTGG 0: 1
1: 0
2: 0
3: 2
4: 88
948815709_948815714 2 Left 948815709 2:240509391-240509413 CCACTCCACAGCAGGTTAGGATT 0: 1
1: 0
2: 1
3: 14
4: 129
Right 948815714 2:240509416-240509438 CTCCGTGGGATAGAAGGAGCCGG 0: 1
1: 0
2: 0
3: 10
4: 122
948815709_948815720 27 Left 948815709 2:240509391-240509413 CCACTCCACAGCAGGTTAGGATT 0: 1
1: 0
2: 1
3: 14
4: 129
Right 948815720 2:240509441-240509463 TATGTCCCTGGCACACTGGGTGG 0: 1
1: 0
2: 1
3: 20
4: 227
948815709_948815713 -4 Left 948815709 2:240509391-240509413 CCACTCCACAGCAGGTTAGGATT 0: 1
1: 0
2: 1
3: 14
4: 129
Right 948815713 2:240509410-240509432 GATTTGCTCCGTGGGATAGAAGG 0: 1
1: 0
2: 0
3: 5
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948815709 Original CRISPR AATCCTAACCTGCTGTGGAG TGG (reversed) Exonic
901754676 1:11434413-11434435 TATCCCAGGCTGCTGTGGAGGGG + Intergenic
904243312 1:29166032-29166054 AATCCTGACCAGCCATGGAGAGG - Intronic
910451343 1:87349091-87349113 GATCAAAACCTGCTGGGGAGAGG + Intergenic
911668735 1:100584804-100584826 AATGCTAACCTTCTCTGAAGGGG + Intergenic
914337884 1:146732214-146732236 AATACTCACCTGCTTCGGAGTGG - Intergenic
915095872 1:153461585-153461607 TGCCCTAACCTGCTGTGGAAAGG + Intergenic
918935600 1:190916690-190916712 AATCCTCACATGTTGTGGAAGGG + Intergenic
919372072 1:196740129-196740151 AATCCTCACGTGTTGTGGATGGG - Intronic
923489820 1:234474862-234474884 AATCCTAAACTGTTGTGCGGTGG + Intronic
1063368526 10:5506578-5506600 ATTCCTAACCTCCTGTACAGTGG - Intergenic
1065333228 10:24625938-24625960 AGTCCTATACTGCTGTTGAGTGG - Intronic
1077251250 11:1561668-1561690 AAACCTGCCCTGCTGTGGGGAGG + Intronic
1078125825 11:8562286-8562308 ATTTCTAACCTGCAGTGAAGTGG - Intronic
1079509542 11:21194962-21194984 AGTCCTAACCTGCTATGAACAGG - Intronic
1080203335 11:29699580-29699602 AAGCCTAAACTGCTGTGGTTTGG + Intergenic
1080600893 11:33819846-33819868 AATCCCATCCTGCAGTGCAGAGG + Intergenic
1080742330 11:35078182-35078204 AAACCTCACCTGCAGTGAAGAGG + Intergenic
1081282737 11:41230404-41230426 AATCCCTACCTTCAGTGGAGAGG + Intronic
1081937378 11:46914560-46914582 AATCCTCACAGGCTGAGGAGGGG + Intronic
1083642099 11:64151037-64151059 AACCCTGACCTGCTGTGTCGGGG - Intronic
1084345827 11:68548213-68548235 AATTCTGACCTGCTGTTGACTGG + Intronic
1087843567 11:102945332-102945354 AATTCAAACTGGCTGTGGAGTGG - Intronic
1089260979 11:117223830-117223852 AGGCCTAACCAGCTGTGGTGGGG + Intronic
1090064014 11:123488213-123488235 AATCCTAACCTCCAGTGCAATGG - Intergenic
1090083123 11:123627489-123627511 AATCCTGACGTGGGGTGGAGTGG + Intronic
1092038385 12:5361756-5361778 AATCGTGACCAGCTGGGGAGGGG - Intergenic
1092089650 12:5793958-5793980 AATCCCATCATGCTGTGGAAAGG - Intronic
1092152983 12:6263867-6263889 AATTCTCTCCTGCTGTGGGGGGG - Intergenic
1096538298 12:52289088-52289110 AGTCCTAGCCTGCTGTGGAAAGG + Intronic
1096540479 12:52304276-52304298 AGTCCTAGCCTGCTGTGGAAAGG - Intronic
1099078465 12:78143278-78143300 AAGCCTAACCTGATCTGCAGAGG + Intronic
1100245535 12:92753032-92753054 AATCCTAACCTTCAGTGGAGCGG - Intronic
1101997948 12:109538503-109538525 AATCCTCACGTGCTCTGGAGGGG - Intergenic
1108437636 13:50416623-50416645 AATCTTTACCTGCTTTGGGGTGG - Intronic
1108801225 13:54097898-54097920 AATGGAAACCTGCTTTGGAGAGG + Intergenic
1109547461 13:63847097-63847119 AATCTTCACATGCTGGGGAGGGG - Intergenic
1109761534 13:66836262-66836284 TATCCTAAACTACTGGGGAGAGG - Intronic
1111059370 13:82993571-82993593 TGTCCTCACCTGGTGTGGAGAGG - Intergenic
1112536609 13:100263445-100263467 AATCTTAATTTGGTGTGGAGAGG + Intronic
1114307536 14:21437384-21437406 CAACCTAACCTGCGGGGGAGGGG - Intronic
1117189015 14:53273100-53273122 AATTCTAACACTCTGTGGAGTGG + Intergenic
1117717594 14:58596819-58596841 AATCCTAACCTTATCTGGGGTGG - Intergenic
1120541219 14:85753288-85753310 AATTCCCACCTGTTGTGGAGAGG - Intergenic
1121073682 14:91048780-91048802 AATCCTAAAGTGCTGTGGGAGGG - Intronic
1122329635 14:100903865-100903887 ATTATTAACCTGATGTGGAGAGG + Intergenic
1130396774 15:83509212-83509234 AAGGCTGACCTGCCGTGGAGGGG + Intronic
1132177747 15:99728705-99728727 TATCCTCACTTCCTGTGGAGCGG - Exonic
1135583529 16:23648789-23648811 CATCCTAAACTGCGGTGAAGTGG + Intronic
1139996395 16:70985119-70985141 AATACTCACCTGCTTCGGAGTGG + Intronic
1140884372 16:79229801-79229823 AATCCTAACCTAGTGGTGAGAGG + Intergenic
1149163812 17:53726217-53726239 AATCCTCACATGTTGTGGAAGGG - Intergenic
1152630074 17:81406949-81406971 CATTCTGACCTGCTGTGGCGAGG + Intronic
1154474001 18:14734591-14734613 AATCCTTACCTGTTGTGGACAGG + Intronic
1157444773 18:47736496-47736518 GATCCTCACCTGCTGGGGATGGG - Intergenic
1162597850 19:11642746-11642768 AATCCTCACCTGTTGTGGAAGGG + Intergenic
927743165 2:25590639-25590661 AATGATTACCAGCTGTGGAGAGG - Intronic
931302318 2:60992423-60992445 ATTCATGACCTGTTGTGGAGTGG - Intronic
933485316 2:82914441-82914463 ACTCATAACCTGCTGTTGACTGG + Intergenic
933841700 2:86292122-86292144 AACCCTGACTAGCTGTGGAGTGG + Intronic
934123647 2:88865262-88865284 AAATATAAACTGCTGTGGAGGGG + Intergenic
935576812 2:104719569-104719591 AATCCTTACCTGTTGTGGGAGGG + Intergenic
936792730 2:116168668-116168690 AATCCTAGCTTGCTGTGCAGGGG + Intergenic
941763107 2:169266350-169266372 AATCCAGACCTGCTCTGGGGAGG - Intronic
942668652 2:178349965-178349987 AACCCTAAGCTGCCATGGAGAGG - Intronic
948815709 2:240509391-240509413 AATCCTAACCTGCTGTGGAGTGG - Exonic
1169398447 20:5257789-5257811 AATCCTAACCTCCAGTGTAATGG - Intergenic
1169476742 20:5938686-5938708 CATCCTAAACTGCTGATGAGTGG - Exonic
1170377431 20:15715974-15715996 AATGCCAACCTACTGTGAAGGGG - Intronic
1173121860 20:40300098-40300120 AAGCCTAAACAACTGTGGAGAGG - Intergenic
1173199969 20:40947236-40947258 AATCCTAACATCCAGTGTAGTGG - Intergenic
1174806241 20:53606711-53606733 AGCCCTGACCTGCTGTGGGGGGG - Intronic
1174992506 20:55526912-55526934 AATCCCAATGTGCTGTGGAGGGG + Intergenic
1175068593 20:56312211-56312233 AATCCCCACGTGCTGTGGAAGGG + Intergenic
1176359575 21:5983365-5983387 AATCCTAAGCTGCTGTGGCATGG - Intergenic
1179254742 21:39705766-39705788 AATCTTACCCTACAGTGGAGTGG + Intergenic
1179763943 21:43555185-43555207 AATCCTAAGCTGCTGTGGCATGG + Intronic
1182299030 22:29327817-29327839 AATCCTGACATTCGGTGGAGGGG + Exonic
1183706851 22:39479480-39479502 AACCTAAACCTGCTGTGGGGAGG - Intronic
1184813504 22:46853250-46853272 ATTTCTCACCTGCTGTGGTGGGG + Intronic
949651422 3:6164432-6164454 AATCCTCACGTGTTGTGGAAGGG + Intergenic
951006535 3:17622284-17622306 ATTCCTAACAGGCTGTGGACCGG + Intronic
951307763 3:21086486-21086508 AATCCTCACGTGTTGTGGAAGGG - Intergenic
953417105 3:42728933-42728955 AATCCTAGCCCTGTGTGGAGAGG + Intronic
953800575 3:46019647-46019669 GATCCCAAGCTGCTGTGGGGAGG + Exonic
956755605 3:72383102-72383124 AATGCTCACCTGTTGTTGAGGGG - Intronic
967373800 3:188778496-188778518 AATCCAACCCTGCTGTAGATAGG + Intronic
967809475 3:193744793-193744815 AGTCTGAACCTTCTGTGGAGTGG - Intergenic
969556638 4:7916032-7916054 AGTCCCCACCTGCTGGGGAGAGG + Intronic
970460068 4:16265826-16265848 AAGACTTACCTGGTGTGGAGAGG + Intergenic
975986479 4:80205370-80205392 AATCATAACTTGCTTTGTAGAGG - Intergenic
976367637 4:84247631-84247653 ACTCTGAACCTGCTGTGGAAGGG + Intergenic
980134083 4:128843870-128843892 AAGGCTGCCCTGCTGTGGAGTGG + Intronic
980136537 4:128863564-128863586 AATCCTAACCTGGTCTGGGAAGG - Intronic
981426716 4:144611844-144611866 AATCTTTACCTACTGTGTAGTGG - Intergenic
983105641 4:163682616-163682638 AATCCTCACATGCTGTGGAAGGG + Intronic
983622406 4:169774819-169774841 CATCCTATCCTGCTGTGGACCGG + Intergenic
983892474 4:173044833-173044855 AGTCTTAACCTTCAGTGGAGTGG - Intergenic
987296236 5:16554362-16554384 GCTCCCAAGCTGCTGTGGAGAGG - Intronic
987562866 5:19546709-19546731 TCTTCTAACCTCCTGTGGAGAGG + Intronic
991412241 5:66357137-66357159 AATCCTTACCTGCTCTCTAGGGG - Intergenic
992202126 5:74395025-74395047 AATCCTAACCCCCTGTGAGGAGG - Intergenic
993986386 5:94602506-94602528 AATCCCAACGTGTTGTTGAGAGG + Intronic
995690827 5:114824532-114824554 AATCCTCACATGCTGTGGTAGGG - Intergenic
1001871715 5:175161859-175161881 AAGCCTAACTTGCTGTTGTGAGG + Intergenic
1002966356 6:1970426-1970448 ACTCCTATCCAGCTCTGGAGCGG - Intronic
1004007548 6:11650974-11650996 AATCATAACATCCTGTAGAGAGG + Intergenic
1004848353 6:19670551-19670573 AAACCTTACTTACTGTGGAGAGG - Intergenic
1012173742 6:96052258-96052280 AATCCCTACCTGTTGTGGAAGGG - Intronic
1015565375 6:134564581-134564603 AAACCAAATCTGCAGTGGAGAGG + Intergenic
1018641034 6:165904241-165904263 AATCCGAAGCAGCAGTGGAGGGG + Intronic
1019924644 7:4184093-4184115 AACCCTAATCTGCTGAGGAGAGG + Intronic
1020254539 7:6495476-6495498 AATCCTCACCCTGTGTGGAGTGG + Intergenic
1021808922 7:24383887-24383909 AATCCTAACCCGCAGTGTGGTGG + Intergenic
1026776085 7:73231832-73231854 AGGCCTACACTGCTGTGGAGGGG + Intergenic
1027016942 7:74785203-74785225 AGGCCTACACTGCTGTGGAGGGG + Exonic
1027071085 7:75160733-75160755 AGGCCTACACTGCTGTGGAGGGG - Intergenic
1027975858 7:85154455-85154477 AATCCTACCATGTTGTGGGGCGG + Intronic
1030942843 7:115676605-115676627 AATCCAAATCTGCTGTTGGGAGG + Intergenic
1032457419 7:132083932-132083954 AATCCTAAACTTCAGAGGAGGGG - Intergenic
1035285540 7:157804158-157804180 ATTCCTCACCGGGTGTGGAGGGG + Intronic
1035585657 8:771278-771300 AATGCAAACGTGCTGTGCAGAGG + Intergenic
1037095434 8:14980753-14980775 AATCCTCACATGTTGTGGGGAGG - Intronic
1038229905 8:25690253-25690275 AAGCATCACCTGCTGTGCAGGGG - Intergenic
1040781641 8:51116593-51116615 AATCCTGACCTGAAGTGGTGTGG - Intergenic
1043992997 8:86779558-86779580 AATTCTCACGTGTTGTGGAGGGG + Intergenic
1045007328 8:97927994-97928016 AATCTTTACCTGCTGAGAAGAGG - Intronic
1045259131 8:100556957-100556979 AATACTACCCTTCTGTGCAGGGG + Intronic
1048310959 8:133322288-133322310 AATCTTCACCTGTTGTGCAGAGG - Intergenic
1051233812 9:14978344-14978366 CATCCTATCCTGCTCTGGACCGG - Intergenic
1053412729 9:37926087-37926109 AATGCTAACCTGCTGTGATGTGG + Intronic
1061176933 9:129003236-129003258 ACACCTACCCTCCTGTGGAGAGG - Intronic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1185545979 X:946126-946148 CTTCCTACCCTGCTGTGGACAGG - Intergenic
1188764890 X:34079674-34079696 AATCCCTACCTGCTGTGGGAGGG - Intergenic
1190913128 X:54790083-54790105 AATGCTAAACAGCTTTGGAGGGG + Intronic
1190917815 X:54823226-54823248 AATGCTAAACAGCTTTGGAGGGG - Intergenic
1192310330 X:70007339-70007361 AATCCATACATGTTGTGGAGGGG + Intronic
1193190599 X:78565366-78565388 AATCCCAACCTGTTGAGGAAGGG - Intergenic
1195376130 X:104229890-104229912 AATCTTGATTTGCTGTGGAGAGG + Intergenic
1195405430 X:104507955-104507977 AACCCTTACCTACTGTGGAAGGG + Intergenic
1195569949 X:106386590-106386612 GATCCTAGCCTGCTTTGAAGAGG + Intergenic
1198278423 X:135118847-135118869 CATCCTAACATGCTGTGCAGGGG - Intergenic
1198292539 X:135253669-135253691 CATCCTAACACGCTGTGCAGGGG + Intronic
1199021854 X:142888506-142888528 AGTTCTAAACTGCTGTGGAAGGG - Intergenic
1200417252 Y:2925398-2925420 AATCCCCACCTGCTGTGGGAGGG - Intronic