ID: 948817255

View in Genome Browser
Species Human (GRCh38)
Location 2:240518425-240518447
Sequence AAATTGGGGGTTTCATAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 158}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948817255_948817265 24 Left 948817255 2:240518425-240518447 CCCTGCTATGAAACCCCCAATTT 0: 1
1: 0
2: 2
3: 22
4: 158
Right 948817265 2:240518472-240518494 GAACAATCTCCTGCTCTCCCTGG 0: 1
1: 0
2: 2
3: 12
4: 161
948817255_948817263 -5 Left 948817255 2:240518425-240518447 CCCTGCTATGAAACCCCCAATTT 0: 1
1: 0
2: 2
3: 22
4: 158
Right 948817263 2:240518443-240518465 AATTTTAGTCGGTTGAGGACAGG 0: 1
1: 0
2: 0
3: 5
4: 82
948817255_948817264 -4 Left 948817255 2:240518425-240518447 CCCTGCTATGAAACCCCCAATTT 0: 1
1: 0
2: 2
3: 22
4: 158
Right 948817264 2:240518444-240518466 ATTTTAGTCGGTTGAGGACAGGG 0: 1
1: 0
2: 11
3: 29
4: 166
948817255_948817259 -10 Left 948817255 2:240518425-240518447 CCCTGCTATGAAACCCCCAATTT 0: 1
1: 0
2: 2
3: 22
4: 158
Right 948817259 2:240518438-240518460 CCCCCAATTTTAGTCGGTTGAGG 0: 1
1: 5
2: 20
3: 64
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948817255 Original CRISPR AAATTGGGGGTTTCATAGCA GGG (reversed) Intronic
900280251 1:1862606-1862628 AAATCGGGGGCATCAGAGCACGG - Intronic
903316517 1:22512168-22512190 TAATTGTGGGTTTTATAGCTTGG + Intronic
906016674 1:42588009-42588031 AAATTTGGGGGGTTATAGCAGGG + Intronic
908507444 1:64818805-64818827 AAAGAGGGGGTTGCATAGGAAGG + Intronic
909104551 1:71392146-71392168 AAATGTGGGGTTTCATGTCATGG + Intergenic
909829094 1:80162792-80162814 AAACTGGGGGATATATAGCAAGG - Intergenic
911502639 1:98707385-98707407 AAATTATGGCTTTCATAGGATGG - Intronic
912696074 1:111843195-111843217 AGTTTGGGGTTTCCATAGCAAGG + Intronic
916164158 1:161949915-161949937 AAATTTGTGTTTTCATAGGAGGG - Intronic
918620121 1:186594155-186594177 AAATCTGGGGTTTCATATTAAGG - Intergenic
919825302 1:201499269-201499291 AAAATCGGGGTTTTGTAGCAAGG - Intronic
1063693965 10:8314896-8314918 AACTTCTGGGTTACATAGCATGG + Intergenic
1064211048 10:13360732-13360754 CACTTGGGAATTTCATAGCATGG - Intergenic
1065360119 10:24881602-24881624 AAAATGGTGGTTTTATAGAAAGG - Intronic
1066338999 10:34510913-34510935 AAATTGGGCATTTAATAGTAAGG - Intronic
1066494194 10:35926207-35926229 AAATTGGAGGTATCAGAGGAGGG + Intergenic
1066612960 10:37268765-37268787 AAATTGGATGTTTCTCAGCAAGG + Intronic
1067260513 10:44685908-44685930 AATTTGTGAGTTTCCTAGCAGGG + Intergenic
1068526111 10:58131885-58131907 AAATTGCTGGTTTCATCCCAAGG + Intergenic
1068942210 10:62691122-62691144 AAATTGGAGGTTCCAAAACAGGG + Intergenic
1075213868 10:120515153-120515175 AAATTAGGGGTTTAATTACAGGG + Intronic
1080875424 11:36270428-36270450 TTATTGGGGTTTTCATAGGAAGG - Intergenic
1086416165 11:86590770-86590792 AAATTAGCTGTTTCTTAGCATGG - Intronic
1088153354 11:106775147-106775169 AAATTTGCAGTTTCATAGTATGG - Intronic
1090264309 11:125344373-125344395 AAATTGGGGGTTGGATGGGAAGG + Intronic
1090842437 11:130503390-130503412 AATTTGGGGGACTCAAAGCAGGG - Intergenic
1091877665 12:3949674-3949696 AATTAGGGGTTTTTATAGCAGGG - Intergenic
1092029279 12:5270415-5270437 AGTTTGTGGATTTCATAGCATGG - Intergenic
1092585615 12:9898425-9898447 AAATTGGGGTTTACATACCAGGG - Intergenic
1093626802 12:21359500-21359522 AAATGGTGGATTTCATTGCAAGG - Intronic
1098572758 12:72007432-72007454 AAATTTGGGGTTTCAAATCTTGG + Intronic
1100020983 12:90069379-90069401 ATATTGGGGCTTTCAGAGCCTGG + Intergenic
1101022809 12:100571157-100571179 AATTAGGGGGTTATATAGCAGGG + Intergenic
1102053474 12:109879831-109879853 AAATGGGGGGATTCATTGTAAGG + Intronic
1105730884 13:23214241-23214263 AACTAGGGGTTTTTATAGCAGGG - Intronic
1106832818 13:33603218-33603240 AACTTGGGGTTTATATAGCAGGG - Intergenic
1107295173 13:38900199-38900221 AGATTGGGGTTTGCATAGTAGGG + Intergenic
1108751273 13:53450615-53450637 AAATTAGGGTTTAAATAGCAGGG - Intergenic
1109066164 13:57695363-57695385 AAATTGGAGTTTTCATATGAAGG + Intronic
1110495836 13:76166882-76166904 AAATTGGGGGTTTTTTTGAAAGG - Intergenic
1111488571 13:88938355-88938377 AACTAGGGGGTTTTATAGCAGGG - Intergenic
1111912422 13:94327485-94327507 AAAATGGTGTTTTCATATCACGG + Intronic
1112576234 13:100639204-100639226 AATTTGTGGTTTTCAGAGCAAGG + Intronic
1114035228 14:18619466-18619488 AGATTGGGGGTTTACTAGCAAGG + Intergenic
1114123417 14:19695549-19695571 AGATTGGGGGTTTACTAGCAAGG - Intergenic
1114673303 14:24425262-24425284 AAGTTGGGAGTTTTATAACAAGG - Intergenic
1116476069 14:45341150-45341172 AACTTGTGTGTTACATAGCAAGG + Intergenic
1118134156 14:63003124-63003146 AAGTTGCGGTTTTCACAGCAAGG - Intronic
1118648747 14:67867678-67867700 AAACTGGGGCTCTCATAGCGAGG + Intronic
1122538732 14:102484579-102484601 AAAGTGGGGGATGCATGGCAAGG - Intronic
1123066021 14:105619748-105619770 AAATTTGGGGGGCCATAGCATGG + Intergenic
1123755093 15:23391543-23391565 AACTTGGGGGTTTCTTAGGCAGG - Intergenic
1124448440 15:29761860-29761882 ATATTTTGGTTTTCATAGCAAGG - Intronic
1124906171 15:33870807-33870829 AAAGTGAGGGTTTCATATCAAGG - Intronic
1125415290 15:39446155-39446177 AGATGGGTGGTGTCATAGCAAGG - Intergenic
1126362062 15:47856856-47856878 AAATGGAGAGTTTCACAGCAGGG + Intergenic
1129027082 15:72586667-72586689 AAATTGGTTGTTTCTTTGCAGGG + Exonic
1129888530 15:79055732-79055754 AAATTGGTTGTTTGATAGCCTGG - Intronic
1132016162 15:98319179-98319201 AAACTAGAGGTTTTATAGCAGGG - Intergenic
1134461277 16:14431458-14431480 AACTTGGGGGTTTCTTAGGCAGG + Intergenic
1138571753 16:57878682-57878704 AAATCGGGGCTTTGTTAGCAAGG + Intergenic
1139798280 16:69500333-69500355 AACTTGGGGGTTTTATACCATGG + Intergenic
1140533810 16:75690807-75690829 AATTAGGGAGTTACATAGCAGGG - Intronic
1141249239 16:82339722-82339744 AAACTGGGGCTTTCAGAGGAAGG + Intergenic
1142758359 17:2028888-2028910 TAATTAGGGGTTTCCAAGCAGGG + Intergenic
1143938728 17:10515654-10515676 AAATTGTGTGTTTCCAAGCAAGG + Intronic
1149273453 17:55008659-55008681 AAACTGGGGGGAGCATAGCAAGG + Intronic
1149771773 17:59328221-59328243 AAATTGGGGTTATGATAGAAAGG + Intergenic
1151308208 17:73277401-73277423 AAATTGAGGGTTTGATACCAAGG - Intergenic
1151406590 17:73891444-73891466 AAATTGGATGTTTCCTTGCAAGG - Intergenic
1151424105 17:74018639-74018661 TAATTTGGGCTTTCATAACAAGG - Intergenic
1153087343 18:1303252-1303274 AAATTGGGGGATTAAAAGCAGGG - Intergenic
1153252790 18:3139412-3139434 AAATTGAAGGGTTTATAGCAAGG - Intronic
1154049263 18:10937930-10937952 AAATGGTGGGTTTCAGAGAACGG + Intronic
1160936555 19:1598898-1598920 AAAATGGGGGTGTAAGAGCACGG + Intronic
1167595735 19:50427218-50427240 TAACTGGGAGTTTCAAAGCAGGG - Intronic
927449891 2:23199542-23199564 AAATTGGGGGGTTGTTAGAAGGG - Intergenic
927631317 2:24776582-24776604 ACAGTGGGGGCTTCATGGCAAGG - Intergenic
928696129 2:33852005-33852027 AATTTGGGGTTTATATAGCAGGG + Intergenic
929491058 2:42396700-42396722 AAGTTGGGGGTCACAGAGCATGG + Intronic
930340957 2:50113808-50113830 AACTTGGGAGTTTCATAGGAAGG - Intronic
933102918 2:78282788-78282810 AAATTGGGGGTCTGATGGTAAGG + Intergenic
933463390 2:82619157-82619179 AACTAGGGGTTTACATAGCAGGG - Intergenic
934137315 2:89009106-89009128 AATTAGGGGGTTATATAGCAGGG - Intergenic
934233787 2:90211383-90211405 AATTAGGGGGTTATATAGCAGGG + Intergenic
935296423 2:101653621-101653643 AATTAGGGGTTTACATAGCAGGG - Intergenic
935818415 2:106869470-106869492 AAATTGCGGGCTTCCTAGGATGG - Intronic
936929496 2:117772905-117772927 AAATTGGGGATTTCAATCCAAGG + Intergenic
937271099 2:120653539-120653561 AACATGGGGGTTTAAGAGCAAGG - Intergenic
937739933 2:125339326-125339348 ATTTAGGGGGTTACATAGCAGGG - Intergenic
938276017 2:130023418-130023440 AGATTGGGGGTTTACTAGCAAGG - Intergenic
938326973 2:130414166-130414188 AGATTGGGGGTTTACTAGCAAGG - Intergenic
938362970 2:130707310-130707332 AGATTGGGGGTTTACTAGCGAGG + Intergenic
938439354 2:131313939-131313961 AGATTGGGGGTTTACTAGCGAGG + Intronic
943341537 2:186688036-186688058 AAATTAAGGGTTATATAGCAGGG - Intergenic
944299633 2:198108474-198108496 AAGTTGGGGGATTGACAGCATGG + Intronic
944532034 2:200676738-200676760 AAAGTGGGGGTAACAGAGCAAGG + Intronic
947405454 2:229771397-229771419 AAAATGGGTGTTAGATAGCAGGG - Intronic
947913521 2:233817883-233817905 CAAATGGGTGTTTCAGAGCAGGG + Intronic
948502718 2:238406847-238406869 AAATTTGTGGTTTCAAAGCCGGG + Intergenic
948570530 2:238914600-238914622 ATATTGGGGGCTTCATCTCAGGG - Intergenic
948645961 2:239404942-239404964 AAATAAGGGGTTTTATATCAGGG + Intergenic
948656687 2:239480577-239480599 AGATGGGGGGATTCATAGCATGG - Intergenic
948817255 2:240518425-240518447 AAATTGGGGGTTTCATAGCAGGG - Intronic
1173699743 20:45058374-45058396 AAATTGGGGATTTCTTAGCGTGG - Intronic
1174281067 20:49439676-49439698 AAATTGGGGTTCTGTTAGCAAGG - Intronic
1174535281 20:51246711-51246733 AAAATGGGAGTATCATAGCCTGG - Intergenic
1177301551 21:19251856-19251878 ATAAAGTGGGTTTCATAGCAGGG + Intergenic
1180459346 22:15546512-15546534 AGATTGGGGGTTTACTAGCAAGG + Intergenic
951542343 3:23794070-23794092 TAATTTAGGGTTTCATAGTAAGG - Intergenic
955207030 3:56905401-56905423 AAATTGATTATTTCATAGCATGG - Intronic
959417784 3:106098341-106098363 AACTCGGGGTTTACATAGCAGGG - Intergenic
959623038 3:108419601-108419623 AAACTGGGGGCTTGGTAGCAAGG + Intronic
962232211 3:133675522-133675544 AGATTGGAGGTTTCATAGAAAGG + Intergenic
966748747 3:183302499-183302521 AAAGAGGGGGTTCCATAGCCGGG + Intronic
968814132 4:2812939-2812961 ACATTGCAGGTTTCAGAGCATGG - Intronic
971327576 4:25656646-25656668 AAGTTGGGGGCTGCATGGCATGG + Intronic
971426917 4:26525202-26525224 TGATTGGGCTTTTCATAGCATGG - Intergenic
974414170 4:61583165-61583187 AACTAGGGGCTTTCATAGAAGGG - Intronic
974538986 4:63208558-63208580 AATTAGGGGTTTACATAGCAAGG - Intergenic
976137025 4:81949508-81949530 TACTTGTGGGTTTAATAGCATGG - Intronic
976659464 4:87524620-87524642 AACTAGGGGTTTACATAGCAAGG - Intronic
977763169 4:100764554-100764576 AAATAGTGGGTTTCATACTAGGG + Intronic
980724705 4:136743174-136743196 AAATTAGGGGTTTAATAGCAGGG + Intergenic
981841330 4:149116051-149116073 AAATCAAGGGTTTCAAAGCAGGG - Intergenic
982531675 4:156552649-156552671 ATATAGTGGGTTTCATACCAGGG - Intergenic
983954450 4:173680601-173680623 ACATTGGGGGGTTCAGAGTAGGG + Intergenic
984269480 4:177533690-177533712 AAATTAGGGGTTTTATAGCAGGG - Intergenic
984377924 4:178955495-178955517 AAATTTGTGGTTTAATAGCAAGG + Intergenic
984512468 4:180694935-180694957 ACAGTGGGGTTTTCTTAGCATGG - Intergenic
986956966 5:13163831-13163853 ATAATGGTGGATTCATAGCAGGG - Intergenic
988906384 5:35794921-35794943 CAAATGGGGGTTTCAGAGGAGGG - Intronic
990292229 5:54363892-54363914 AAATTGGGCATTTAATTGCATGG + Intergenic
991384519 5:66070336-66070358 AAATTGGGAGGTTCCTAGCTGGG - Intronic
991561776 5:67961263-67961285 AATTCAAGGGTTTCATAGCATGG - Intergenic
992391453 5:76334899-76334921 AAATGGGGGGTTTGTAAGCAAGG + Intronic
994167169 5:96619789-96619811 AAATTGGTGGTTTCTTGGTATGG - Intronic
994540010 5:101082762-101082784 TAATTTGCTGTTTCATAGCATGG - Intergenic
994608046 5:101995690-101995712 AAAAGTGGGGTTTTATAGCAAGG + Intergenic
998564180 5:143201430-143201452 ATATTGGAGGTTTCAGAGCCAGG + Intronic
999882257 5:155878648-155878670 AAATTGGGATTCTCTTAGCAAGG + Intronic
1000429640 5:161135951-161135973 AAATTGGGAGTTTCAAAACTAGG + Intergenic
1001154654 5:169262586-169262608 AAATTGGTGGTTTCCTTGCTCGG - Intronic
1006672821 6:35740242-35740264 AGTTTGGGGGTATGATAGCAGGG - Intronic
1008008132 6:46434284-46434306 AAATTGTGGGATTCAGACCAAGG - Intronic
1008310794 6:49970610-49970632 TATTTGGAGTTTTCATAGCAAGG + Intergenic
1009611377 6:65945945-65945967 AGATTGGGAGTTTCATTGAAGGG - Intergenic
1010005840 6:70994005-70994027 AAATTGGGGTTTATCTAGCAGGG + Intergenic
1010142550 6:72627836-72627858 ACATTAGGAGTTTAATAGCAAGG - Intronic
1012934308 6:105349741-105349763 AAATTGGAGGTTTCACAACATGG + Intronic
1013755084 6:113451992-113452014 AAATTAGGGGTTATATAGCAGGG - Intergenic
1015354325 6:132259242-132259264 AGCTTGGTTGTTTCATAGCAAGG - Intergenic
1016200620 6:141403121-141403143 AATTTGGGGGTTACATGACAGGG - Intergenic
1016350706 6:143164038-143164060 AAATTGGTGGTTTCGTAGGTCGG - Intronic
1016909821 6:149187148-149187170 CAAGTGGGGGTTTCATACCAGGG - Intergenic
1017752608 6:157502483-157502505 AAATTTGGGGTTGCTGAGCATGG - Intronic
1020376289 7:7491138-7491160 CAATTGGGGGTTTATCAGCAGGG - Intronic
1020505826 7:8986870-8986892 ACATTTGGGGTCTTATAGCATGG + Intergenic
1023753534 7:43394532-43394554 AAATTGGGGTTTATATATCAGGG + Intronic
1031062469 7:117067461-117067483 AAAGTAGGGGTTTTATAGCCAGG + Intronic
1032609870 7:133401330-133401352 AAATTTGGTCTTTCTTAGCAAGG + Intronic
1033710447 7:143937670-143937692 CAATTCTGGGTTGCATAGCAGGG + Intergenic
1039303756 8:36238774-36238796 AAATTGGGGGGAACATAGCAAGG - Intergenic
1042300065 8:67269311-67269333 AAATTTAGGTTTTCATAGCTGGG + Intronic
1045499676 8:102735551-102735573 AGAGTGGGGGCTTCATGGCATGG - Intergenic
1045683090 8:104683369-104683391 AACTGGAGGGTTTGATAGCAAGG - Intronic
1047670716 8:127143210-127143232 AATTAGGGGTTTACATAGCAGGG + Intergenic
1048953665 8:139516515-139516537 AACTCGGGGCTTTCACAGCAAGG - Intergenic
1054722774 9:68619951-68619973 AAATTGGCAGTTTCAATGCATGG + Intergenic
1055290029 9:74772856-74772878 AAATTGGGGGTTTCCTCTCTCGG + Intronic
1055550763 9:77430176-77430198 AAATTGAGGCTTTTATAGAATGG - Intronic
1055950487 9:81725408-81725430 AAATGGGAGGTTTATTAGCAAGG + Intergenic
1056453654 9:86740071-86740093 AAATTGGGGGTTGCAAAGGTTGG + Intergenic
1058163559 9:101595268-101595290 AAATTGGGGTTATCATGGAAAGG - Intronic
1058351769 9:104033817-104033839 ATAATGTGGGTTTCACAGCAGGG + Intergenic
1186235560 X:7504927-7504949 AAATTGGGGGTTTTATAGTGTGG + Intergenic
1187491280 X:19753739-19753761 CACTTGGTGGTTTGATAGCATGG - Intronic
1189115694 X:38340198-38340220 AAAGTGGGGTTTTCATTGGAGGG - Intronic
1190476882 X:50836953-50836975 AAAGTGCAGGGTTCATAGCAGGG - Intergenic
1190751773 X:53368231-53368253 AAATTGGGAGTTTAATGGGAAGG + Intergenic
1195485622 X:105402254-105402276 AAATTGAGTCTTTCATAGCAGGG - Intronic
1196637922 X:118025134-118025156 AAAATAGGGGAATCATAGCAGGG - Intronic
1200914705 Y:8561361-8561383 AAATTGGGAGTTTGCCAGCATGG - Intergenic