ID: 948817662

View in Genome Browser
Species Human (GRCh38)
Location 2:240521067-240521089
Sequence ACTTGGGCCTCAAGAGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 210}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948817656_948817662 10 Left 948817656 2:240521034-240521056 CCAGGTCAGGAGTAAACTGTGCC 0: 1
1: 0
2: 0
3: 4
4: 96
Right 948817662 2:240521067-240521089 ACTTGGGCCTCAAGAGAGGCTGG 0: 1
1: 0
2: 0
3: 12
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948817662 Original CRISPR ACTTGGGCCTCAAGAGAGGC TGG Intronic
900633993 1:3652816-3652838 ACTTGGCGCTCGCGAGAGGCTGG + Intronic
903229495 1:21913302-21913324 ACTGGGGCTTGAAGACAGGCTGG - Intronic
904006936 1:27367945-27367967 ACTTGGCCTGCAACAGAGGCTGG + Intergenic
904248816 1:29207623-29207645 ACTTCAGCCTCATGAGAAGCCGG - Intronic
905016305 1:34781275-34781297 ACCTCGGCCTCCAGGGAGGCCGG - Exonic
905341816 1:37283387-37283409 ACCTGGGCCTTTAGGGAGGCAGG + Intergenic
906142386 1:43541353-43541375 CCTTGGGCCCCCACAGAGGCTGG + Intronic
906961022 1:50419515-50419537 GCTCGGGCCTCCAAAGAGGCAGG - Exonic
907286374 1:53383073-53383095 ACTGAGGCCTCAAGAGGGGAAGG + Intergenic
910121416 1:83794337-83794359 CCTTGAGCCTCAAAAGAAGCAGG + Intergenic
914378771 1:147097741-147097763 ACTTGTGCAGCAGGAGAGGCAGG + Intergenic
914761459 1:150602155-150602177 ACTTTGGCCTCCAGAGTAGCTGG - Intronic
915320727 1:155054753-155054775 ACTTCGGCCTCCTGAGTGGCTGG - Intronic
919943994 1:202306846-202306868 GCTAGGGCAGCAAGAGAGGCTGG - Exonic
1063473252 10:6306146-6306168 GCCTGGGCCTCATGAGTGGCTGG + Intergenic
1065634762 10:27719871-27719893 CCTTGGGCCTCGAGAGTAGCTGG - Intronic
1065791645 10:29265889-29265911 ACTTGAGCCTCACGAGTAGCTGG - Intergenic
1066355330 10:34678187-34678209 ACCTCGGCCTCCAGAGTGGCTGG + Intronic
1071515244 10:86292614-86292636 CCTTGGCCCTGAAGAGAGGGAGG - Intronic
1071523369 10:86344600-86344622 ACTTTGGCTCCAAAAGAGGCTGG - Intronic
1073185277 10:101612051-101612073 ACACAGGCCTCAAGAAAGGCTGG + Intronic
1073394169 10:103204514-103204536 ACTTTAGCCTCATGAGTGGCTGG - Intergenic
1074281374 10:112054880-112054902 ACTTGTGTCTGAAGAGAGGAAGG - Intergenic
1074877174 10:117622505-117622527 ACTTGGGCTGATAGAGAGGCAGG - Intergenic
1075612016 10:123862062-123862084 CCTTGGGCCTCAAGACTGTCAGG - Intronic
1076560726 10:131361609-131361631 ACATGGGCACCAAGAAAGGCAGG - Intergenic
1077915781 11:6610763-6610785 ACTGTGGCCCCAAGAGGGGCGGG + Exonic
1078907556 11:15701969-15701991 AGTTGGGACTCATGAGAGCCCGG - Intergenic
1079565566 11:21878149-21878171 CCTTGGGCTTGAAGAGAGGGAGG + Intergenic
1079660949 11:23035804-23035826 ACTTGGGCTTCAGGAGACGGAGG + Intergenic
1080755259 11:35191141-35191163 ACTTGGGCCTCCAAAGAGTGTGG + Intronic
1081192182 11:40117534-40117556 CCTTTGGCCACAAGAGATGCAGG - Intronic
1081570375 11:44286935-44286957 CCTTGGCCCTCCAGAGAGGGTGG + Intronic
1083810808 11:65105669-65105691 ACTAGTGCCTGAAGGGAGGCAGG - Intronic
1083854417 11:65385649-65385671 ACTTGGGGCCCCAAAGAGGCAGG - Intergenic
1084433843 11:69126598-69126620 AGGTGGGCCTCAAGCAAGGCTGG - Intergenic
1085345861 11:75767973-75767995 AACTGAGGCTCAAGAGAGGCAGG + Intronic
1085912942 11:80850263-80850285 ACTTCGGCCTCCAGAGTAGCTGG + Intergenic
1086164333 11:83760315-83760337 AATTGAGGCTCAAAAGAGGCTGG + Intronic
1090998380 11:131887434-131887456 ACTTGTGCCTGAAGAATGGCAGG - Intronic
1092073474 12:5653136-5653158 ATTTGGGCTTCAAAAGAAGCAGG + Intronic
1094798968 12:34008177-34008199 ATTTGGTCCTGAAAAGAGGCTGG - Intergenic
1095748138 12:45682370-45682392 ACTTGGGCTTCAGGAGTCGCAGG + Intergenic
1095997949 12:48105585-48105607 ACTCGGGTCTCAAGGAAGGCGGG + Exonic
1097107075 12:56632292-56632314 ACTGAGGCCTCAAGGGCGGCGGG + Intronic
1097626100 12:62002382-62002404 ACTTGAGACACAAGGGAGGCAGG - Intronic
1099635575 12:85206795-85206817 GCTTGGGCCCCAGGGGAGGCCGG + Intronic
1100764106 12:97844457-97844479 ACTTGGGCAAGAGGAGAGGCTGG - Intergenic
1102242475 12:111333645-111333667 ACATGGGCCTCCTGAGAGGATGG - Intronic
1102561126 12:113762927-113762949 CCTTGGGCCTGGCGAGAGGCTGG - Intergenic
1103107598 12:118244175-118244197 ACTTGAGCCTCCCGAGTGGCTGG + Intronic
1108482631 13:50890188-50890210 ACATGGGCCTCCAGAGAATCCGG - Intergenic
1111739441 13:92184469-92184491 GCTTGGGCCTCAGGAGAAGTAGG - Intronic
1114238499 14:20843890-20843912 ACTTTGGCCTCTTGAGAAGCTGG - Intergenic
1114924809 14:27383449-27383471 GCTTGTGCCACAGGAGAGGCTGG + Intergenic
1119172434 14:72545331-72545353 ACTTGCTGCTCCAGAGAGGCAGG - Intronic
1119392461 14:74300261-74300283 ACCTGGGCCTGAAGAGAAGGTGG + Exonic
1120304977 14:82758208-82758230 ACTTGGGCATCAAGACTGCCAGG + Intergenic
1125165263 15:36696653-36696675 ACCTCGGCCTCCAGAGTGGCTGG + Intronic
1126198555 15:45958377-45958399 ACTCGGGCCTCTTGAGAGGGAGG + Intergenic
1128635032 15:69297761-69297783 ACTGGGGCCTACACAGAGGCAGG - Intergenic
1129012570 15:72435701-72435723 ACCTCGGCCTCAAGAGTAGCTGG + Intergenic
1129653048 15:77505092-77505114 ACCAAGGCCTCAAGAGAGGAAGG - Intergenic
1129795874 15:78375338-78375360 ACCTGGGCCTGAAGAGGAGCAGG + Intergenic
1129908823 15:79209306-79209328 GATTGGTCCTCCAGAGAGGCTGG - Intergenic
1131796809 15:96026845-96026867 ACTTTGGCCTAAAAACAGGCTGG - Intergenic
1132520708 16:386790-386812 GCTTCGGCTTCAGGAGAGGCAGG - Intronic
1132785939 16:1657009-1657031 CCTTGGGCCGCCAGAGGGGCTGG - Intronic
1137674354 16:50296970-50296992 GGTTGGGCCTCATGTGAGGCAGG + Intronic
1137720264 16:50623511-50623533 ACTTGGGCTTCCAGGGAGGCAGG - Intronic
1139918428 16:70442617-70442639 ACTTCGGCCTCTAGAGTAGCTGG - Intergenic
1140314226 16:73879076-73879098 ACTTGGTCCTCAAGAGAAGTTGG - Intergenic
1141969130 16:87468487-87468509 ACTTCAGCCTCCAGAGAAGCTGG + Intronic
1142052279 16:87966709-87966731 ACTGGCCCCTTAAGAGAGGCAGG + Intronic
1142158124 16:88542237-88542259 GCTTGGGCCTCTCAAGAGGCTGG + Intergenic
1142839755 17:2618760-2618782 GCTTGGGCCTCACGAGTAGCTGG + Intronic
1143144174 17:4762994-4763016 ACTGGGGCCTCCAGAGGGGAAGG + Intergenic
1143279983 17:5746621-5746643 ACTTAGGCCCCAATAGAGGTGGG - Intergenic
1144206823 17:12985204-12985226 AGTGGGGCCTCAGGAGAGGCTGG + Intronic
1146000168 17:29126170-29126192 ATTTGGTGCTCAAGATAGGCAGG - Intronic
1146006597 17:29164460-29164482 CCTTGGGCCTGAAGAGGGGCTGG - Intronic
1146738310 17:35258756-35258778 CCTTGGGACTCAGCAGAGGCAGG + Exonic
1147408391 17:40230254-40230276 ACTTGAGCCCCAGGAGAGGGAGG + Intronic
1148552312 17:48557820-48557842 ACTTGGGGCTCAAGCCAGCCTGG + Intronic
1149867279 17:60157854-60157876 ACCTGGGACTCCAGCGAGGCAGG + Intronic
1150327202 17:64266714-64266736 ACCTGGGTTTCAAGAGAGCCTGG - Intergenic
1151285961 17:73111369-73111391 ACTTGAGCCTCAGGAGAAGGAGG + Intergenic
1157855139 18:51098529-51098551 GTCTTGGCCTCAAGAGAGGCTGG + Intergenic
1159868287 18:73731355-73731377 ACTTGGGGCTCACCAGATGCAGG + Intergenic
1160668875 19:346733-346755 ACTTCGGCCTCCAGAGTAGCTGG - Intergenic
1161406472 19:4094130-4094152 TCTTTGCCCTCATGAGAGGCTGG - Intronic
1162518110 19:11162092-11162114 ACTTCAGCCTCCAGAGTGGCTGG - Intergenic
1162532875 19:11245936-11245958 CCTTGGGCCTCAAGAGGGAGTGG - Intronic
1163843075 19:19623377-19623399 TCTTGTGCCTCAGGAGAAGCTGG - Intergenic
1163889308 19:19996870-19996892 ACTGAGGCCCCAAAAGAGGCTGG + Intergenic
1164818066 19:31221933-31221955 TCCTGGGGCTGAAGAGAGGCTGG - Intergenic
1164874561 19:31674530-31674552 ACTGGGGCCTCAGAAGAGGCAGG + Intergenic
1165293291 19:34906062-34906084 AACTGGACCTCCAGAGAGGCAGG - Intergenic
1165341065 19:35212522-35212544 ACTTGAGAATCAACAGAGGCTGG + Intergenic
1166624401 19:44336990-44337012 ACCTGGGCCTCCAGAGTAGCCGG + Intronic
1167165246 19:47794856-47794878 GCTTGGGCTTTAGGAGAGGCAGG + Intergenic
1167240607 19:48340982-48341004 ACTTGGGCCAACAGAGGGGCTGG - Intronic
1168234459 19:55053357-55053379 ACTTAATCCTCTAGAGAGGCTGG + Intronic
1168469420 19:56628642-56628664 ACCTTGGCCTCCAGAGTGGCTGG - Intergenic
925728169 2:6894694-6894716 ACTTGGGCCTCCCCAGATGCTGG + Intronic
931717142 2:65038090-65038112 ACCTCGGCCTCCAGAGTGGCTGG - Intergenic
931995327 2:67834170-67834192 ACTTGGGCTTGACAAGAGGCAGG - Intergenic
933743294 2:85551875-85551897 ACTTGGCCCTCCAGGGAGACAGG + Exonic
933792092 2:85890918-85890940 ACTTGGGCAGCAAGACAAGCAGG + Intergenic
934851564 2:97705228-97705250 AGCTGGGCCTCAGGAAAGGCAGG + Intergenic
937385609 2:121429247-121429269 CCTTGGGCCACAAAGGAGGCAGG + Intronic
938094028 2:128450117-128450139 ACTAAGGCCTCTACAGAGGCAGG + Intergenic
938732335 2:134156431-134156453 ACCTGGGCAACAAAAGAGGCAGG - Intronic
939224755 2:139350848-139350870 ACTTGGGCCTCACAAAATGCTGG + Intergenic
941997955 2:171619267-171619289 ACTTGAGCCTCCAAAGAAGCTGG + Intergenic
943688988 2:190849789-190849811 CCTTGGTCATCAAGACAGGCAGG - Intergenic
948591655 2:239054336-239054358 CCTTGGCCCTGCAGAGAGGCAGG - Intronic
948653050 2:239460853-239460875 ACATGGCACACAAGAGAGGCTGG - Intergenic
948817662 2:240521067-240521089 ACTTGGGCCTCAAGAGAGGCTGG + Intronic
1168881772 20:1212313-1212335 AACTGGGCCTCAAGATATGCTGG - Intergenic
1168980882 20:2002770-2002792 ACTTTAGCCGCAAGGGAGGCTGG + Intergenic
1172754349 20:37272882-37272904 ACTAGGGCCTCAAGTGATTCTGG + Intergenic
1173141971 20:40492424-40492446 AGTTGACCCTCCAGAGAGGCTGG - Intergenic
1173982676 20:47236927-47236949 AGTTGGGCCTCAGTAGAGTCAGG - Intronic
1175061061 20:56243805-56243827 ACCTGGTCTTCAAGGGAGGCTGG + Intergenic
1175699225 20:61125126-61125148 ACCTGGGCCTCATGAGATGCGGG - Intergenic
1178387867 21:32169436-32169458 AGTTGGGCCAAATGAGAGGCTGG + Intergenic
1178540101 21:33442250-33442272 CCTTGAGTCTCAAGGGAGGCTGG - Intronic
1179543256 21:42098059-42098081 CCCAGGGCCTCAGGAGAGGCTGG + Intronic
1181719921 22:24766098-24766120 ACTTCGGCCTCCAGAGTAGCTGG + Intronic
1183232265 22:36590397-36590419 ACTGGGGCCTCCAGAGTGCCAGG - Intronic
1183695568 22:39419995-39420017 ACTAGTGCCACAAGGGAGGCAGG + Intronic
1183814130 22:40284963-40284985 AGTTGGGCCTCCAGAAAGGAGGG + Intronic
1184884887 22:47337250-47337272 ACATGGGCATCAATAAAGGCTGG + Intergenic
950142335 3:10623941-10623963 ACTCGGGCCCCAAGAGCAGCTGG - Intronic
950158078 3:10738915-10738937 ACTTGGGCCTAAGGGGAGGCTGG + Intergenic
954509477 3:51109816-51109838 ACTTTGGCCTCACGAGTAGCTGG - Intronic
959520905 3:107322051-107322073 TCTTGTGCCTCAAGAGCTGCTGG + Intergenic
959658494 3:108838561-108838583 ACTGGAGCCACAAGGGAGGCAGG + Intronic
960871340 3:122252871-122252893 CCCTGAGCCTCAAGACAGGCTGG + Intronic
961057469 3:123801235-123801257 ACTTGGACCTCAAGGGACCCTGG + Intronic
961812420 3:129529540-129529562 GCTTGGGCCCCCAGAGAGGAGGG - Intronic
963093325 3:141507859-141507881 ACTGTAGCCACAAGAGAGGCTGG + Intronic
967330282 3:188283105-188283127 CCTTGTGCCTCTAGAGAGACAGG - Intronic
967922630 3:194624275-194624297 ACCTTGGCCTCATGAGTGGCTGG + Intronic
968391190 4:194229-194251 AGTTGGCCCTCAATAGAGTCAGG + Intergenic
972716069 4:41647417-41647439 ACTTGGTCCTCAAATGAGACAGG + Intronic
975920811 4:79384380-79384402 CATGGGGCCTGAAGAGAGGCAGG + Intergenic
977445242 4:97123698-97123720 ACTAGGGCCCCAGGAGAGGCTGG - Intergenic
978839185 4:113189613-113189635 ACTTGTGCCTCATTAGAAGCAGG + Intronic
979415453 4:120432661-120432683 ACTTAGGCCTCTAGTGTGGCTGG + Intergenic
983592067 4:169425083-169425105 ACTTTGGCCTCCTGAGGGGCTGG - Intronic
985222839 4:187726191-187726213 ACTTGTGCCTCCGCAGAGGCTGG - Intergenic
985965292 5:3335157-3335179 GGTGGGGCCTGAAGAGAGGCTGG + Intergenic
985967792 5:3350960-3350982 ACCTGGGCCTCCTGAGTGGCTGG + Intergenic
986340424 5:6784472-6784494 ACCTGGGCCTCAGGGGAGGAGGG + Intergenic
989427051 5:41307950-41307972 ACTTGGACCTCACAACAGGCTGG + Exonic
989719158 5:44504222-44504244 ACTTGGGCTTCAGGAGTCGCAGG + Intergenic
991981582 5:72237032-72237054 ACTTGAGCCTCTAGAGTAGCTGG + Intronic
995494445 5:112726135-112726157 ACTTGGGCTTCAGGAGCTGCAGG - Intronic
997183417 5:131857512-131857534 GCTGGGGCCCCAGGAGAGGCTGG - Intronic
997267624 5:132504822-132504844 ACTTTGGCCTCCAAAGATGCTGG + Intergenic
997434652 5:133865589-133865611 AATTTGCCCTCAAGACAGGCTGG + Intergenic
997515817 5:134489268-134489290 ACTTGGGCCTCAAAACAGTAGGG - Intergenic
998000348 5:138620270-138620292 CCCCAGGCCTCAAGAGAGGCAGG + Intronic
1002467550 5:179415188-179415210 ACTTGGGCCTCACAGGAAGCTGG + Intergenic
1004088501 6:12474969-12474991 ACTTGGCCAGCAAGAGAGGGTGG - Intergenic
1004462062 6:15846913-15846935 ACCTAGGCCTCCAGAGTGGCTGG + Intergenic
1008582382 6:52918664-52918686 AGTTGGCCTTCAAGAGAGTCAGG + Intergenic
1009425329 6:63507302-63507324 ACTTGGGCCTCATGAAGGGAGGG - Intergenic
1011268395 6:85550611-85550633 ACTTGAGCCTCCAGAGTAGCTGG + Intronic
1011384077 6:86775296-86775318 ACTTGCCCCTCAAGAGAAGCTGG - Intergenic
1014445234 6:121519149-121519171 ACTTCGGCCTCAAAAAATGCTGG + Intergenic
1015822900 6:137282036-137282058 GCATGGGCCTCTAGACAGGCAGG + Intergenic
1017290749 6:152733216-152733238 ACATCAGCCTCCAGAGAGGCTGG + Intergenic
1022522087 7:31015010-31015032 AATTGGGACCCCAGAGAGGCTGG + Intergenic
1023532740 7:41175407-41175429 AGTCTGGCCTCAAGAGAGGGAGG - Intergenic
1024480063 7:49853376-49853398 TCTTTGGCCTCAGGAGATGCTGG + Intronic
1024667751 7:51563440-51563462 AAGAGGGCCACAAGAGAGGCTGG - Intergenic
1025093935 7:56083570-56083592 ACTGGGGTCTCAGGGGAGGCAGG - Intronic
1025251873 7:57356867-57356889 ACTTCAGCCTCCAGAGAGGCTGG + Intergenic
1025607736 7:63051419-63051441 ACATGAGCCTCCAGAGTGGCTGG + Intergenic
1026016993 7:66679421-66679443 ACTTTGGCCTCCAGAGTAGCTGG + Intronic
1026823532 7:73566288-73566310 ACTGCAGCCTCCAGAGAGGCTGG + Intergenic
1028814939 7:95132860-95132882 ACTTGGGGCTCAACAGTTGCTGG - Intronic
1029279113 7:99425325-99425347 ACTTGGGCCTCCAGAGCCTCCGG - Exonic
1032602830 7:133317794-133317816 GCCTTGGCCTCAAGAGAAGCTGG + Intronic
1033477775 7:141707168-141707190 ACATGGGCCCAAAGAGAGACAGG - Intergenic
1034586172 7:152094397-152094419 ACTTGGGCCTCGAGTGAAACGGG - Exonic
1034592853 7:152158177-152158199 ACTGGGGCATCAACTGAGGCTGG + Intronic
1036189811 8:6660160-6660182 ATTTGGGCCTCCAGAAAGGAAGG - Intergenic
1036664773 8:10731044-10731066 ACTTGGGCCGCCACAGAGGCCGG + Intronic
1036760799 8:11507424-11507446 TCATGGCCCTCAAGAAAGGCAGG + Intronic
1037208830 8:16360309-16360331 ACTTGAGACTAAAGAGAGGGAGG + Intronic
1037579039 8:20233876-20233898 ACTAGGGCCCTAAAAGAGGCAGG + Intergenic
1037615336 8:20514149-20514171 ATTTGGGCTTCAAAAGATGCTGG + Intergenic
1039042391 8:33420011-33420033 ACCTCAGCCTCGAGAGAGGCTGG - Intronic
1039777079 8:40747335-40747357 ACTTGGACTTCCAGAAAGGCTGG - Intronic
1043594082 8:81863983-81864005 ACATGGGCCTTGGGAGAGGCTGG - Intergenic
1047268813 8:123334957-123334979 ATTTGGGCCTGAAGAAAGTCAGG + Intronic
1048180701 8:132191976-132191998 ACTTGGACCTCAAGTGCAGCAGG - Intronic
1049222570 8:141434690-141434712 GCTTGGGGCTGAAGAGGGGCAGG - Intergenic
1049464732 8:142745730-142745752 ACATGGGCTTCACGGGAGGCCGG - Intergenic
1058470198 9:105269847-105269869 ACTTGGGAGACAGGAGAGGCAGG + Intronic
1058937811 9:109785434-109785456 AATTGGGAGTCAGGAGAGGCTGG - Intronic
1059114071 9:111585109-111585131 ATTTGGGGCCCATGAGAGGCTGG + Intronic
1060343949 9:122800668-122800690 ACGAGAGCCTTAAGAGAGGCTGG - Exonic
1061046301 9:128166935-128166957 ACATGGGCCCCTAGAGAGGGAGG - Intronic
1062325837 9:136012121-136012143 ACATGGGCCCCAGGAGCGGCCGG - Intronic
1062395212 9:136350041-136350063 ACTGAGGCCCAAAGAGAGGCGGG - Intronic
1185738467 X:2511557-2511579 ACTTGGGCTTCAGGAGTTGCAGG - Intergenic
1186642382 X:11469834-11469856 ACTTGTGAGTCAAAAGAGGCAGG + Intronic
1187094765 X:16136096-16136118 ACTTGGGGATCAAGAGACCCAGG + Intronic
1189583446 X:42431853-42431875 ACTTGGGCCGCACCAGATGCTGG - Intergenic
1191720493 X:64224697-64224719 ACTGGGGCCCCAGGAGAGGGAGG + Intronic
1192333198 X:70196365-70196387 ACTTCAGCCTCCAGAGTGGCTGG - Intronic
1192690178 X:73354219-73354241 GCTGGGGTCCCAAGAGAGGCTGG + Intergenic
1195323024 X:103736312-103736334 ACTTCGGCTTCAAGAGTAGCTGG + Intergenic
1196464404 X:115958178-115958200 CCTTGGGCCTCCAGAGAGCCTGG + Intergenic
1197434025 X:126402551-126402573 ACTTTGTCCTCAAGAGGGGAAGG - Intergenic
1200235476 X:154465937-154465959 CCTTGGGCCCCACGAGAGGGTGG - Exonic
1201751460 Y:17436444-17436466 ACTGGGGCTTCAGGAGTGGCAGG - Intergenic
1201953968 Y:19600065-19600087 ACCTTGGCCTCCAGAGTGGCTGG - Intergenic