ID: 948818573

View in Genome Browser
Species Human (GRCh38)
Location 2:240526569-240526591
Sequence TCCTCAGGTACCCTGAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 841
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 805}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948818569_948818573 -9 Left 948818569 2:240526555-240526577 CCCCCACTGTTCACTCCTCAGGT 0: 1
1: 0
2: 0
3: 15
4: 205
Right 948818573 2:240526569-240526591 TCCTCAGGTACCCTGAGTGCTGG 0: 1
1: 0
2: 1
3: 34
4: 805
948818564_948818573 13 Left 948818564 2:240526533-240526555 CCTCTCCCTCTTGTGGCTCAGCC 0: 1
1: 0
2: 5
3: 47
4: 478
Right 948818573 2:240526569-240526591 TCCTCAGGTACCCTGAGTGCTGG 0: 1
1: 0
2: 1
3: 34
4: 805
948818559_948818573 26 Left 948818559 2:240526520-240526542 CCTCCCTCCAATGCCTCTCCCTC 0: 1
1: 0
2: 10
3: 73
4: 918
Right 948818573 2:240526569-240526591 TCCTCAGGTACCCTGAGTGCTGG 0: 1
1: 0
2: 1
3: 34
4: 805
948818567_948818573 -8 Left 948818567 2:240526554-240526576 CCCCCCACTGTTCACTCCTCAGG 0: 1
1: 0
2: 1
3: 34
4: 257
Right 948818573 2:240526569-240526591 TCCTCAGGTACCCTGAGTGCTGG 0: 1
1: 0
2: 1
3: 34
4: 805
948818560_948818573 23 Left 948818560 2:240526523-240526545 CCCTCCAATGCCTCTCCCTCTTG 0: 1
1: 0
2: 1
3: 28
4: 430
Right 948818573 2:240526569-240526591 TCCTCAGGTACCCTGAGTGCTGG 0: 1
1: 0
2: 1
3: 34
4: 805
948818558_948818573 29 Left 948818558 2:240526517-240526539 CCACCTCCCTCCAATGCCTCTCC 0: 1
1: 0
2: 12
3: 107
4: 1133
Right 948818573 2:240526569-240526591 TCCTCAGGTACCCTGAGTGCTGG 0: 1
1: 0
2: 1
3: 34
4: 805
948818563_948818573 19 Left 948818563 2:240526527-240526549 CCAATGCCTCTCCCTCTTGTGGC 0: 1
1: 0
2: 1
3: 26
4: 243
Right 948818573 2:240526569-240526591 TCCTCAGGTACCCTGAGTGCTGG 0: 1
1: 0
2: 1
3: 34
4: 805
948818561_948818573 22 Left 948818561 2:240526524-240526546 CCTCCAATGCCTCTCCCTCTTGT 0: 1
1: 0
2: 3
3: 32
4: 418
Right 948818573 2:240526569-240526591 TCCTCAGGTACCCTGAGTGCTGG 0: 1
1: 0
2: 1
3: 34
4: 805
948818566_948818573 7 Left 948818566 2:240526539-240526561 CCTCTTGTGGCTCAGCCCCCCAC 0: 1
1: 0
2: 2
3: 20
4: 236
Right 948818573 2:240526569-240526591 TCCTCAGGTACCCTGAGTGCTGG 0: 1
1: 0
2: 1
3: 34
4: 805
948818565_948818573 8 Left 948818565 2:240526538-240526560 CCCTCTTGTGGCTCAGCCCCCCA 0: 1
1: 0
2: 4
3: 31
4: 392
Right 948818573 2:240526569-240526591 TCCTCAGGTACCCTGAGTGCTGG 0: 1
1: 0
2: 1
3: 34
4: 805
948818570_948818573 -10 Left 948818570 2:240526556-240526578 CCCCACTGTTCACTCCTCAGGTA 0: 1
1: 0
2: 0
3: 9
4: 172
Right 948818573 2:240526569-240526591 TCCTCAGGTACCCTGAGTGCTGG 0: 1
1: 0
2: 1
3: 34
4: 805

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948818573 Original CRISPR TCCTCAGGTACCCTGAGTGC TGG Intronic
900335805 1:2162695-2162717 ACCTCAGCTTCCCAGAGTGCTGG + Intronic
901047747 1:6408270-6408292 TCCTCAGCCTCCCAGAGTGCTGG - Intergenic
901345474 1:8536951-8536973 TCCTCAGCTTCCCAAAGTGCTGG - Intronic
901392482 1:8955971-8955993 TCCTCAGCCTCCCAGAGTGCTGG - Intronic
901465315 1:9417480-9417502 ACCTCAGTTTCCCTGTGTGCAGG + Intergenic
901619617 1:10572783-10572805 TCCTCAGCCTCCCAGAGTGCTGG + Intronic
901694422 1:10996088-10996110 TCCTCAGCCTCCCAGAGTGCTGG + Intergenic
901812215 1:11774294-11774316 ACCTCGGCTTCCCTGAGTGCTGG + Intronic
901889304 1:12248592-12248614 GCCTCAGCTTCCCAGAGTGCTGG + Intronic
902263131 1:15241983-15242005 GCCTCAGCTTCCCAGAGTGCTGG - Intergenic
902340309 1:15778889-15778911 ACCTCAGCTTCCCAGAGTGCTGG + Intronic
902843029 1:19087387-19087409 TCCCCAGTTACCCTGAATGGAGG + Intronic
902898647 1:19497768-19497790 TCCTCAGCCTCCCAGAGTGCTGG + Intergenic
903460211 1:23515633-23515655 ACCTCAGCTTCCCAGAGTGCTGG + Intronic
903754802 1:25653326-25653348 GCCTCAGCCACCCAGAGTGCTGG + Intronic
903837629 1:26215835-26215857 GCCTCAGCTTCCCAGAGTGCTGG + Intergenic
903890902 1:26569839-26569861 CCCTCAGGTGCCCTGAGCTCAGG - Intronic
904185365 1:28699823-28699845 GCCTCAGCTTCCCAGAGTGCTGG - Intronic
904195761 1:28784375-28784397 ACCTCAGCTTCCCAGAGTGCTGG + Intergenic
904551351 1:31321714-31321736 TCCTCAGCCTCCCAGAGTGCTGG + Intronic
905570633 1:39001651-39001673 ACCTCAGCTTCCCAGAGTGCTGG + Intronic
906438195 1:45815417-45815439 TCCTCAGCCTCCCTAAGTGCTGG + Intronic
906477949 1:46182458-46182480 GCCTCAGCTTCCCAGAGTGCTGG - Intronic
906483045 1:46213013-46213035 TCCTCAGCTTCCCAAAGTGCTGG + Intronic
907129019 1:52078310-52078332 GCCTCAGTTTCCCTAAGTGCTGG + Intronic
907299718 1:53478998-53479020 TCCTCAGCTTCCCAAAGTGCTGG - Intergenic
907513063 1:54976813-54976835 TCCTCAGTCTCCCAGAGTGCTGG + Intergenic
907658712 1:56371683-56371705 ACCTCAGCTTCCCAGAGTGCTGG + Intergenic
908696226 1:66844942-66844964 TCCTCAGCCTCCCAGAGTGCTGG - Intronic
908869970 1:68598690-68598712 TCCTCAGGCTCCCAAAGTGCTGG + Intergenic
910580220 1:88816494-88816516 GCCTCAGCTTCCCAGAGTGCTGG + Intronic
910584328 1:88862596-88862618 GCCTCAGGCACCCAAAGTGCTGG - Intronic
911734290 1:101320519-101320541 TCCTCAGCTGCCCAAAGTGCTGG + Intergenic
912065847 1:105741694-105741716 GCCTCAGCCTCCCTGAGTGCTGG - Intergenic
913222581 1:116670867-116670889 ACCTCAGCTACCCAAAGTGCTGG - Intergenic
913224888 1:116690242-116690264 TACTCAGGTGCTCTGAGTGCTGG + Intergenic
913648569 1:120886948-120886970 ACCTCAGCTTCCCTAAGTGCTGG + Intergenic
914078127 1:144376412-144376434 ACCTCAGCTTCCCTAAGTGCTGG - Intergenic
914101052 1:144590089-144590111 ACCTCAGCTTCCCTAAGTGCTGG + Intergenic
914173035 1:145244946-145244968 ACCTCAGCTTCCCTAAGTGCTGG - Intergenic
914297921 1:146347565-146347587 ACCTCAGCTTCCCTAAGTGCTGG - Intergenic
914527686 1:148486086-148486108 ACCTCAGCTTCCCTAAGTGCTGG - Intergenic
914638705 1:149580979-149581001 ACCTCAGCTTCCCTAAGTGCTGG + Intergenic
915182624 1:154076036-154076058 ACCTCAGGCTCCCAGAGTGCTGG + Intronic
915240088 1:154515115-154515137 ACCTCAGCTTCCCAGAGTGCTGG + Intronic
915470855 1:156124989-156125011 TCCTCAGGTGACCTGGGGGCAGG + Intronic
915725914 1:158017440-158017462 TCCTCAGCTTCCCAAAGTGCTGG - Intronic
915918772 1:159958712-159958734 GCCTCAGCTACCCAAAGTGCTGG + Intergenic
916093170 1:161325256-161325278 GCCTCAGGTTCCCAAAGTGCTGG - Intronic
916138696 1:161675260-161675282 TCCCAGGATACCCTGAGTGCAGG + Exonic
916968216 1:169976972-169976994 ACCTCAGGTTCCCAAAGTGCTGG + Intronic
917818073 1:178730945-178730967 ACCTCAGGCTCCCAGAGTGCTGG + Intronic
917873806 1:179266817-179266839 GCCTCAGCCACCCTAAGTGCTGG + Intergenic
918004740 1:180531123-180531145 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
918318216 1:183340803-183340825 TCCCCAGGTGCCCTGATGGCAGG + Intronic
918642693 1:186862459-186862481 TCCTCAGTTTCCCAAAGTGCTGG + Intronic
919066431 1:192697303-192697325 GCCTCAGTTTCCCAGAGTGCCGG - Intergenic
919487321 1:198160187-198160209 TTCTCAGGTACCCTGAATGGTGG - Intronic
920277265 1:204815861-204815883 TCCTCAGCTTCCCAAAGTGCTGG - Intergenic
921009388 1:211126113-211126135 GCCTCAGCTACCCAAAGTGCTGG - Intronic
921026012 1:211282746-211282768 GCCTCAGCTTCCCAGAGTGCTGG + Intronic
921056481 1:211546418-211546440 TCCTCAGCCTCCCAGAGTGCTGG + Intergenic
921567022 1:216733739-216733761 CCCTCAGGCTCCCAGAGTGCTGG - Intronic
921637201 1:217510841-217510863 GCCTCAGCTTCCCAGAGTGCTGG - Intronic
922466732 1:225849601-225849623 TCCTAAGCTAGCCCGAGTGCAGG - Intronic
922528080 1:226321641-226321663 TCCTCAGCCTCCCAGAGTGCTGG - Intergenic
922947419 1:229529040-229529062 TCCTCAGTCCCCCAGAGTGCTGG - Intronic
923378006 1:233385771-233385793 ACCTCAGGTTCCCAAAGTGCTGG - Intergenic
923561797 1:235047357-235047379 TCCTCAGCTTCCCGAAGTGCTGG + Intergenic
924017847 1:239747003-239747025 GCCTCAGCTTCCCAGAGTGCTGG + Intronic
924103274 1:240625781-240625803 GCCTCAGGTTCCCAAAGTGCTGG - Intergenic
924869023 1:248020030-248020052 GCCTCAGGCTCCCAGAGTGCTGG + Intronic
1063085786 10:2816641-2816663 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1063476007 10:6329745-6329767 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1063918244 10:10905954-10905976 GCCTCAGGTGCCCTGATAGCTGG - Intergenic
1064410743 10:15101639-15101661 ACCTCAGCTTCCCAGAGTGCTGG - Intronic
1064464621 10:15566861-15566883 TCCTCAGCCTCCCAGAGTGCTGG - Intronic
1064588258 10:16861899-16861921 TCCTCAGGCTCCCAAAGTGCTGG - Intronic
1065353259 10:24814461-24814483 ACCTCAGCTTCCCAGAGTGCTGG + Intergenic
1065534590 10:26704885-26704907 CCCTCAGGTTCCCAAAGTGCTGG + Intronic
1065547773 10:26839245-26839267 TCCTCAGCTTCCCAAAGTGCTGG - Intronic
1065911320 10:30308646-30308668 ACCTCAGCTTCCCAGAGTGCTGG - Intergenic
1066183328 10:32984560-32984582 TCCTCAGCTTCCCAAAGTGCTGG + Intronic
1066402299 10:35088258-35088280 TCCTCAGCCTCCCAGAGTGCTGG - Intronic
1066602258 10:37122247-37122269 ACCTCAGCTTCCCGGAGTGCTGG + Intergenic
1067226860 10:44382346-44382368 TCCTCAGTTACCCAGGCTGCAGG - Intronic
1067302492 10:45024926-45024948 ACCTCAGCTTCCCAGAGTGCTGG - Intergenic
1067401306 10:45976359-45976381 ACCTCAGCTTCCCAGAGTGCTGG - Intronic
1067485266 10:46643075-46643097 GCCTCAGCCACCCAGAGTGCTGG + Intergenic
1067609491 10:47698588-47698610 GCCTCAGCCACCCAGAGTGCTGG - Intergenic
1067869655 10:49945938-49945960 ACCTCAGCTTCCCAGAGTGCTGG - Intronic
1068185172 10:53576102-53576124 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1068444739 10:57106811-57106833 TCCTCAGCTTCCCAAAGTGCTGG - Intergenic
1068512718 10:57986405-57986427 GCCTCAGCTTCCCAGAGTGCTGG - Intergenic
1068856171 10:61799417-61799439 TCCTCAGCTTCCCAAAGTGCTGG - Intergenic
1069010324 10:63364734-63364756 GCCTCAGCTTCCCTAAGTGCTGG + Intronic
1069043082 10:63714458-63714480 ACCTCAGCTTCCCAGAGTGCTGG + Intergenic
1069462349 10:68607671-68607693 TCCTCAGGCTCCCAAAGTGCAGG + Intronic
1069489087 10:68845986-68846008 ACCTCAGCCTCCCTGAGTGCTGG + Intronic
1069596793 10:69677177-69677199 GCATCATGTACCCTGAGGGCAGG - Intergenic
1069658525 10:70107967-70107989 GCCTCAGGCACCCAAAGTGCTGG - Intronic
1069675213 10:70241476-70241498 GCCTCAGCTTCCCAGAGTGCTGG - Intergenic
1069842369 10:71347826-71347848 TACTCAGGTACCCCCAGGGCAGG - Intronic
1070060707 10:72980776-72980798 TTCTCAGCTAGCCTGGGTGCAGG + Intergenic
1070069441 10:73072918-73072940 TCCTCAGCCTCCCAGAGTGCTGG - Intronic
1070269380 10:74938058-74938080 TCCTCAGCCTCCCAGAGTGCTGG + Intronic
1070361182 10:75690706-75690728 TCCTCAGTTTCCCAAAGTGCTGG - Intronic
1071583165 10:86792312-86792334 GCCTCAGCTTCCCAGAGTGCTGG + Intronic
1072671676 10:97434633-97434655 TCCTCAGCTTCCCAAAGTGCTGG - Intergenic
1072877916 10:99192677-99192699 TCCTCAGCTTCCCAAAGTGCTGG + Intronic
1072952849 10:99863057-99863079 GCCTCAGCTTCCCAGAGTGCTGG + Intergenic
1073174420 10:101544156-101544178 GCCTCAGGTTCCCAAAGTGCTGG + Intronic
1073199880 10:101726784-101726806 TCCTCAGCCTCCCAGAGTGCTGG + Intergenic
1073254715 10:102143349-102143371 GCCTCAGCTTCCCAGAGTGCTGG - Intronic
1073404348 10:103284244-103284266 GCCTCAGCTACCCAAAGTGCTGG + Intronic
1073429804 10:103478765-103478787 TCCTCCGGTGCCCTGCGGGCCGG + Exonic
1073463570 10:103680524-103680546 ACCTCAGGTTCCCAAAGTGCTGG + Intronic
1073657993 10:105438292-105438314 GCCTCAGGTTCCCAAAGTGCTGG - Intergenic
1074149276 10:110743863-110743885 ACCTCAGCTTCCCAGAGTGCTGG + Intronic
1074637021 10:115331307-115331329 GCCTCAGCTTCCCAGAGTGCTGG + Intronic
1075135027 10:119776998-119777020 ACCTCAGCTTCCCAGAGTGCTGG + Intronic
1075181910 10:120219034-120219056 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1075335642 10:121607172-121607194 TCCTCAGCCTCCCAGAGTGCTGG - Intergenic
1075382991 10:122033900-122033922 TCCTCAGCTTCCCAAAGTGCTGG - Intronic
1076356752 10:129858733-129858755 TCCTCAGATGCCTAGAGTGCGGG + Intronic
1076755053 10:132565222-132565244 GCCTCAGTCTCCCTGAGTGCTGG + Intronic
1077008637 11:370372-370394 GCCTCAGTTTCCCTGTGTGCTGG + Intronic
1077084080 11:739172-739194 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1077497437 11:2892922-2892944 TCCCCAGCTGCCCTGATTGCTGG - Intronic
1078052588 11:7979988-7980010 TCCTCAGCCTCCCAGAGTGCTGG + Intronic
1078265739 11:9755363-9755385 TCCTCAGCCTCCCTAAGTGCTGG + Intergenic
1078446856 11:11411061-11411083 TCCTCAGCTTCCCAAAGTGCTGG - Intronic
1078778564 11:14415659-14415681 GCCTCAGGTTCCCAAAGTGCTGG - Intergenic
1078893206 11:15576158-15576180 TCCTCAGCTTCCCAAAGTGCTGG - Intergenic
1079054339 11:17192694-17192716 TCCTCAGCCTCCCAGAGTGCTGG + Intronic
1080564762 11:33498037-33498059 TCCTCAGGCTCCCAAAGTGCTGG - Intergenic
1080590353 11:33718231-33718253 TCCTCGGCTTCCCTAAGTGCTGG - Intronic
1081893618 11:46566167-46566189 TCCTCAGCCTCCCAGAGTGCTGG - Intronic
1083185354 11:61014483-61014505 ACCTCAGGTTCCCAAAGTGCTGG - Intronic
1083874695 11:65515614-65515636 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1083923880 11:65794438-65794460 TCCTCAGGGACACTGGGGGCTGG + Intronic
1083946566 11:65926747-65926769 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1084126887 11:67105019-67105041 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1084353385 11:68620036-68620058 TCCTCAGCTTCCCAAAGTGCTGG - Intergenic
1084911063 11:72389674-72389696 TCCTCAGTCTCCCAGAGTGCTGG - Intronic
1085314099 11:75533262-75533284 GCCTCAGCTTCCCTAAGTGCTGG + Intergenic
1085484174 11:76848002-76848024 TCCTCAGCCTCCCAGAGTGCTGG + Intergenic
1086956135 11:92936191-92936213 TCCTCAGGCTCCCAAAGTGCTGG - Intergenic
1087563269 11:99818503-99818525 ACCTCGGCTTCCCTGAGTGCTGG + Intronic
1087635173 11:100694180-100694202 ACCTCAGCTTCCCAGAGTGCTGG + Intronic
1087872261 11:103310949-103310971 ACCTCAGCTTCCCTAAGTGCTGG + Intronic
1088227625 11:107638895-107638917 GCCTCAGCTTCCCAGAGTGCTGG - Intronic
1088244231 11:107801154-107801176 TCCTCAGCTTCCCAAAGTGCTGG + Intronic
1088245994 11:107818889-107818911 TCCTCAGCTTCCCAAAGTGCTGG - Intronic
1088575672 11:111268795-111268817 GCCTCAGGTTCCCAAAGTGCCGG + Intronic
1088876879 11:113943582-113943604 ACCTCAGCTTCCCAGAGTGCTGG + Intronic
1089216501 11:116837517-116837539 ACCTCAGGTACCCAGAGGCCCGG + Intronic
1089237931 11:117048851-117048873 GCCTCAGCTTCCCTAAGTGCTGG - Intronic
1089698021 11:120227683-120227705 CCCTCAGGTCCCCTGTGTGGAGG + Intronic
1089702174 11:120252041-120252063 TCCTCAGCCTCCCAGAGTGCTGG + Intronic
1090161196 11:124497611-124497633 TCCTCAGGCTCCCAAAGTGCTGG + Intergenic
1090341461 11:126024953-126024975 TCCTCAGCTTCCCAAAGTGCTGG - Intronic
1090459910 11:126881795-126881817 TCCTCAGCCTCCCTAAGTGCTGG + Intronic
1090815346 11:130289231-130289253 TCCTCAGCCTCCCAGAGTGCTGG - Intronic
1091491891 12:939825-939847 GCCTCAGCTTCCCAGAGTGCTGG - Intronic
1091510548 12:1119797-1119819 TCCTCAGCCACCCAAAGTGCTGG + Intronic
1091545506 12:1499037-1499059 TCCTCAGCCTCCCTAAGTGCTGG + Intergenic
1092271367 12:7025990-7026012 TCCTCAGCCTCCCAGAGTGCTGG + Intronic
1093727111 12:22526902-22526924 GCCTCAGCTTCCCAGAGTGCTGG - Intronic
1093866932 12:24238604-24238626 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1094066409 12:26365188-26365210 TCCTCAGGTCCTCTGTGTTCAGG - Intronic
1094198696 12:27776478-27776500 TCCTCAGCCTCCCAGAGTGCTGG - Intergenic
1094554939 12:31489774-31489796 ACCTAAGGTGACCTGAGTGCTGG + Intronic
1094653095 12:32396968-32396990 GCCTCAGCTACCCAAAGTGCTGG + Intergenic
1094791997 12:33926242-33926264 TCCTCAGCCTCCCTAAGTGCTGG + Intergenic
1095280938 12:40352277-40352299 TCCCCAGCTACCCTGAGTGTTGG - Intronic
1095396776 12:41770844-41770866 ACCTCAGCTTCCCAGAGTGCTGG - Intergenic
1095458823 12:42419481-42419503 GCCTCAGCTTCCCAGAGTGCTGG + Intronic
1095550461 12:43432100-43432122 ACCTCAGTTTCCCAGAGTGCTGG + Intronic
1096004475 12:48157764-48157786 AGCTCAGGAACCCTGAGTGTTGG + Intronic
1096087896 12:48878507-48878529 ACCTCAGCCACCCAGAGTGCTGG + Intergenic
1096224712 12:49859422-49859444 TCCTCAGCCTCCCAGAGTGCTGG - Intergenic
1096305316 12:50469659-50469681 TCCTCAGGCTCCCAAAGTGCGGG - Intronic
1097113807 12:56682307-56682329 TCCTCAGCCTCCCAGAGTGCTGG - Intronic
1097121890 12:56739887-56739909 TCCTCAGCCTCCCAGAGTGCTGG - Intronic
1097605164 12:61744805-61744827 ACCTCAGCTTCCCAGAGTGCTGG + Intronic
1097831836 12:64233147-64233169 TCCTCAGGCTCCCAAAGTGCTGG + Intergenic
1097846158 12:64369067-64369089 TCCTCAGCTTCCTAGAGTGCTGG - Intronic
1097868074 12:64576600-64576622 TCCTCAGCTGCCCAAAGTGCTGG - Intergenic
1099119299 12:78668075-78668097 ACCTCAGGTGCCCAAAGTGCTGG - Intergenic
1099416778 12:82398328-82398350 CCCTCAGCCTCCCTGAGTGCTGG + Intronic
1099725923 12:86427769-86427791 TCCTCAGCCTCCCAGAGTGCTGG - Intronic
1100976141 12:100124493-100124515 TCCTCAGCCTCCCAGAGTGCTGG - Intronic
1101448695 12:104756794-104756816 GCCTCAGCTTCCCAGAGTGCTGG + Intronic
1101979795 12:109396170-109396192 GCCTCAGCTTCCCAGAGTGCTGG + Intronic
1102092804 12:110207307-110207329 TCCTCAGCCTCCCAGAGTGCTGG + Intronic
1102109776 12:110356207-110356229 TCCTCAGCTTCCCAAAGTGCTGG - Intergenic
1102502993 12:113365560-113365582 TCCTCAGCTTCCCAAAGTGCTGG + Intronic
1103339608 12:120214566-120214588 TCCTCAGGGCTCCTGAGTCCTGG + Intronic
1103360252 12:120349346-120349368 GCCTCAGGTTCCCAAAGTGCTGG + Intronic
1103426878 12:120843701-120843723 ACCTCAGCCACCCAGAGTGCTGG - Intronic
1103525655 12:121566370-121566392 GCCTCAGCTTCCCAGAGTGCTGG - Intronic
1103536488 12:121637246-121637268 TCCTCAGCTTCCCAGTGTGCTGG + Intronic
1103796818 12:123508934-123508956 TCCTCAGCTTCCCAAAGTGCTGG - Intronic
1104037506 12:125107709-125107731 ACCTCAGGTTCCCAAAGTGCTGG - Intronic
1104547603 12:129726307-129726329 TCCTCAGGGACACTGTGTCCAGG - Intronic
1104658581 12:130592439-130592461 TCCTCAGCCTCCCAGAGTGCTGG - Intronic
1105302216 13:19145934-19145956 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1105378955 13:19868998-19869020 TCCTCAGCCTCCCTAAGTGCTGG + Intergenic
1105579314 13:21678665-21678687 TCCTCAGCTACTCCGTGTGCAGG + Intronic
1105952131 13:25238850-25238872 GCCTCAGCTACCCAAAGTGCTGG - Intergenic
1106525337 13:30535638-30535660 TCCTCAGCTTCCCAAAGTGCTGG - Intronic
1106839052 13:33666839-33666861 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1107139225 13:36979247-36979269 TCCTCAGGTTCCCAAAGTGCTGG + Intronic
1107361114 13:39618751-39618773 TCTCCAGGAAGCCTGAGTGCAGG - Intergenic
1107532818 13:41300657-41300679 GCCTCAGCTTCCCTGAGTGTTGG + Intergenic
1107534827 13:41318449-41318471 GCCTCAGCCTCCCTGAGTGCTGG + Intronic
1107560324 13:41552027-41552049 TCCTCAGTTACAAAGAGTGCTGG + Intergenic
1107744654 13:43491517-43491539 TCCTCAGCCTCCCAGAGTGCTGG - Intronic
1108338426 13:49471224-49471246 TCCTCAGCTTCCCAAAGTGCTGG + Intronic
1109167409 13:59053175-59053197 TCCTCAGCTTCCCAAAGTGCTGG - Intergenic
1111238481 13:85441588-85441610 TCCTCGGCTTCCCAGAGTGCTGG - Intergenic
1112174438 13:97007967-97007989 GCCTCAGCTTCCCAGAGTGCTGG + Intergenic
1112560120 13:100505613-100505635 GCCCCAGGTTCCCAGAGTGCTGG - Intronic
1112609749 13:100944956-100944978 TCAGGAGCTACCCTGAGTGCTGG - Intergenic
1113329541 13:109315039-109315061 TCCTCAGCCTCCCAGAGTGCTGG + Intergenic
1113387383 13:109861448-109861470 TCCTCAGCTTCCCAAAGTGCTGG - Intergenic
1113763723 13:112867765-112867787 CCCCCAAGTTCCCTGAGTGCTGG - Intronic
1113811503 13:113145273-113145295 TCCTCAGCCACCCAAAGTGCTGG + Intronic
1114164895 14:20211207-20211229 TCCTCAGCTTCCCAAAGTGCTGG - Intergenic
1114170157 14:20264533-20264555 TCCTCAGCTGCCCAAAGTGCTGG - Intronic
1114244685 14:20901594-20901616 GCCTCAGGTGCCCAAAGTGCTGG + Intergenic
1114247685 14:20929737-20929759 GCCTCAGGTGCCCAAAGTGCTGG + Intergenic
1114947762 14:27707470-27707492 GCCTCAGCTTCCCAGAGTGCTGG + Intergenic
1115256141 14:31404655-31404677 GCCTCAGCTACCCGAAGTGCTGG - Intronic
1116402368 14:44523811-44523833 GCCTCAGTTACCCAAAGTGCTGG - Intergenic
1116468639 14:45262030-45262052 TCCTCAGCCTCCCAGAGTGCTGG + Intergenic
1117847183 14:59923689-59923711 ACCTCAGCTTCCCAGAGTGCTGG - Intronic
1117857987 14:60055641-60055663 GCCTCAGCTTCCCAGAGTGCTGG - Intronic
1118555175 14:67010299-67010321 TCCTCAGCCTCCCAGAGTGCTGG - Intronic
1118781202 14:69009072-69009094 GCCTCAGCTACCCGAAGTGCTGG - Intergenic
1119399742 14:74354890-74354912 GCCTCAGGTTCCCAAAGTGCTGG - Intronic
1119835302 14:77744201-77744223 TCCTCAGCTTCCCAAAGTGCTGG - Intronic
1120830616 14:88994558-88994580 TCCTCAGCTTCCCAAAGTGCTGG - Intergenic
1120898989 14:89559426-89559448 TCCTCAGCTTCCCAAAGTGCTGG - Intronic
1121108808 14:91298183-91298205 TCCTCAGCCTCCCAGAGTGCTGG - Intronic
1121295385 14:92816807-92816829 TCCTCAGCCTCCCAGAGTGCTGG + Intronic
1121589253 14:95088723-95088745 TTCTAAGGAACCCTGAGTGAGGG - Exonic
1121696728 14:95919457-95919479 GCCTCAGCTTCCCTAAGTGCTGG - Intergenic
1122524864 14:102374510-102374532 TCCTCAGCTTCCCCAAGTGCTGG - Intronic
1122564186 14:102640092-102640114 GCCTCAGCTTCCCAGAGTGCTGG + Intronic
1122678800 14:103440032-103440054 ACCTCAGCTTCCCAGAGTGCTGG + Intronic
1122792788 14:104191399-104191421 TCCTCTGTTCCCCTGAATGCAGG - Intergenic
1122962168 14:105099658-105099680 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1124470895 15:29984798-29984820 TCCTCAGCTTCCCAAAGTGCTGG - Intergenic
1125617960 15:41032788-41032810 TCCTCAGCCGCCCAGAGTGCTGG - Intronic
1125618453 15:41037257-41037279 ACCTCAGCTTCCCAGAGTGCTGG - Intronic
1125639481 15:41218093-41218115 GCCTCAGCTTCCCAGAGTGCTGG - Intronic
1125987704 15:44071311-44071333 TCCTCAGCCTCCCTGAGTGCTGG - Intronic
1126148134 15:45496744-45496766 TCCTCAGCTTCCCAAAGTGCAGG - Intronic
1127232010 15:57006665-57006687 TCCTCAGCTTCCCAAAGTGCTGG - Intronic
1127262792 15:57338155-57338177 TCCTGAGGCACCCTGCCTGCAGG - Intergenic
1127668901 15:61175455-61175477 ACCTCAGCCACCCAGAGTGCTGG - Intronic
1128170113 15:65504111-65504133 ACCTCAGCCTCCCTGAGTGCTGG - Intronic
1128471717 15:67959436-67959458 GCCTCAGGTTCCCAAAGTGCTGG + Intergenic
1128472321 15:67965291-67965313 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1129422221 15:75437903-75437925 TCCTCAGTCACCCAGAGTGCTGG - Intronic
1130393715 15:83482739-83482761 ACCTCAGCTTCCCAGAGTGCTGG + Intronic
1130603308 15:85292962-85292984 TCCTCAGCCTCCCAGAGTGCTGG + Intergenic
1131820572 15:96269315-96269337 TCTTCAGTGATCCTGAGTGCTGG - Intergenic
1131834431 15:96375838-96375860 TCCTCAGCCTCCCAGAGTGCTGG + Intergenic
1132052087 15:98615701-98615723 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1133243684 16:4432270-4432292 GCCTCAGGTTCCCAAAGTGCTGG + Intronic
1133358538 16:5155278-5155300 TCCTCAGCTTCCCAAAGTGCTGG - Intergenic
1133558977 16:6932354-6932376 GCCTCAGGCTCCCTAAGTGCTGG + Intronic
1133935691 16:10267481-10267503 TCCTCAGCTTCCCAAAGTGCTGG - Intergenic
1134026709 16:10959639-10959661 GCCTCAGGTTCCCTAAGTGCTGG + Intronic
1134414223 16:14029959-14029981 TCCTCAGATACCCTGAGAGTTGG + Intergenic
1134437858 16:14278255-14278277 ACCTCAGCTTCCCAGAGTGCTGG - Intergenic
1134611807 16:15615028-15615050 ACCTCAGCTTCCCAGAGTGCTGG + Intronic
1134788423 16:16965646-16965668 TCCACACGTACCCTTAGAGCAGG - Intergenic
1135065974 16:19310217-19310239 TCCTCAGCTTCCCAAAGTGCTGG - Intronic
1135410123 16:22227470-22227492 GCCTCAGGTTCCCAAAGTGCTGG + Intronic
1135422746 16:22315915-22315937 ACCTCAGGCTCCCTAAGTGCTGG + Intronic
1135914440 16:26592605-26592627 TCCTCAGCCTCCCAGAGTGCTGG + Intergenic
1136253025 16:29019112-29019134 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1136473417 16:30496892-30496914 TCCTCAGCCTCCCAGAGTGCTGG + Intronic
1136475397 16:30510127-30510149 ACCTCAGCCTCCCTGAGTGCTGG + Intronic
1136502707 16:30680901-30680923 ACCTCAGCCACCCTAAGTGCTGG - Intergenic
1136527681 16:30842893-30842915 TCCTCAGCTTCCCAAAGTGCTGG + Intronic
1137673623 16:50293121-50293143 TTCTCAGTCACCCTGAGTCCCGG + Intronic
1138033713 16:53581236-53581258 TCCTCAGCCTCCCAGAGTGCTGG - Intergenic
1138199051 16:55075448-55075470 TCCTCAGCTTCCCAAAGTGCCGG - Intergenic
1139649276 16:68354126-68354148 GCCTCAGGTTCCCAGAGTGCTGG - Intronic
1139668030 16:68471912-68471934 ACCTCAGCTTCCCTAAGTGCTGG - Intergenic
1139772978 16:69294264-69294286 ACCTCAGCTTCCCAGAGTGCTGG + Intronic
1140414409 16:74763505-74763527 TCCTCAGCTTCCCAAAGTGCCGG + Intronic
1141648857 16:85381935-85381957 TCCTCAGGCACTCTGTGAGCAGG - Intergenic
1141945841 16:87309631-87309653 TCTTCAGCTACCCAAAGTGCTGG + Intronic
1142336413 16:89491996-89492018 TCCTCAGCTTCCCAAAGTGCTGG + Intronic
1142662311 17:1439597-1439619 GCCTCAGCTTCCCTAAGTGCTGG - Intronic
1143190243 17:5035056-5035078 TCCTCAGCTTCCCAAAGTGCTGG - Exonic
1143225312 17:5296985-5297007 GCCTCAGCTTCCATGAGTGCTGG + Intronic
1143312875 17:6007741-6007763 TCCTCAGCCTCCCAGAGTGCTGG + Intronic
1143375975 17:6467999-6468021 TCCACAGGAGCCCTGAGGGCAGG - Intronic
1143676028 17:8433763-8433785 ACCTCAGCTTCCCAGAGTGCTGG + Intronic
1144186076 17:12796510-12796532 TCCTCAGTCTCCCTAAGTGCTGG + Intronic
1144336953 17:14280119-14280141 GCCTCAGCTTCCCTAAGTGCTGG - Intergenic
1144394508 17:14831100-14831122 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1144814043 17:18020908-18020930 TCCTCAGCCACCCAAAGTGCTGG + Intronic
1145744300 17:27302672-27302694 TCCTCAGCCTCCCTAAGTGCTGG + Intronic
1145847202 17:28050853-28050875 ACCTCAGCTACCCAAAGTGCTGG - Intronic
1147133736 17:38423620-38423642 TCCTCAGCCTCCCAGAGTGCTGG + Intergenic
1147728750 17:42583482-42583504 TCCTCAGGTATCTTGAGTGTGGG - Exonic
1147877365 17:43631292-43631314 TCCTCAGCCTCCCAGAGTGCTGG + Intergenic
1148087442 17:45002802-45002824 GCCTCAGCTTCCCTAAGTGCTGG - Intergenic
1148319465 17:46738181-46738203 ACCTCAGCTTCCCAGAGTGCTGG + Intronic
1148500354 17:48085814-48085836 TCCTCAGCCTCCCAGAGTGCTGG - Intronic
1148607741 17:48943113-48943135 TCCTCAGCTTCCCAAAGTGCTGG + Intronic
1148841061 17:50497537-50497559 TCCTCAGCTTCCCGAAGTGCTGG - Intergenic
1148962938 17:51408587-51408609 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1149475466 17:56957368-56957390 TCCTCAGCTTCCCAAAGTGCTGG - Intronic
1149807112 17:59628909-59628931 TCCTCAGCTTCCCAAAGTGCTGG + Intronic
1150414896 17:64979134-64979156 ACCTCAGCTTCCCAGAGTGCTGG - Intergenic
1150556539 17:66259809-66259831 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1151022468 17:70633238-70633260 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1151374610 17:73678183-73678205 GCCTCAGGTTCCCAAAGTGCTGG + Intergenic
1151461850 17:74259020-74259042 TCCCCAGGTAGCCTGTGTGCAGG + Intronic
1151574454 17:74945203-74945225 TCCTCAGCTTCCCAAAGTGCTGG + Intronic
1151592563 17:75055464-75055486 TCCTCAGCCTCCCAGAGTGCTGG - Intronic
1151958987 17:77395161-77395183 GCCTCAGGTTCCCAAAGTGCTGG + Intronic
1152688681 17:81707691-81707713 TCATCAGGTCCCCGGTGTGCAGG + Intergenic
1153736151 18:8069932-8069954 TCCTCATGAACCCAGAGGGCCGG + Exonic
1154331125 18:13429760-13429782 GCGTCAGGAACCCTGAGCGCTGG - Intronic
1155329114 18:24696779-24696801 TTCTCAGGATCCCTGAGTCCAGG + Intergenic
1155949060 18:31888282-31888304 TCCTCAGCCTCCCAGAGTGCTGG - Intronic
1156346047 18:36258087-36258109 TCCTCAGGCATCCAGAGTCCTGG + Intronic
1157811938 18:50703463-50703485 TCCTGAGAGCCCCTGAGTGCTGG - Intronic
1157970426 18:52261213-52261235 GCCTCAGCTACCCAAAGTGCTGG + Intergenic
1158551099 18:58437111-58437133 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1159051950 18:63428389-63428411 GCCTCAGCTTCCCAGAGTGCTGG + Intergenic
1159439395 18:68457878-68457900 ACCTCAGCTTCCCAGAGTGCTGG - Intergenic
1159573063 18:70142732-70142754 ACCTCAGCTTCCCAGAGTGCTGG - Intronic
1159589683 18:70320236-70320258 ACCTCAGCTTCCCAGAGTGCTGG + Intronic
1159951748 18:74489147-74489169 TCCTCAGGTGACGTGAGTTCTGG + Intergenic
1160119822 18:76120421-76120443 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1160443449 18:78910788-78910810 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1160707388 19:535957-535979 TCCTCCGGGACCCAGGGTGCTGG + Intronic
1160929806 19:1565141-1565163 TCCTCAGCCACCCAAAGTGCTGG - Intronic
1161050368 19:2160671-2160693 TCCTCAGGATCACTGAGTACAGG - Intronic
1161170793 19:2811647-2811669 TCCACAGGTACCCGTAGTACTGG - Exonic
1161203971 19:3030672-3030694 TCCTCAGCTTCCCAAAGTGCTGG - Intronic
1161843924 19:6699486-6699508 TCCTCAGCCTCCCAGAGTGCTGG - Intronic
1162001492 19:7747168-7747190 TCCTCAGGTCCCAGGAGTCCAGG + Intronic
1162049582 19:8024798-8024820 GCCTCAGCTTCCCAGAGTGCTGG + Intronic
1162120318 19:8461980-8462002 AGCTCAGGGCCCCTGAGTGCGGG + Intronic
1162135645 19:8553621-8553643 TCCTCAGGCTCCCAAAGTGCTGG - Intronic
1162311020 19:9907204-9907226 GCCTCAGCTACCCAAAGTGCTGG - Intronic
1162375523 19:10303087-10303109 ACCTCAGCCTCCCTGAGTGCTGG + Intergenic
1162597565 19:11640858-11640880 TCCTCAGCCACCCAAAGTGCTGG + Intergenic
1162636602 19:11973462-11973484 ACCTCAGCTTCCCAGAGTGCTGG + Intronic
1162729343 19:12708615-12708637 GCCTCAGCTTCCCAGAGTGCTGG - Intronic
1162984863 19:14263216-14263238 GCCTCAGGCTCCCAGAGTGCTGG - Intergenic
1163016416 19:14458189-14458211 GCCTCTGGCACCCTGAGTGATGG + Intronic
1163139934 19:15340685-15340707 GCCTCAGGTTCCCAAAGTGCTGG + Intergenic
1163376774 19:16938034-16938056 TCCTCAGGATCCCAAAGTGCTGG + Intronic
1163430634 19:17265017-17265039 TCCTCAGCTTCCCAGAGTGCTGG - Intronic
1163508384 19:17721200-17721222 TCCTCAGCAACCCACAGTGCAGG + Intronic
1163524017 19:17809322-17809344 TCCTCAGCTTCCCAAAGTGCTGG - Intronic
1163651016 19:18517770-18517792 ACCTCAGCTGCCCAGAGTGCCGG - Intronic
1164118000 19:22240542-22240564 TCCTCAGCCTCCCAGAGTGCTGG - Intergenic
1164288152 19:23840706-23840728 ACCTCAGCTTCCCAGAGTGCTGG - Intergenic
1164855282 19:31516393-31516415 TCCACAGGGACCCTGACTGGGGG - Intergenic
1165788594 19:38477390-38477412 TCCTCAGCTTCCCAAAGTGCTGG + Intronic
1166035292 19:40163847-40163869 GCCTCAGCTACCCAAAGTGCTGG + Intergenic
1166070549 19:40384859-40384881 TCCTCAGCCTCCCTAAGTGCTGG + Intronic
1166141785 19:40809045-40809067 TCCTCAGCCTCCCAGAGTGCTGG - Intronic
1166432612 19:42740199-42740221 TCCTCAGCCTCCCTAAGTGCTGG + Intronic
1167067096 19:47194680-47194702 TCCACAGGTAACCTGCCTGCGGG - Intronic
1167207912 19:48114930-48114952 TCCTCAGCCCCCCTAAGTGCTGG - Intergenic
1167236655 19:48319776-48319798 TCCTCAGCTTCCCAAAGTGCTGG + Exonic
1167270522 19:48503295-48503317 TCCTCAGGCTCCCAAAGTGCTGG + Intronic
1167600194 19:50450516-50450538 TCCTCAGCTTCCCAAAGTGCTGG + Intronic
1167673230 19:50868173-50868195 TCCTCAGGTTCAGTGATTGCTGG + Intronic
1167962106 19:53114415-53114437 ACCTCAGCCACCCAGAGTGCTGG + Intronic
1168224766 19:54986795-54986817 TCCTCAGGCTCCCAAAGTGCTGG + Intronic
1168279650 19:55298062-55298084 GCCTCAGCTTCCCAGAGTGCTGG + Intronic
1168643254 19:58043914-58043936 TCCTCAGCCACCCAAAGTGCTGG + Intronic
925451826 2:3975705-3975727 TCCTCAGGCTCCCAAAGTGCTGG + Intergenic
925595854 2:5555105-5555127 TCCTCAGCTTCCCGAAGTGCTGG + Intergenic
925968113 2:9085005-9085027 TCCTCACGTGCCCTAACTGCAGG + Intergenic
926051532 2:9747996-9748018 GCCTCAGGTTCCCAAAGTGCTGG + Intergenic
926145542 2:10395044-10395066 GCCTCAGCTTCCCAGAGTGCTGG + Intronic
927051937 2:19338606-19338628 TCACCAGGTGCTCTGAGTGCTGG - Intergenic
927087509 2:19686545-19686567 TGTGCAGGTGCCCTGAGTGCTGG - Intergenic
927165519 2:20316780-20316802 GCCTCAGCCACCCAGAGTGCTGG - Intronic
927210057 2:20633770-20633792 ACCTCAGCTGCCCAGAGTGCTGG + Intronic
927347498 2:22062989-22063011 TCAACAGGAACCCTGATTGCTGG - Intergenic
927372948 2:22378766-22378788 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
927497943 2:23563294-23563316 CCCTCAGGCAGCCTGAGTCCTGG + Intronic
927802956 2:26118218-26118240 TCCTCAGCCACCCAAAGTGCTGG + Intronic
928529446 2:32176407-32176429 TCCTCAGCTTCCCAAAGTGCTGG - Intronic
928548377 2:32349045-32349067 ACCTCAGCTTCCCAGAGTGCTGG + Intergenic
928762666 2:34603139-34603161 TCCTCAGACTCCCTAAGTGCTGG - Intergenic
929459655 2:42093498-42093520 GCCTCAGGCTCCCAGAGTGCTGG - Intergenic
929667204 2:43842260-43842282 TCCTCAGCTTCCCAAAGTGCTGG + Intronic
930425509 2:51207554-51207576 TCCTCAGCCACCCAAAGTGCTGG + Intergenic
930663460 2:54078845-54078867 TCCTCAGCTTCCCAAAGTGCTGG + Intronic
930812729 2:55559870-55559892 TCCTCAGCCACCCAAAGTGCTGG - Intronic
930965084 2:57313324-57313346 TCCTTACCTACCCTGACTGCAGG + Intergenic
931033222 2:58207807-58207829 CCCTCAGCTTCCCAGAGTGCTGG - Intronic
931299147 2:60959636-60959658 GCCTCAGCCACCCAGAGTGCTGG + Intronic
931377440 2:61719843-61719865 TCCTCAGCCTCCCAGAGTGCTGG - Intergenic
931411057 2:62032284-62032306 GCCTCAGCTTCCCAGAGTGCTGG - Intronic
931852014 2:66261016-66261038 TCCTCAGCCTCCCAGAGTGCTGG + Intergenic
932196081 2:69785195-69785217 TCCTCAGGTACCCAGGGCACGGG - Intronic
932243137 2:70173528-70173550 GCCTCAGCTTCCCAGAGTGCTGG + Intronic
932503769 2:72208972-72208994 TCCTCAGCTTCCCAAAGTGCTGG - Intronic
932542561 2:72671443-72671465 GCCTCAGCTTCCCAGAGTGCTGG - Intronic
932556065 2:72825782-72825804 CGCTCAGGTACCCCGGGTGCCGG - Exonic
933011677 2:77072546-77072568 TCCTCAGTCTCCCTAAGTGCTGG - Intronic
933232472 2:79824939-79824961 ACCTCAGCTTCCCTAAGTGCTGG - Intronic
933733026 2:85472118-85472140 TCCTCAGCCTCCCAGAGTGCTGG + Intergenic
933998598 2:87687993-87688015 TCCCCAGGTTCCCTGAGGGTAGG + Intergenic
934098736 2:88631045-88631067 TGCTCAGGTACCCTGAGCCAGGG + Intergenic
934536775 2:95140724-95140746 GCCTCAGCTTCCCAGAGTGCTGG - Intronic
934967393 2:98734365-98734387 TCCTCCACTACCCAGAGTGCAGG - Intergenic
934968434 2:98743349-98743371 GCCTCAGGTTCCCAAAGTGCTGG - Intergenic
935127883 2:100240009-100240031 TCCTCAGATAACCTGGGTGGAGG - Intergenic
935159736 2:100519528-100519550 TCCTCAGCTTCCCAAAGTGCAGG + Intergenic
935277329 2:101486208-101486230 TCTTCAGCCAGCCTGAGTGCAGG + Intergenic
935601072 2:104921746-104921768 GCCTCAGCTTCCCAGAGTGCTGG - Intergenic
935651687 2:105387475-105387497 TGCCCAGGTACCCTGAGAGCAGG + Intronic
936295250 2:111262877-111262899 TCCCCAGGTTCCCTGAGGGTAGG - Intergenic
937212884 2:120288432-120288454 TCCTCAGGCTCCCAGAGTGCTGG + Intronic
937292354 2:120789271-120789293 TCCTCAGCCTCCCAGAGTGCTGG + Intronic
937750864 2:125475212-125475234 TGCTCATGTACCTTGAGGGCAGG - Intergenic
938920593 2:135991013-135991035 GCCTCAGCTGCCCAGAGTGCTGG + Intergenic
938969417 2:136418544-136418566 TACAGAGGTACCCTGAGTTCAGG + Intergenic
939326321 2:140693955-140693977 ACCTCAGCTCCCCAGAGTGCCGG + Intronic
939639995 2:144628664-144628686 TCTTCAGGTCCCCTAAGTGCAGG - Intergenic
940631349 2:156243451-156243473 GCCTCAGCTTCCCAGAGTGCTGG - Intergenic
941826004 2:169897748-169897770 GCCTCAGCCACCCAGAGTGCTGG + Intronic
942092480 2:172507507-172507529 TCCTCAGCCTCCCAGAGTGCTGG - Intergenic
942644284 2:178094277-178094299 GCCTCAGGCTCCCTAAGTGCTGG - Intronic
943708387 2:191060666-191060688 TCCTCAGGCTCCCAAAGTGCTGG + Intronic
944078091 2:195754760-195754782 TCCTCAGCCTCCCAGAGTGCTGG + Intronic
944241002 2:197484939-197484961 TCCTCAGCCACCCAAAGTGCTGG - Intergenic
944388433 2:199190547-199190569 ACCTCAGCTTCCCAGAGTGCTGG + Intergenic
944694785 2:202191027-202191049 TCCTCAGCTTCCCAAAGTGCTGG - Intronic
944706530 2:202294713-202294735 TCCTCAGCTTCCCAAAGTGCTGG - Intronic
944737205 2:202577810-202577832 TACTCAGGTTCCCAAAGTGCTGG + Intergenic
945544076 2:211127146-211127168 TCCTCAGCCTCCCAGAGTGCTGG - Intergenic
946259645 2:218476322-218476344 ACCTCAGCTTCCCTAAGTGCTGG - Intronic
946367552 2:219258577-219258599 GCCTCAGCCTCCCTGAGTGCTGG + Intronic
946407817 2:219501469-219501491 TCCTCAGGTCCCTGGAATGCAGG + Exonic
946911590 2:224467042-224467064 GCCTCAGCTTCCCAGAGTGCTGG - Intergenic
947605369 2:231482604-231482626 TCCTCAGCCTCCCAGAGTGCTGG + Intronic
947639600 2:231699546-231699568 TCCTCAGGCTCCCAAAGTGCTGG + Intergenic
947680653 2:232029286-232029308 TTCTCAGGAACCCTGACTGCTGG + Intronic
947894256 2:233654840-233654862 ACCTCAGTTTCCCTAAGTGCAGG - Intronic
948818573 2:240526569-240526591 TCCTCAGGTACCCTGAGTGCTGG + Intronic
1169127872 20:3143349-3143371 GCCTCAGCTTCCCAGAGTGCTGG + Intronic
1169280395 20:4262311-4262333 GCCTCAGGCTCCCAGAGTGCTGG - Intergenic
1169436704 20:5599298-5599320 ACCTCAGCTTCCCAGAGTGCTGG - Intronic
1169588076 20:7109467-7109489 GCCTCAGCTTCCCAGAGTGCTGG - Intergenic
1169888479 20:10428587-10428609 TCCTCAGCCTCCCCGAGTGCTGG - Intronic
1170202977 20:13764971-13764993 GCCTCAGCTTCCCAGAGTGCTGG - Intronic
1170632048 20:18074220-18074242 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1170661218 20:18342423-18342445 GCCTCAGCTTCCCAGAGTGCTGG - Intergenic
1170874472 20:20237293-20237315 TCGTAAGGTACCCTGAGTCTGGG - Intronic
1171113259 20:22502985-22503007 TCCTCAAGGCCCCTCAGTGCCGG - Intergenic
1171462480 20:25306629-25306651 TCCTCAGCTTCCCAAAGTGCTGG + Intronic
1171498819 20:25577429-25577451 TCCTCAGGTCACTTGAGTACAGG + Intronic
1171525362 20:25805446-25805468 CCCTCAGGTTCCCATAGTGCTGG + Intronic
1171551465 20:26050438-26050460 CCCTCAGGTTCCCATAGTGCTGG - Intergenic
1171568957 20:26227388-26227410 TCCTCAGCAACCCGGAGTTCTGG - Intergenic
1171973708 20:31580480-31580502 TCCTCAGCCTCCCAGAGTGCTGG + Intergenic
1172089545 20:32419451-32419473 TCCTCAGCTTCCCAAAGTGCTGG + Intronic
1172394673 20:34593085-34593107 TCCTCTGGTTCCCAAAGTGCTGG - Intronic
1172551778 20:35806110-35806132 TCCTCAGCTTCCCAAAGTGCTGG + Intronic
1172888599 20:38247837-38247859 ACCTCAGCTTCCCAGAGTGCTGG - Intronic
1173374257 20:42469450-42469472 TCCTCAGCCTCCCAGAGTGCTGG + Intronic
1173484789 20:43433014-43433036 GCCTCAGCTTCCCAGAGTGCTGG - Intergenic
1173565854 20:44038144-44038166 TCCTCAGCTCCCCAGAGTGCTGG - Intronic
1174045642 20:47730695-47730717 TCCTCGGCTTCCCAGAGTGCTGG + Intronic
1174060247 20:47827288-47827310 TCCTCACGGAGCCTAAGTGCTGG - Intergenic
1174071650 20:47904082-47904104 TCCTCACGGAGCCTAAGTGCTGG + Intergenic
1174096229 20:48091770-48091792 TCCTCAGGCTCCCAAAGTGCTGG - Intergenic
1174152399 20:48494553-48494575 TCCTCACGGAGCCTAAGTGCTGG - Intergenic
1174301688 20:49586823-49586845 TCCTCAGGCTCCCAAAGTGCTGG - Intergenic
1174350038 20:49960601-49960623 TCCTCAGGCTCCCAAAGTGCTGG + Intergenic
1174465971 20:50717695-50717717 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1174632428 20:51969483-51969505 TCCTCAGCCACCCAAAGTGCTGG - Intergenic
1174685176 20:52447745-52447767 TCCTCAGCTTCCCAAAGTGCTGG - Intergenic
1174958447 20:55127777-55127799 TCCTCAGCTTCCCAAAGTGCTGG - Intergenic
1175491438 20:59383409-59383431 AGCCCAGGCACCCTGAGTGCTGG - Intergenic
1175850063 20:62085499-62085521 TCCTCAGTCACCCTCAGTCCAGG - Intergenic
1176428171 21:6561316-6561338 TCCTCTGGTCTCCTGAGTCCCGG + Intergenic
1176870924 21:14082888-14082910 TCCTCAGGCTCCCGAAGTGCAGG - Intergenic
1177238280 21:18422233-18422255 TCCTCAGCTTCCCAAAGTGCTGG + Intronic
1178124868 21:29505467-29505489 TCCTCAGCTTCCCAAAGTGCTGG - Intronic
1178300262 21:31447137-31447159 TCCTCAGCCTCCCAGAGTGCTGG - Intronic
1178386709 21:32157316-32157338 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1178510988 21:33204876-33204898 ACCTCAGCCTCCCTGAGTGCTGG + Intergenic
1179385046 21:40933733-40933755 TCCTCAGCTTCCCTCTGTGCTGG - Intergenic
1179703662 21:43169633-43169655 TCCTCTGGTCTCCTGAGTCCCGG + Intronic
1179780984 21:43700842-43700864 TCCTCAGCCTCCCAGAGTGCTGG - Intergenic
1179949648 21:44702620-44702642 TCCTCTGCCACCCTGTGTGCAGG + Intronic
1179954874 21:44733034-44733056 CCCAGAGGGACCCTGAGTGCAGG + Intergenic
1180917936 22:19501964-19501986 TCCTCAGCTTCCCAAAGTGCTGG + Intronic
1181293255 22:21814581-21814603 ACCTCAGCTTCCCAGAGTGCTGG - Intronic
1181818097 22:25454780-25454802 ACCTCAGCTTCCCAGAGTGCTGG + Intergenic
1182529974 22:30947645-30947667 TCCTCCAGTACCCAAAGTGCTGG + Intronic
1182584967 22:31339722-31339744 GGCCCAGGCACCCTGAGTGCAGG + Intronic
1183082981 22:35468878-35468900 ACCTCAGTTTCCCAGAGTGCTGG + Intergenic
1183395782 22:37569974-37569996 ACCTCAGGATCCCTGAGAGCAGG + Intergenic
1183499743 22:38171567-38171589 TCCTCAGCCTCCCAGAGTGCTGG - Intronic
1183899161 22:40992059-40992081 GCCTCAGCTTCCCAGAGTGCTGG + Intergenic
1183906831 22:41047827-41047849 TCCTCAGCCACCCAAAGTGCTGG + Intergenic
1184448471 22:44568384-44568406 TCCTCAGGCTCCCAAAGTGCTGG - Intergenic
1184760917 22:46543726-46543748 TCCTCAGCCTCCCAGAGTGCTGG + Intergenic
1185024036 22:48397355-48397377 TCCTGAGGTCCCCTGCCTGCCGG + Intergenic
1185047698 22:48537254-48537276 TCCTCAGGTCCCCAGGGAGCCGG - Intronic
1185079661 22:48702651-48702673 TCCTGAGGTAGCGTGAGTGACGG - Intronic
1185257020 22:49839876-49839898 TCCTCAGCTTCCCAAAGTGCTGG - Intergenic
1185285059 22:49996422-49996444 TCCTGATGTACCCTGGGTCCTGG + Exonic
1203289053 22_KI270735v1_random:16910-16932 ACCTTAGGGACCCTGAGGGCTGG - Intergenic
949505646 3:4724931-4724953 TCCAAAGTAACCCTGAGTGCAGG + Intronic
949558709 3:5183147-5183169 ACCTCAGCTTCCCAGAGTGCTGG + Intergenic
950243943 3:11397831-11397853 ACCTCAGGCTCCCAGAGTGCCGG - Intronic
950516632 3:13470706-13470728 TCCTCAGGCTCCCAAAGTGCTGG + Intergenic
950598266 3:14005476-14005498 ACCTCAGGCACCCAAAGTGCTGG + Intronic
950782316 3:15402482-15402504 GCCTCAGCTTCCCAGAGTGCTGG - Intronic
950943145 3:16914979-16915001 ACCTCAGCTACCCAAAGTGCTGG + Intronic
951210964 3:19974400-19974422 TCCTCAGCCTCCCAGAGTGCTGG + Intronic
952444056 3:33363288-33363310 TCCTCAGCTTCCCAAAGTGCAGG + Intronic
952459271 3:33507184-33507206 GCCTCAGCTTCCCAGAGTGCTGG + Intronic
952556264 3:34534823-34534845 TCCCCAGCTTCCCTGAGTGTTGG + Intergenic
952571986 3:34728998-34729020 ACCTCAGCCTCCCTGAGTGCTGG - Intergenic
953517464 3:43608828-43608850 TCCTCAGCTTCCCAAAGTGCTGG + Intronic
953545875 3:43863322-43863344 TCCTCAGCCACCCAAAGTGCTGG - Intergenic
953601604 3:44371305-44371327 GCCTCAGCTTCCCAGAGTGCTGG + Intronic
953633449 3:44640625-44640647 TCCTCAGCCTCCCAGAGTGCTGG + Intronic
953676498 3:45006972-45006994 TCCTCAGCTTCCCAAAGTGCTGG + Intronic
954061726 3:48073359-48073381 GCCTCAGCTTCCCTAAGTGCTGG - Intronic
954584558 3:51722077-51722099 TCCTCAGATACCCTGATTGATGG - Intergenic
954890106 3:53919517-53919539 TACTCAGCTACCCAAAGTGCTGG - Intergenic
955288039 3:57663215-57663237 GCCTCAGCTTCCCAGAGTGCTGG - Intronic
955806829 3:62745320-62745342 TCCTCAGGCTCCCAAAGTGCTGG + Intronic
956697127 3:71928096-71928118 ACCTCAGCTCCCCAGAGTGCTGG - Intergenic
957376860 3:79370103-79370125 TCCTCAGCTTCCCAAAGTGCTGG - Intronic
957686331 3:83507056-83507078 TCCTCAGAAACCCAAAGTGCTGG - Intergenic
959364393 3:105438763-105438785 TCCTCAGCTTCCCAAAGTGCAGG - Intronic
959700892 3:109298330-109298352 ACCTCAGGCTCCCTGAGTTCAGG - Intronic
960979479 3:123209040-123209062 TCCTCAGCCACCCAAAGTGCTGG + Exonic
961379136 3:126486067-126486089 TCCTGAGGTTCCCTGGGTCCTGG - Intronic
961576331 3:127839774-127839796 GCCTCAGCTACCCAAAGTGCTGG - Intergenic
962668153 3:137677315-137677337 ACCTCAGGCTCCCAGAGTGCTGG - Intergenic
962735045 3:138318236-138318258 TCAGCAGGTACCCTGGATGCAGG + Intronic
962750366 3:138430637-138430659 TCCTCAGCCACCCAAAGTGCTGG - Intergenic
962805084 3:138921324-138921346 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
963223400 3:142835891-142835913 ACCTCAGGTTCTCAGAGTGCTGG + Intronic
963335518 3:143971011-143971033 TCCTCAGGGACCCTCAGGGGCGG + Intergenic
963815032 3:149820299-149820321 TCCTCAGCTTCCCAAAGTGCTGG + Intronic
965367555 3:167819261-167819283 GCCTCAGCTTCCCTGAGTGCTGG + Intronic
965438844 3:168687877-168687899 TCCTCAGCTTCCCAAAGTGCTGG - Intergenic
966171249 3:177083838-177083860 GCCTCAGCTTCCCAGAGTGCTGG - Intronic
966377436 3:179311044-179311066 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
966459014 3:180154172-180154194 TCCTCAGCTTCCCAAAGTGCTGG - Intergenic
966969465 3:185029811-185029833 ACCTCAGCTTCCCAGAGTGCTGG + Intronic
968388239 4:165547-165569 ACCTCAGCTTCCCAGAGTGCTGG - Intergenic
968763812 4:2457845-2457867 TCCTCAGGTGCACTGGGTGCAGG - Intronic
968853984 4:3104662-3104684 GCCTCAGGTTCCCAAAGTGCTGG - Intronic
969061395 4:4438100-4438122 GCCTCAGGAGCCCTGTGTGCCGG - Intronic
969174743 4:5389966-5389988 TGCCCAGGTTCCCTGACTGCTGG - Intronic
969347482 4:6578514-6578536 TCCTGAGGGACCCTGGGTGCAGG - Intronic
969374978 4:6757026-6757048 TCCTCAGTTTCCCAAAGTGCTGG + Intergenic
969635580 4:8367718-8367740 TCCTCAGCCTCCCAGAGTGCAGG - Intronic
969956776 4:10898591-10898613 GCCTCAGCCTCCCTGAGTGCTGG - Intergenic
970565676 4:17330347-17330369 TCCTCAGGCTCCCAAAGTGCTGG - Intergenic
971005495 4:22370122-22370144 AACTCAGGTACCCTGAGTGCAGG + Intronic
971407134 4:26332367-26332389 TTCTTAGGTACCCTAAGTCCTGG + Intronic
971754677 4:30692047-30692069 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
972510787 4:39766998-39767020 GCCTCAGCTTCCCAGAGTGCTGG + Intronic
972676641 4:41266169-41266191 GCCTCAGCTTCCCAGAGTGCTGG + Intronic
973937270 4:55859968-55859990 ACCTCAGCTTCCCTAAGTGCTGG - Intronic
974300423 4:60058999-60059021 GCCTCAGCTACCCAAAGTGCTGG + Intergenic
974871198 4:67645349-67645371 TCCTCAGCTTCCCAAAGTGCTGG - Intronic
974946978 4:68540572-68540594 TCCTCAGCCACCCAAAGTGCTGG + Intronic
975120838 4:70726619-70726641 GCCTCAGCTTCCCAGAGTGCTGG + Intronic
975141711 4:70925284-70925306 TCCTCAGGCTCCCACAGTGCTGG + Intronic
976966167 4:91043835-91043857 TCCTCAGCTTCCCAAAGTGCTGG + Intronic
978556585 4:109987511-109987533 TCCTCAGCTTCCCAAAGTGCTGG + Intronic
978581981 4:110241090-110241112 TCCTCAGTTTCCCAAAGTGCTGG - Intergenic
980069040 4:128223197-128223219 TCCTCAGCCTCCCAGAGTGCTGG + Intergenic
980267027 4:130530176-130530198 TCTTCTGGTACCATGAATGCTGG - Intergenic
980368918 4:131841718-131841740 TCCTCAGCCTCCCTAAGTGCTGG + Intergenic
980553501 4:134371467-134371489 TCCTCAGCCTCCCAGAGTGCTGG + Intergenic
980936247 4:139228407-139228429 ACCTCAGCTACCCAAAGTGCTGG + Intergenic
980960054 4:139466092-139466114 ACCTCAGGCTCCCTAAGTGCTGG + Intronic
981282674 4:142976884-142976906 ACCTCAGCTACCCAAAGTGCTGG - Intergenic
981584060 4:146281544-146281566 TCCTCAGATACACAGAGTGCAGG - Intronic
981953054 4:150434604-150434626 TCCTCAGCCACCCAAAGTGCTGG - Intronic
983289156 4:165779538-165779560 GCCTCAGCCACCCAGAGTGCTGG + Intergenic
983467681 4:168115130-168115152 GCCTCAGATTCCCAGAGTGCTGG + Intronic
983601326 4:169532688-169532710 TCCTCAGCCTCCCTAAGTGCTGG - Intronic
984322913 4:178215956-178215978 TCCTCAGCTTCCCAAAGTGCTGG - Intergenic
984613844 4:181873316-181873338 TCCTCAGCCTCCCAGAGTGCTGG + Intergenic
985258635 4:188093853-188093875 GCCTCAGGTTCCCAAAGTGCTGG - Intronic
985259795 4:188104610-188104632 TCCTCAGCTTCCCAAAGTGCTGG + Intronic
985563950 5:605968-605990 TCCTCAGTCACCCAAAGTGCTGG + Intergenic
985680061 5:1251336-1251358 GCCTCAGCTTCCCAGAGTGCTGG - Intergenic
986158995 5:5206729-5206751 TCCTCAGCCTCCCTAAGTGCTGG + Intronic
986354323 5:6908958-6908980 TCCTCAGCCTCCCAGAGTGCTGG - Intergenic
986669236 5:10128092-10128114 TCCTCACATATCCTGGGTGCAGG - Intergenic
987334471 5:16886680-16886702 TCCTCAGCCTCCCAGAGTGCTGG - Intronic
987339005 5:16922779-16922801 TCCTCAGCGTCCCAGAGTGCTGG - Intronic
987970151 5:24932233-24932255 TCCTCAGCTTCCCAAAGTGCTGG - Intergenic
988064966 5:26220794-26220816 TCCTCAGCTTCCCAAAGTGCTGG - Intergenic
988511115 5:31865559-31865581 GCCTCAGGTTCCCAAAGTGCTGG + Intronic
988513011 5:31881625-31881647 ACCTCAGCTTCCCAGAGTGCTGG + Intronic
988559037 5:32263685-32263707 GCCTCAGGTGCCCAAAGTGCTGG + Intronic
988733493 5:33996933-33996955 TCCTCAGGATCCCTCAGTCCTGG - Intronic
988787579 5:34578910-34578932 TCCTATGGTAGCCTGAGTGATGG - Intergenic
988950908 5:36259331-36259353 GCCTCAGGCTCCCTAAGTGCTGG - Intronic
989376422 5:40767118-40767140 TCCTCAGCTTCCCAAAGTGCTGG + Intronic
989973684 5:50555737-50555759 TCCTCAGCCACCCAAAGTGCTGG + Intergenic
990313624 5:54564029-54564051 GCCTCAGCTTCCCAGAGTGCTGG - Intergenic
990403698 5:55466451-55466473 GCCTCAGGTTCCCAGAGTGCTGG - Intronic
991380402 5:66016862-66016884 TCCTCGGCTTCCCAGAGTGCTGG + Intronic
991932682 5:71769399-71769421 TCCACAGGGGTCCTGAGTGCAGG - Intergenic
992228212 5:74639856-74639878 TGCACAGACACCCTGAGTGCGGG - Intronic
992235087 5:74700955-74700977 TCCTCAGCTTCCCGAAGTGCTGG + Intronic
992400535 5:76407214-76407236 TCCTCAGCTTCCCAAAGTGCTGG + Intronic
992629540 5:78667177-78667199 TCCTCAGGCTCCCAAAGTGCTGG + Intronic
994074577 5:95636260-95636282 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
994092286 5:95820100-95820122 ACCTCAGCTTCCCAGAGTGCTGG - Intronic
994384886 5:99119595-99119617 GCCTCAGGCTCCCTAAGTGCTGG + Intergenic
994410938 5:99406857-99406879 GCCTCAGCTTCCCAGAGTGCTGG - Intergenic
994482894 5:100358426-100358448 ACCTCAGCTTCCCAGAGTGCTGG + Intergenic
995689163 5:114804189-114804211 GCCTCAGGCTCCCTAAGTGCTGG + Intergenic
995715429 5:115077873-115077895 TCCTCAGCTTCCCAAAGTGCTGG - Intergenic
996092812 5:119367068-119367090 TCCCCAGCAACCCTGAGGGCTGG - Intronic
996440984 5:123490560-123490582 TCCTCAGCTTCCCAAAGTGCTGG - Intergenic
996650744 5:125873262-125873284 ACCTCAGGTGCCATGAGTGCGGG - Intergenic
996748427 5:126866131-126866153 TCCTCAGCTTCCCAAAGTGCTGG - Intergenic
996880278 5:128289038-128289060 CTCTCAGGTACCCTGGGTGATGG - Intronic
997171965 5:131731403-131731425 TCCTCAGCTTCCCAAAGTGCTGG - Intronic
997289575 5:132718557-132718579 GCCTCAGCCACCCAGAGTGCTGG + Intronic
998024450 5:138803050-138803072 GCCTCAGCTTCCCAGAGTGCTGG + Intronic
998144531 5:139719394-139719416 ACCTCAGCTTCCCAGAGTGCTGG + Intergenic
998997803 5:147884916-147884938 GCCTCAGCTTCCCAGAGTGCTGG + Intronic
999098048 5:148998813-148998835 TCCTCAAGTCCCCTGAGTTCTGG + Intronic
1000104618 5:158047428-158047450 GCCTCAGGCTCCCAGAGTGCTGG + Intergenic
1000555986 5:162726643-162726665 GCCTCAGCCACCCAGAGTGCTGG - Intergenic
1002910993 6:1490937-1490959 TCCTCAGGCACCCTCATTCCTGG + Intergenic
1003084085 6:3047545-3047567 TCCTCAGCCTCCCAGAGTGCTGG - Intergenic
1003646182 6:7914642-7914664 GCCTCAGGCTCCCAGAGTGCTGG + Intronic
1004119432 6:12805848-12805870 GCCTCAGGTTCCCAAAGTGCTGG + Intronic
1004675017 6:17833243-17833265 GCCTCAGCTTCCCAGAGTGCTGG - Intronic
1004803274 6:19174550-19174572 TCCTCAGCCTCCCAGAGTGCTGG - Intergenic
1005469834 6:26152077-26152099 CTCTAAGGTACCCTGAGTGGTGG - Intergenic
1005992183 6:30910240-30910262 TCCTCAGGGGCCATGAGTGGGGG - Intronic
1006490891 6:34386863-34386885 TCCTCAGCCTCCCTAAGTGCTGG - Intronic
1006526571 6:34610959-34610981 TCCTCAACCACCCAGAGTGCTGG - Intronic
1006531962 6:34663170-34663192 GCCTCAGCCACCCAGAGTGCTGG - Intronic
1006597544 6:35204310-35204332 GCCTCAGGCTCCCAGAGTGCTGG + Intergenic
1007638931 6:43320641-43320663 TCCTCAGCTTCCCAAAGTGCTGG - Intronic
1007672555 6:43568057-43568079 TCCTCAGCTTCCCAAAGTGCTGG - Intronic
1007887765 6:45251057-45251079 TCCTCAGCCTCCCAGAGTGCTGG + Intronic
1008171133 6:48207377-48207399 ACCTCAGCTTCCCTAAGTGCTGG + Intergenic
1008301514 6:49846504-49846526 CACTCAGGTAACCTGTGTGCTGG - Exonic
1009434417 6:63601509-63601531 TCCTCAGCCTCCCAGAGTGCTGG + Intergenic
1009631293 6:66203834-66203856 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1010225089 6:73481515-73481537 TCCTCAGCCTCCCAGAGTGCTGG - Intronic
1010690210 6:78902380-78902402 GCCTCAGCTTCCCAGAGTGCTGG + Exonic
1011891343 6:92164649-92164671 ACCTCAGCTTCCCAGAGTGCTGG + Intergenic
1012026778 6:94005084-94005106 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1013178190 6:107694927-107694949 TCCTCAGCTTCCCAGAGTGCTGG - Intergenic
1013325412 6:109041049-109041071 TCCTCAGCTTCCCAAAGTGCTGG - Intronic
1013415164 6:109918246-109918268 GCCTCAGCTTCCCAGAGTGCTGG + Intergenic
1013504759 6:110788405-110788427 GCCTCAGGTTCCCTAAGTGCTGG + Intronic
1013837378 6:114348563-114348585 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1014023852 6:116621106-116621128 ACCTCAGGCTCCCAGAGTGCCGG + Intronic
1014348535 6:120308727-120308749 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1014739510 6:125131663-125131685 TCCTCGGGTCCCCAAAGTGCTGG - Intronic
1014776944 6:125521888-125521910 TCCTCGGCTTCCCTAAGTGCTGG + Intergenic
1015255954 6:131179616-131179638 TCCTCAGGCCCCCAGAGTGCTGG - Intronic
1015415444 6:132942221-132942243 GCCTCAGCTTCCCTAAGTGCTGG - Intergenic
1015579634 6:134709754-134709776 TCCTCAGCTTCTCAGAGTGCTGG - Intergenic
1016027911 6:139307436-139307458 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1016861117 6:148719792-148719814 ACCTCAGCTTCCCAGAGTGCTGG + Intergenic
1016884107 6:148942311-148942333 TCCTCAGGCTCCCAAAGTGCTGG - Intronic
1016933098 6:149428398-149428420 TCCTCAGCCTCCCTAAGTGCTGG + Intergenic
1017789470 6:157783890-157783912 GCCTCAGCTTCCCAGAGTGCTGG + Intronic
1018269317 6:162058701-162058723 TCCTCAGCCACCCAAAGTGCTGG - Intronic
1018314155 6:162540556-162540578 GCCTCAGCCTCCCTGAGTGCTGG - Intronic
1018891970 6:167989181-167989203 TCCTGAGGGACCCTGAGCGGGGG - Intergenic
1019479293 7:1259177-1259199 TCCTCAGCTTCCCGAAGTGCTGG + Intergenic
1019503574 7:1378112-1378134 TCCTCAGCCACCCAAAGTGCTGG - Intergenic
1019512785 7:1426310-1426332 GCCTCAGCTTCCCTAAGTGCTGG - Intergenic
1019676035 7:2313274-2313296 ACCTCAGCTTCCCAGAGTGCTGG - Intronic
1019739618 7:2666142-2666164 CCCACAGGTGCCCTGAGAGCTGG - Intergenic
1019811143 7:3165876-3165898 TCCTCGGCTTCCCAGAGTGCTGG - Intronic
1019994341 7:4714073-4714095 ACCTCAGCTTCCCAGAGTGCTGG + Intronic
1020117725 7:5485562-5485584 ACCTCAGCTTCCCAGAGTGCTGG - Intronic
1020160145 7:5764396-5764418 TCCTCAGCCTCCCAGAGTGCTGG - Intronic
1020785183 7:12564890-12564912 TGCTCAGGTCCCCTGATTCCAGG + Intergenic
1021727735 7:23565745-23565767 GCCTCAGCTTCCCAGAGTGCAGG + Intergenic
1021908108 7:25355702-25355724 ACCTGAGCTTCCCTGAGTGCTGG + Intergenic
1022598347 7:31733743-31733765 TCCTCAGCCTCCCAGAGTGCTGG - Intergenic
1022862819 7:34385644-34385666 TCCTCAGGTTCCCTGACTCCAGG + Intergenic
1023408542 7:39863189-39863211 TCCTCAGCCTCCCAGAGTGCTGG + Intergenic
1023416819 7:39941103-39941125 TCCTCAGCTTCCCAAAGTGCTGG - Intergenic
1024340542 7:48253731-48253753 GCCTCAGCTTCCCAGAGTGCTGG + Intronic
1024584510 7:50830111-50830133 TCCTCGGCTTCCCTAAGTGCTGG + Intergenic
1024762311 7:52613223-52613245 ACCTCAGCTTCCCTAAGTGCTGG + Intergenic
1025062982 7:55827019-55827041 TCCTCAGGTACCCAGGGTTCAGG - Intronic
1025234693 7:57226741-57226763 TCCTCACGGACCCTAAGCGCTGG + Intergenic
1025741230 7:64198008-64198030 TCCTCAGCTTCCCATAGTGCTGG - Intronic
1025781325 7:64604384-64604406 TCATAATGTACCCTGAGTGAAGG - Intergenic
1025965940 7:66271424-66271446 GCCTCAGCTTCCCAGAGTGCTGG + Intronic
1026384687 7:69834420-69834442 TCCTGAGCCACCCTTAGTGCTGG + Intronic
1026483242 7:70796724-70796746 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1026761593 7:73130951-73130973 TCCTCAGCTTCCCAAAGTGCTGG - Intergenic
1026951543 7:74350613-74350635 TCCTCAGCCTCCCAGAGTGCTGG - Intronic
1027037933 7:74939767-74939789 TCCTCAGCTTCCCAAAGTGCTGG - Intergenic
1027085628 7:75261708-75261730 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1027225227 7:76239444-76239466 TCCTCAGCCTCCCAGAGTGCTGG - Intronic
1027398922 7:77787622-77787644 GCCTCAGCTTCCCAGAGTGCTGG + Intergenic
1028727989 7:94110923-94110945 TCCTCAGGCGCCCAAAGTGCTGG + Intergenic
1029140933 7:98409584-98409606 TCCTCAGCTTTCCAGAGTGCTGG - Intergenic
1029190727 7:98770204-98770226 GCCTCAGGTTCCCAAAGTGCTGG - Intergenic
1029833989 7:103290169-103290191 CCCTCAGGTTCCCAAAGTGCTGG + Intergenic
1030028960 7:105351406-105351428 TCCTCAGCCTCCCAGAGTGCTGG - Intronic
1030849469 7:114465212-114465234 TCCTCAGCCTCCCTAAGTGCTGG + Intronic
1030856284 7:114561902-114561924 ACCTCAGCTTCCCAGAGTGCTGG + Intronic
1031007911 7:116495656-116495678 TCCTCAGCCACCCAGAGAGCTGG + Intronic
1032232607 7:130088523-130088545 TCCTCAGCTTCCCAAAGTGCTGG + Intronic
1032336843 7:131033061-131033083 GCCTCAGCTTCCCAGAGTGCTGG - Intergenic
1032354333 7:131195701-131195723 ACCTCAGGCTCCCAGAGTGCTGG - Intronic
1033085218 7:138335170-138335192 TCCTCAGCTTCCCCAAGTGCTGG + Intergenic
1033213339 7:139476690-139476712 TCCTCAGGCTCCCAAAGTGCTGG + Intronic
1033241719 7:139685410-139685432 TCCTCAGCTTCCCAAAGTGCTGG + Intronic
1033303602 7:140208439-140208461 TCCTCAGCCTCCCAGAGTGCTGG + Intergenic
1033463481 7:141568823-141568845 TCCTCAGCCTCCCAGAGTGCTGG + Intronic
1033520045 7:142151236-142151258 TCATCAGGTCCCCTAGGTGCTGG - Intronic
1034033796 7:147798877-147798899 TCATCAGAGACCCTGTGTGCTGG - Intronic
1034473253 7:151267725-151267747 ACCTCAGCTTCCCAGAGTGCTGG - Intronic
1034501598 7:151454336-151454358 TCCTCAGGCTCCCAAAGTGCTGG + Intergenic
1036438402 8:8757664-8757686 TCCTCAGCCTCCCTAAGTGCTGG + Intergenic
1036521834 8:9499235-9499257 TCCTCAGGCTCCCAAAGTGCTGG - Intergenic
1036661415 8:10711344-10711366 GCCCCAGCTACCCCGAGTGCTGG - Intronic
1036934030 8:12983418-12983440 TCCTCAGCCACCCAAAGTGCTGG - Intronic
1036944179 8:13079191-13079213 GCCTCAGCTTCCCAGAGTGCTGG + Intergenic
1037873221 8:22519903-22519925 TCCTCAGCTTCCCAGAGTGCTGG + Intronic
1037986243 8:23292353-23292375 TCCTCAGCTTCCCAAAGTGCTGG - Intronic
1038448550 8:27622456-27622478 TCCTCAGGCTCCCAAAGTGCTGG + Intergenic
1039523282 8:38190691-38190713 GCCTCAGCTACCCAAAGTGCTGG + Intronic
1039696013 8:39912369-39912391 TCCTCAGCTTCCCAAAGTGCTGG + Intronic
1040497977 8:47983386-47983408 ACCTCAGCTTCCCAGAGTGCTGG + Intergenic
1041857984 8:62479759-62479781 TACTCTGGGACCCTGAGGGCTGG - Intronic
1042262870 8:66877613-66877635 TCCTCAGCTTCCCAAAGTGCAGG - Intronic
1042522738 8:69731247-69731269 GCCTCAGCTACCCAAAGTGCTGG + Intronic
1042930922 8:74013535-74013557 GCCTCAGCTTCCCAGAGTGCTGG + Intronic
1044391041 8:91651694-91651716 GCCTCAGGTTCCCAAAGTGCTGG - Intergenic
1046933745 8:119866990-119867012 TCCTCAGGCTCCCAAAGTGCTGG + Intergenic
1048279666 8:133095815-133095837 TTCTCAGCTCCCCTAAGTGCAGG + Intronic
1049333935 8:142071999-142072021 CCCTCAGGTTCCCAAAGTGCTGG - Intergenic
1049439700 8:142603696-142603718 ACCTCAGCTTCCCTAAGTGCTGG + Intergenic
1049863497 8:144917550-144917572 TCCTCAGCCTCCCAGAGTGCTGG - Intergenic
1051601854 9:18882742-18882764 TCCTCAGCTTCCCAAAGTGCTGG - Intronic
1052426807 9:28315153-28315175 GCCTCAGCTTCCCAGAGTGCTGG - Intronic
1052573871 9:30265556-30265578 TCCACATGTAGCCTGAGTACAGG + Intergenic
1052752589 9:32507758-32507780 ACCTCAGGTTCCCAAAGTGCTGG + Intronic
1052813765 9:33084042-33084064 GCCTCAGCCACCCTAAGTGCTGG - Intergenic
1052933264 9:34072994-34073016 TGCTCAGGTCCCCTGAGTCCCGG + Intergenic
1052948752 9:34190537-34190559 TCCTCAGCTTCCCAAAGTGCTGG + Intronic
1053137693 9:35661948-35661970 CCCTGAGGTATCCTGAGTTCTGG + Exonic
1053151257 9:35744691-35744713 TCCTCAGGTACCTGCAGTGGTGG - Exonic
1053247496 9:36546491-36546513 GCCTCAGGTTCCCAAAGTGCGGG - Intergenic
1053387448 9:37705544-37705566 GCCTCAGCTTCCCTAAGTGCTGG + Intronic
1053505302 9:38638023-38638045 TCCTCAGCTACCCAAAGTGCTGG + Intergenic
1053545340 9:39017679-39017701 AACTCAGGTGCCCTGAGTGTGGG - Intergenic
1053616757 9:39775286-39775308 TCCTCGGGCACCCAAAGTGCTGG - Intergenic
1053809659 9:41839360-41839382 AACTCAGGTGCCCTGAGTGTGGG - Intergenic
1054236760 9:62567097-62567119 TCCTCGGGCACCCAAAGTGCTGG + Intergenic
1054267411 9:62932152-62932174 TCCTCGGGCACCCAAAGTGCTGG + Intergenic
1054550897 9:66601605-66601627 TCCTCGGGCACCCAAAGTGCTGG + Intergenic
1054620934 9:67348068-67348090 AACTCAGGTGCCCTGAGTGTGGG + Intergenic
1054714501 9:68543534-68543556 TCCTCAAATACCCTGAGCCCAGG - Intergenic
1056570143 9:87807746-87807768 GCCTCAGCTTCCCTAAGTGCTGG - Intergenic
1056834497 9:89943558-89943580 TCCTCTGGAGCCCTGACTGCAGG - Intergenic
1057107905 9:92438055-92438077 ACCTCAGCTACCCATAGTGCTGG + Intronic
1057310085 9:93937299-93937321 TCTTCAGGCACCCTCAGTCCTGG - Intergenic
1057611385 9:96546811-96546833 GCCTCAGGTTCCCAAAGTGCTGG - Intronic
1057727654 9:97579533-97579555 GCCTCAGCTTCCCAGAGTGCTGG + Intronic
1058835136 9:108853893-108853915 GCCTCGGGTTCCCAGAGTGCTGG + Intergenic
1058890252 9:109355172-109355194 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1059141385 9:111856425-111856447 GCCTCAGGTTCCCAAAGTGCTGG + Intergenic
1059166092 9:112077750-112077772 TCCTCAGCTTCCCAAAGTGCTGG + Intronic
1060946555 9:127572793-127572815 GCCTCAGCTTCCCAGAGTGCTGG - Intronic
1061114338 9:128599382-128599404 ACCTCAGCTTCCCAGAGTGCTGG + Intronic
1061508686 9:131047414-131047436 TCCTCAGCCTCCCAGAGTGCTGG + Intronic
1061894098 9:133638016-133638038 CCATGAGGCACCCTGAGTGCAGG + Intronic
1062257773 9:135637099-135637121 TCCTCAGCTTCCCAAAGTGCTGG + Intronic
1185674954 X:1841686-1841708 ACCTCAGGTTCCCAAAGTGCTGG - Intergenic
1185767710 X:2739116-2739138 ACCTCAGCTTCCCAGAGTGCTGG + Intronic
1185808189 X:3079708-3079730 TCCTCAGCTTCCCAAAGTGCTGG - Intronic
1185924782 X:4133903-4133925 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1186370783 X:8944920-8944942 TCCTCAGTCTCCCTAAGTGCTGG + Intergenic
1187193623 X:17060049-17060071 GCCTCAGCTTCCCAGAGTGCTGG - Intronic
1187526759 X:20061407-20061429 TCCCCTGGGACCCTGAGGGCAGG + Intronic
1187652883 X:21429646-21429668 TCCTCAGGCTCCCAAAGTGCTGG - Intronic
1188074600 X:25759609-25759631 GCCTCAGGTTCCCAAAGTGCTGG - Intergenic
1188638416 X:32465831-32465853 GCCTCAGCTGCCCAGAGTGCTGG + Intronic
1188990252 X:36810036-36810058 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1189356623 X:40314508-40314530 TCCTCAGCTTCCCAAAGTGCTGG - Intergenic
1189455381 X:41183186-41183208 GCCTCAGCTTCCCAGAGTGCTGG + Intronic
1189498238 X:41529187-41529209 TCCTCTGCTCCCCTGAGTGCTGG - Intronic
1189975832 X:46460734-46460756 TTCTCAGCCACCCTTAGTGCTGG + Intronic
1189983235 X:46530966-46530988 TTCTCAGCCACCCTTAGTGCTGG - Intronic
1190679305 X:52811321-52811343 ACCTCAGGGACCCGAAGTGCAGG - Intergenic
1191697966 X:64008621-64008643 ACCTCAGCTTCCCAGAGTGCTGG + Intergenic
1191911176 X:66151785-66151807 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1192453955 X:71262191-71262213 GCCTCAGCTTCCCAGAGTGCTGG + Intergenic
1193995985 X:88366337-88366359 TCTGCAGGTACACAGAGTGCAGG - Intergenic
1195244092 X:102980360-102980382 ACCTCAGGCACCCAGAGTCCAGG + Intergenic
1195322007 X:103728117-103728139 TCCTCAGGTGAGCTGAGTGGGGG - Exonic
1195380744 X:104268634-104268656 GCCTCAGCTTCCCTAAGTGCTGG + Intergenic
1195691136 X:107626564-107626586 ACCTCGGCCACCCTGAGTGCTGG + Intergenic
1195771740 X:108358642-108358664 TCCTCAGCCTCCCAGAGTGCTGG + Intronic
1196767731 X:119263732-119263754 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1197188823 X:123621791-123621813 TCCTCAGCCTCCCAGAGTGCTGG - Intronic
1197217825 X:123883042-123883064 TCCTCAGCCTCCCAGAGTGCTGG + Intronic
1199723450 X:150559710-150559732 TCCTCAGCTTCCCAAAGTGCTGG + Intergenic
1200156395 X:153978515-153978537 ACCTCAGCCACCCAGAGTGCTGG + Intronic
1200781098 Y:7216463-7216485 ACCTCAGCTTCCCAGAGTGCTGG + Intergenic
1201477121 Y:14394636-14394658 ACCTCAGCTTCCCAGAGTGCTGG - Intergenic
1201887541 Y:18902077-18902099 TCCTCAGCTTCCCAAAGTGCTGG - Intergenic