ID: 948823998

View in Genome Browser
Species Human (GRCh38)
Location 2:240565692-240565714
Sequence TCCCCACGCCTTGTGTACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 67}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948823991_948823998 14 Left 948823991 2:240565655-240565677 CCAAGCGTGGGGGTGGTAGTGAG 0: 1
1: 0
2: 0
3: 12
4: 245
Right 948823998 2:240565692-240565714 TCCCCACGCCTTGTGTACCTGGG 0: 1
1: 0
2: 0
3: 7
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948823998 Original CRISPR TCCCCACGCCTTGTGTACCT GGG Intronic
901448423 1:9322007-9322029 TCCCCAGGTGATGTGTACCTGGG + Intronic
902619635 1:17643423-17643445 CCACCACGCCTTGTGGTCCTGGG + Intronic
904631077 1:31842727-31842749 TCCCCAGGCCTTGTGCAAATGGG + Intergenic
909258233 1:73451941-73451963 GCCCCATGCCTCCTGTACCTTGG + Intergenic
909340880 1:74529856-74529878 ACCCCACCCCTTGTGAACCAGGG + Intronic
909474091 1:76062691-76062713 CCACCACGCCTGGTGGACCTAGG + Intergenic
914802381 1:150971150-150971172 TCCCCACCCCTTGTTCTCCTGGG + Intronic
1067784739 10:49237203-49237225 TCCAGACGTTTTGTGTACCTTGG - Intergenic
1073455708 10:103635596-103635618 GCCACACACCGTGTGTACCTGGG - Intronic
1074720822 10:116263695-116263717 TTCCCAGGTCTTGTGCACCTTGG - Intronic
1083724997 11:64623308-64623330 TCCCCAGCCCATGTGTACCCTGG - Intronic
1083890644 11:65594098-65594120 TCCTCAGGCCTTTTGTAGCTGGG + Intronic
1084381371 11:68815193-68815215 TCCCCAAGCCTTAAGTACCATGG + Intronic
1087175334 11:95090330-95090352 TCCCTACGCCTTCGGTGCCTTGG + Intronic
1089873320 11:121696036-121696058 TCCCAATGCCTTGTTTCCCTGGG + Intergenic
1103560092 12:121789075-121789097 CCACCACGCCTGGTCTACCTGGG - Intronic
1106003546 13:25747628-25747650 TCCCCACGCATTGTATCCCCAGG - Intronic
1111423325 13:88046717-88046739 TCCCCATGCCTGTTGGACCTTGG - Intergenic
1114575738 14:23711326-23711348 TCCCTACTCCGTGTGCACCTGGG + Intergenic
1122460340 14:101889329-101889351 GCCCCAAGCCTCGTGCACCTGGG - Intronic
1125715332 15:41816796-41816818 TCCCCAAGCCATGTGAACCATGG - Intronic
1128308798 15:66617671-66617693 TCCCCACGCCTGGCCTAGCTGGG - Intronic
1129109739 15:73330388-73330410 TCCCCACGCCTTGTGTGTTCCGG - Intronic
1129324089 15:74790422-74790444 TCCCCACTCCTTGTCAGCCTGGG + Intronic
1131908630 15:97171761-97171783 TTTCCACGCCGTGTGTATCTGGG + Intergenic
1136653858 16:31697133-31697155 TTCCCTCGCCTTGTGTCCATTGG + Intergenic
1141925019 16:87162377-87162399 TTCCCACTCCTTGTGTTCCGAGG - Intronic
1142188709 16:88707067-88707089 TCCCCACGCCTAGTGGGCTTTGG - Intronic
1144100777 17:11940347-11940369 TCCCCACGTCCTGTGTATTTTGG + Intronic
1144558269 17:16300755-16300777 TCACCACCACTTGTTTACCTTGG - Intronic
1150168555 17:62966876-62966898 TCCCCACGCCTTGGACACCGAGG - Intergenic
1151808631 17:76422591-76422613 TCCCCAAGCCTGGCGTGCCTCGG - Intronic
1154040939 18:10855291-10855313 CCCCCACGCCTTTGGGACCTTGG - Intronic
1160811642 19:1015389-1015411 TCCCCAAGCCCTGTGGACGTCGG - Intronic
1160926905 19:1550794-1550816 TCCACACACCGTGTGTCCCTTGG - Intergenic
1161207923 19:3051455-3051477 TCCCCACGGCTGGTGCAGCTTGG + Intergenic
1168098655 19:54129216-54129238 TCCCCCCACCTTGTGTCCCTCGG - Intronic
925287458 2:2725131-2725153 TCAGCACTGCTTGTGTACCTTGG + Intergenic
928557394 2:32441735-32441757 CCCCCACGTCTTGAGTAGCTAGG - Intronic
938802858 2:134778626-134778648 TCCCCTCTCCTTGGGCACCTGGG - Intergenic
946232767 2:218302790-218302812 TCCCCCCGCCCTGACTACCTTGG - Intronic
948753468 2:240145310-240145332 TCCTTACTCCTTGGGTACCTGGG - Intergenic
948801176 2:240434352-240434374 TCCCTACCCCTTCTGTGCCTGGG - Intergenic
948823998 2:240565692-240565714 TCCCCACGCCTTGTGTACCTGGG + Intronic
1179172169 21:38981181-38981203 TCCCCCTGCCTTGTGTGCCTTGG - Intergenic
1179975060 21:44860614-44860636 TCCCCACACCTTCTGTAACGTGG + Intronic
1181990703 22:26834728-26834750 TCCCCACAGCTTGTTTCCCTTGG + Intergenic
1185421247 22:50735507-50735529 TCCCCATGCCTTATTTACCTGGG - Intergenic
951637143 3:24792229-24792251 TCCCAACCTCTTTTGTACCTAGG + Intergenic
952287404 3:31981653-31981675 TCCCCACCCCTTATCCACCTCGG + Intronic
961174359 3:124821582-124821604 TCCCCTTGCCATGTGTACCTGGG + Intronic
962322688 3:134404926-134404948 TCCCCTCGCCTTGTCTAGCAAGG - Intergenic
962768843 3:138593981-138594003 TCCCCAGGCTTTGTGTTCTTTGG - Intronic
963809441 3:149760487-149760509 TCCCCACACCCTGAGTAGCTGGG - Intergenic
969240692 4:5895062-5895084 TCCTCTCTCCTTGTGTCCCTGGG + Intergenic
970222487 4:13825238-13825260 TCCCCATGCTGTGTGCACCTAGG + Intergenic
971122336 4:23718570-23718592 TCCCCTCTTCATGTGTACCTGGG + Intergenic
972311472 4:37887685-37887707 TCCACACTCCTTGTGTTCCTGGG + Intergenic
973716834 4:53685190-53685212 TCCCCAGACCATGGGTACCTGGG - Intronic
995574379 5:113513957-113513979 GCCCCTCGCCTTGTGGCCCTGGG + Exonic
1001210544 5:169806774-169806796 TCCCCACACCTTGTGTGACTGGG - Intronic
1003889727 6:10553407-10553429 TCCCCAGGTCTTTCGTACCTTGG + Intronic
1010821863 6:80423507-80423529 TCCCCACCCATTGTGTAACTTGG + Intergenic
1023798591 7:43814012-43814034 CCCCCACGGCTTTTTTACCTTGG - Intergenic
1024584251 7:50827418-50827440 TCCCCATCCCTTGTGGTCCTAGG + Intergenic
1028740054 7:94263708-94263730 TCTCCCAGCCTTGTGTAGCTAGG + Intergenic
1029975178 7:104826839-104826861 ACCCCACTCCTTTTTTACCTTGG + Intronic
1031977156 7:128101384-128101406 TCCTCACACCCTGTGTAACTTGG - Intergenic
1036345837 8:7961900-7961922 TCCCCACCCCCTGTGTTTCTGGG + Intergenic
1039301459 8:36213989-36214011 TACCCAAGCCTTTTGAACCTAGG + Intergenic
1049167459 8:141135514-141135536 TCTCCATGCCTTGGGTACCCAGG + Intronic
1054762125 9:69013122-69013144 TCCCCAGGGCCTGTGTACTTCGG + Exonic
1057790256 9:98119688-98119710 TCCCCACCCCTTGGGTGCCATGG - Intergenic
1189500412 X:41551229-41551251 GCCCCAGGCTGTGTGTACCTGGG + Intronic
1194761789 X:97803844-97803866 CCCCCACCCCTTGTCTTCCTGGG + Intergenic