ID: 948824588

View in Genome Browser
Species Human (GRCh38)
Location 2:240568233-240568255
Sequence CGCCGCCCGGGGAGGAAGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 186}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948824581_948824588 -7 Left 948824581 2:240568217-240568239 CCTGGGATCTCCCGGGCGCCGCC 0: 1
1: 0
2: 0
3: 18
4: 151
Right 948824588 2:240568233-240568255 CGCCGCCCGGGGAGGAAGCGAGG 0: 1
1: 0
2: 2
3: 34
4: 186
948824573_948824588 28 Left 948824573 2:240568182-240568204 CCGGCAGTGTCTGGGAGGGAGCA 0: 1
1: 0
2: 2
3: 32
4: 272
Right 948824588 2:240568233-240568255 CGCCGCCCGGGGAGGAAGCGAGG 0: 1
1: 0
2: 2
3: 34
4: 186
948824577_948824588 0 Left 948824577 2:240568210-240568232 CCCGCCTCCTGGGATCTCCCGGG 0: 1
1: 0
2: 0
3: 37
4: 306
Right 948824588 2:240568233-240568255 CGCCGCCCGGGGAGGAAGCGAGG 0: 1
1: 0
2: 2
3: 34
4: 186
948824579_948824588 -1 Left 948824579 2:240568211-240568233 CCGCCTCCTGGGATCTCCCGGGC 0: 1
1: 0
2: 1
3: 30
4: 270
Right 948824588 2:240568233-240568255 CGCCGCCCGGGGAGGAAGCGAGG 0: 1
1: 0
2: 2
3: 34
4: 186
948824580_948824588 -4 Left 948824580 2:240568214-240568236 CCTCCTGGGATCTCCCGGGCGCC 0: 1
1: 0
2: 0
3: 17
4: 154
Right 948824588 2:240568233-240568255 CGCCGCCCGGGGAGGAAGCGAGG 0: 1
1: 0
2: 2
3: 34
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948824588 Original CRISPR CGCCGCCCGGGGAGGAAGCG AGG Intronic