ID: 948825233

View in Genome Browser
Species Human (GRCh38)
Location 2:240570759-240570781
Sequence GCCCATCAGCACCTGTGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 307}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948825223_948825233 25 Left 948825223 2:240570711-240570733 CCTGCCCTGCAGCGTCTGGAGCC 0: 1
1: 0
2: 2
3: 32
4: 300
Right 948825233 2:240570759-240570781 GCCCATCAGCACCTGTGCCCGGG 0: 1
1: 0
2: 4
3: 28
4: 307
948825225_948825233 20 Left 948825225 2:240570716-240570738 CCTGCAGCGTCTGGAGCCCTTCA 0: 1
1: 0
2: 2
3: 10
4: 145
Right 948825233 2:240570759-240570781 GCCCATCAGCACCTGTGCCCGGG 0: 1
1: 0
2: 4
3: 28
4: 307
948825228_948825233 -4 Left 948825228 2:240570740-240570762 CCTTGTTCCTTTTCCACCAGCCC 0: 1
1: 0
2: 1
3: 44
4: 512
Right 948825233 2:240570759-240570781 GCCCATCAGCACCTGTGCCCGGG 0: 1
1: 0
2: 4
3: 28
4: 307
948825227_948825233 3 Left 948825227 2:240570733-240570755 CCTTCAGCCTTGTTCCTTTTCCA 0: 1
1: 1
2: 6
3: 102
4: 1232
Right 948825233 2:240570759-240570781 GCCCATCAGCACCTGTGCCCGGG 0: 1
1: 0
2: 4
3: 28
4: 307
948825224_948825233 21 Left 948825224 2:240570715-240570737 CCCTGCAGCGTCTGGAGCCCTTC 0: 1
1: 0
2: 0
3: 18
4: 142
Right 948825233 2:240570759-240570781 GCCCATCAGCACCTGTGCCCGGG 0: 1
1: 0
2: 4
3: 28
4: 307
948825226_948825233 4 Left 948825226 2:240570732-240570754 CCCTTCAGCCTTGTTCCTTTTCC 0: 1
1: 0
2: 5
3: 67
4: 735
Right 948825233 2:240570759-240570781 GCCCATCAGCACCTGTGCCCGGG 0: 1
1: 0
2: 4
3: 28
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948825233 Original CRISPR GCCCATCAGCACCTGTGCCC GGG Intronic
900257506 1:1704713-1704735 GTCCCTCAGCATCTGCGCCCGGG - Intronic
900302364 1:1984393-1984415 GCTCAGCAGCACCTGCGCCAGGG - Intronic
900644109 1:3701230-3701252 CCCCATCCGTCCCTGTGCCCAGG + Intronic
900745888 1:4360571-4360593 GACCAGCAGCACCAGTACCCTGG + Intergenic
901457819 1:9373442-9373464 GCACATCAGGGCCTGAGCCCAGG + Intergenic
901474079 1:9477095-9477117 TCCCCTCAGAAACTGTGCCCTGG - Intergenic
901665847 1:10825779-10825801 TCCCATCAGGACCTGTGGCAGGG - Intergenic
902241815 1:15094804-15094826 GCTCAGCAGCACCTGCCCCCGGG - Exonic
902612049 1:17603179-17603201 GCAGTCCAGCACCTGTGCCCTGG - Intronic
903041661 1:20535251-20535273 GCCCACCTGCATCTGTGCTCAGG - Intergenic
903583108 1:24387187-24387209 GTGCATCAGGACCTGTGCCAAGG + Intronic
904331709 1:29762253-29762275 GCACAGCAACACCTGGGCCCAGG - Intergenic
905307288 1:37028462-37028484 GACCATCCACACCTGGGCCCTGG + Intronic
905455329 1:38084373-38084395 GCCCAGAAACAACTGTGCCCAGG + Intergenic
905537024 1:38730072-38730094 GTGCATCAGCACCTTTCCCCTGG - Intergenic
907301099 1:53486771-53486793 GCCCCTCTGTACCTGAGCCCTGG - Intergenic
907878700 1:58522290-58522312 GCACATCTGCACATGTACCCTGG + Intronic
911307654 1:96250591-96250613 GCCCAGCTGCATCTCTGCCCCGG + Intergenic
914361329 1:146938699-146938721 GCCCAGCTGCGCCTGTGCCTTGG + Intergenic
914491281 1:148152011-148152033 GCCCAGCTGCGCCTGTGCCTTGG - Exonic
914928615 1:151909777-151909799 GCCCCTCAGCCCCTCAGCCCCGG + Exonic
916166580 1:161971473-161971495 GCCCCTCAGCACCTGGGCTCAGG + Intergenic
916597295 1:166256925-166256947 ACCCATGAGCACCTGTGCCCTGG - Intergenic
916785670 1:168085455-168085477 TCCCATCACCGCCTGTGCCGCGG - Exonic
917976758 1:180244877-180244899 GCACAGCCGCACCTCTGCCCTGG - Intronic
921889086 1:220335773-220335795 GCCCAGCAACACCTGTGCCAAGG + Intergenic
923131068 1:231075146-231075168 GGCCATACTCACCTGTGCCCTGG + Intergenic
924795782 1:247291304-247291326 GCACAGCTGCACCTCTGCCCAGG + Intergenic
1062996197 10:1869529-1869551 GCCCATGAGATCCTGTGCCGAGG + Intergenic
1063957566 10:11280891-11280913 CCCCATTGACACCTGTGCCCAGG + Intronic
1063964637 10:11337607-11337629 GCTCTTCAGCGCCTGCGCCCAGG - Intergenic
1064057060 10:12106620-12106642 GCCACCCAGCACCTGTGCTCAGG + Intronic
1066317306 10:34260483-34260505 GCCCATCCACATCTGTGCCTGGG - Intronic
1066468104 10:35670853-35670875 GCCCCACAGCACCTGTGCCCAGG - Intergenic
1069001294 10:63269286-63269308 CTCCATCAGCACCTGTGACGGGG - Intronic
1069582170 10:69573506-69573528 GCCAATCAGCGCCGGGGCCCTGG + Intergenic
1071569187 10:86687192-86687214 GCCCATCAGCATGTATTCCCAGG + Exonic
1072323638 10:94274833-94274855 GCCCATCAGCATAGGTGCCATGG - Intronic
1073945685 10:108747311-108747333 GCCCATCAGAACCCCTGCCAGGG - Intergenic
1074538191 10:114343887-114343909 GCCCAGCAGCACCATTGCCTTGG - Intronic
1075071966 10:119325661-119325683 GCCCACCAGCATCTGGGCCTTGG - Intronic
1076462708 10:130657262-130657284 GTCCCTGAGCACCTGTGTCCCGG - Intergenic
1076681990 10:132177561-132177583 GCGCACCTGCTCCTGTGCCCTGG + Intronic
1076682021 10:132177825-132177847 GCGCACCTGCTCCTGTGCCCTGG + Intronic
1076790807 10:132775771-132775793 GCCCATCAGACCCTGTCCCATGG + Intronic
1076813233 10:132899788-132899810 GCCCACAAGCACATGTGCACAGG + Intronic
1076846305 10:133071140-133071162 TCCCAGCAGCACCTTTGCTCCGG - Intronic
1076854808 10:133110890-133110912 ATCCAGCAGCACCTGTGTCCAGG - Intronic
1077262917 11:1632595-1632617 GCGCAGCAGCACTTGAGCCCTGG + Intergenic
1077468367 11:2744718-2744740 GCCCAACAGCACATGTGACGAGG - Intronic
1077539548 11:3140082-3140104 GCCAAGCAGCACCTCTGCCAAGG + Intronic
1078225094 11:9384719-9384741 GCCCAGTAGCACCCGAGCCCCGG + Exonic
1078637338 11:13064301-13064323 GCTCAGCAGCCCCTGTCCCCAGG - Intergenic
1082299702 11:50491217-50491239 GCAAACCAGCACGTGTGCCCCGG - Intergenic
1083205417 11:61145868-61145890 GCCCCTCAGTACCAGAGCCCTGG + Intronic
1083272729 11:61580422-61580444 GCTCCCCAGCACCGGTGCCCCGG - Intronic
1083632035 11:64100784-64100806 GCTCCTCAGCGTCTGTGCCCTGG - Intronic
1084427759 11:69094854-69094876 CCCCAGCAGCACCTGTTGCCAGG + Intergenic
1084933804 11:72576374-72576396 GGCCATATCCACCTGTGCCCTGG - Exonic
1085204203 11:74720810-74720832 GCCCATGAGCTCCTGTTTCCTGG - Intronic
1085496757 11:76977766-76977788 GGGCATCTGCAGCTGTGCCCGGG - Intronic
1087355497 11:97088427-97088449 GCCTATCAGCTCCTGTCCTCTGG - Intergenic
1088756361 11:112888593-112888615 GACCATGAGCCCCTCTGCCCTGG - Intergenic
1089691657 11:120190642-120190664 GCCCTTCAGCCCCTGGGCCTAGG + Intergenic
1091286433 11:134411211-134411233 TCCCATCTGCACCTGGGCTCAGG - Intronic
1092238550 12:6824093-6824115 GCCCCTCACCACCTTTGCCGTGG + Exonic
1093281678 12:17203655-17203677 GGGCAGCAGCAACTGTGCCCGGG - Intergenic
1093734985 12:22610792-22610814 GCCAATCATCACCTAAGCCCTGG + Intergenic
1095349000 12:41188078-41188100 ACCCATCAGCAGCCCTGCCCAGG + Intergenic
1096150128 12:49304370-49304392 GCCAGTCAGCAGCTGTCCCCTGG - Intergenic
1096242128 12:49965198-49965220 GCCCCTCAGCCCCTGAGCCAAGG + Exonic
1096355648 12:50938478-50938500 GGCCAGCTGCAGCTGTGCCCAGG + Intergenic
1096651371 12:53063507-53063529 CCCCTTCAGCAGCTGTCCCCTGG + Intronic
1096660165 12:53119201-53119223 GCCCTTCAGCACCCGTGCCCTGG + Exonic
1097188322 12:57207686-57207708 GCCCATCATGCCCTGTGCCCTGG - Intronic
1097244693 12:57601009-57601031 TCCCATCGGCCCCTGGGCCCAGG + Exonic
1101970419 12:109309024-109309046 GCCCCGCAGCCCCTGCGCCCGGG + Intronic
1103922110 12:124404468-124404490 GCCCATCAGCCCCTGCACCTAGG + Intronic
1104043098 12:125143401-125143423 GCCCGCCAACAGCTGTGCCCTGG + Intergenic
1104110624 12:125700862-125700884 GCCCCTCAGCTTCTGAGCCCTGG + Intergenic
1104820038 12:131671900-131671922 CCCCATGACCACCTGAGCCCTGG + Intergenic
1104981139 12:132573597-132573619 GCCCAGAAGCAGCTGTGCTCGGG - Intronic
1105896846 13:24723831-24723853 GCCCACCAGCACCTGCCCCACGG - Intergenic
1108933307 13:55859244-55859266 GGCCAGCAGCACCTCTGCCCAGG + Intergenic
1111594753 13:90396947-90396969 GCCCTTGAGCCCCTGTGCTCAGG + Intergenic
1112342533 13:98564512-98564534 GCTCTTCAGCTCCTCTGCCCTGG - Intronic
1112365632 13:98752802-98752824 GCCCACCCGCACCTGGGCCGGGG - Intergenic
1113902889 13:113806371-113806393 GCCCAACAGCTGCTGTGTCCCGG - Intronic
1119086227 14:71741744-71741766 GCCCAACAGCACCTTCTCCCAGG - Intergenic
1119182392 14:72613853-72613875 GCCTCTCAGCAGCTGTCCCCGGG - Intergenic
1119407791 14:74409572-74409594 GCCCACCAGCTCCTGGACCCAGG - Exonic
1120528136 14:85601416-85601438 GCCCAACATCACCAGTTCCCTGG + Intronic
1121247608 14:92473623-92473645 ACTCATCCGCACCTCTGCCCTGG - Intronic
1121948263 14:98144485-98144507 ACCCATCAGCATCTCTGCCCTGG + Intergenic
1122691674 14:103534698-103534720 GGCCATCTGTGCCTGTGCCCAGG - Exonic
1123067670 14:105626687-105626709 GCCCTTCAGCCCCAGGGCCCCGG + Intergenic
1123071689 14:105645412-105645434 GCCCTTCAGCCCCAGGGCCCCGG + Intergenic
1123091353 14:105743688-105743710 GCCCTTCAGCCCCAGGGCCCCGG + Intergenic
1123097122 14:105772028-105772050 GCCCTTCAGCCCCAGGGCCCCGG + Intergenic
1123439871 15:20282486-20282508 GCCCATCAGCGCCTGAACCGTGG - Intergenic
1123716911 15:23040155-23040177 CCCCCTCAGCACCTCTGGCCAGG - Intergenic
1123716967 15:23040376-23040398 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123717058 15:23040671-23040693 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123717693 15:23042788-23042810 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123718086 15:23044127-23044149 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123718377 15:23045154-23045176 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123718477 15:23045488-23045510 GCCCCCCAGCACCTCTGGCCAGG - Intergenic
1123718746 15:23046449-23046471 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123718814 15:23046676-23046698 TCCCCTCAGCACCTCTGGCCAGG - Intergenic
1123718909 15:23047009-23047031 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123719124 15:23047752-23047774 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123719186 15:23047970-23047992 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123719413 15:23048759-23048781 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123719439 15:23048831-23048853 GCCCCCCAGCACCTCTGGCCAGG - Intergenic
1123719572 15:23049285-23049307 CCCCACCAGCACCTCTGGCCAGG - Intergenic
1125512214 15:40298193-40298215 GGCCACCAGCCTCTGTGCCCAGG + Intronic
1125722506 15:41852049-41852071 GACCTTCAGCTCCTGTGCCCGGG + Intronic
1127865866 15:63032131-63032153 AGCCATCAGCACATGTGCCTTGG + Intergenic
1129455761 15:75675520-75675542 CCCGATCAGCATCTGGGCCCAGG + Exonic
1129683312 15:77670763-77670785 GCCCAGCAGCAGCTGGCCCCTGG - Intronic
1130149254 15:81298850-81298872 CCCCATCAGAAGCTGTGCACAGG + Intronic
1130988582 15:88860970-88860992 ACCCAGCAGCACGTCTGCCCAGG + Intronic
1131222535 15:90597085-90597107 GCCCAGCTGCAGCTGTGCCTTGG - Intronic
1132465497 16:75614-75636 TCCCATAAGCACCTGGGCCCAGG + Intronic
1132569918 16:639831-639853 GCCCACCAAGAGCTGTGCCCAGG - Intronic
1132666494 16:1083425-1083447 CCCCATCAGCAGGGGTGCCCTGG + Intergenic
1132761664 16:1511425-1511447 GTCCCTCAGCAGCTGTGCACAGG + Intronic
1132809118 16:1789301-1789323 ACACATCAGCACCTGGGCCCAGG - Intronic
1132844417 16:1993256-1993278 GTCCCTCAGCACCTGGCCCCAGG + Exonic
1132850822 16:2024157-2024179 GCCCCTGAACACCTTTGCCCAGG + Intergenic
1132905494 16:2280596-2280618 GCCCTCCTGCACCTCTGCCCGGG - Intronic
1133757471 16:8772984-8773006 GGCCAGCAGCACCTCTGCCTTGG + Intronic
1136419656 16:30123542-30123564 GCCCACCAGAACCTGGGCCCGGG + Intergenic
1136567163 16:31077361-31077383 GCCATTCAGCATCTGTGCACTGG - Exonic
1137031968 16:35532345-35532367 GGCCATCCTCACCAGTGCCCTGG - Intergenic
1137601679 16:49760462-49760484 ACCCATCAGCACCTGAGTCAGGG + Intronic
1138000455 16:53273626-53273648 GCCTATCAGCTCCTGTACCCAGG + Exonic
1138205199 16:55119649-55119671 GCACATCAGCACATGGGCCCAGG + Intergenic
1141765557 16:86056655-86056677 GCCCATGAGCAACTGTGGTCTGG + Intergenic
1141946224 16:87311545-87311567 CACCATCTGCACCTGTGCCCTGG + Intronic
1142483045 17:230108-230130 GCCCATCAGCTCCCGTGCCTGGG - Intronic
1142649089 17:1335087-1335109 GCCTCTGAGCCCCTGTGCCCGGG + Intergenic
1142990858 17:3729908-3729930 GCACATCTGCACATGTACCCTGG - Intronic
1144631296 17:16873775-16873797 GCCCCTCAGCACCTGTGGGTGGG - Intergenic
1147217288 17:38908242-38908264 GCCCCTGAGAACCTGTGACCAGG - Intronic
1147948801 17:44095683-44095705 GCCAAACAGCAGCTGTGCCTGGG + Intronic
1148210910 17:45807971-45807993 GCCCAGCAGCAGCCATGCCCAGG - Intronic
1148578754 17:48728760-48728782 GCCAATCAGCGCGCGTGCCCGGG - Exonic
1151280889 17:73073317-73073339 GCCCCATAGCACCTGTGCCATGG + Intronic
1151462273 17:74261486-74261508 GCCAATAAGCTCCTGTGGCCTGG - Exonic
1152008952 17:77699029-77699051 GCCCATCAGGGCTGGTGCCCAGG + Intergenic
1152364561 17:79847915-79847937 GTCCACCTGCCCCTGTGCCCTGG + Intergenic
1153948808 18:10039797-10039819 CCCCATCAGCAACTGTGCCCAGG + Intergenic
1156375683 18:36513383-36513405 GCCAGGCAGCAGCTGTGCCCAGG + Intronic
1156478490 18:37421348-37421370 GCCCCACAGCCCCTGTGGCCAGG - Intronic
1160455455 18:78995888-78995910 GCCCAGCTGCACGTGTTCCCCGG - Intronic
1160523988 18:79524788-79524810 GCCCACGAGCACCTGAGCCTCGG - Intronic
1161400260 19:4064177-4064199 GCCAGTCAGCACCTGGGCCCGGG - Intronic
1161406696 19:4094978-4095000 ACCCAGCAGCACCTGTGGCGTGG - Intronic
1162302294 19:9850717-9850739 GACCATCAGCAGCAGGGCCCAGG + Intergenic
1163525936 19:17821465-17821487 GCCCAGCAGCACCAGCGCCCAGG + Exonic
1163675339 19:18653014-18653036 GCCAAAAAGCACCTGTGCACTGG - Intronic
1163710682 19:18845031-18845053 CCCCATGAGCACCTGTCCCTAGG + Intronic
1164667944 19:30053768-30053790 GCCCCTCTGCACCTGTCCCCGGG - Intergenic
1164668944 19:30062338-30062360 GCGCATCAGGAGCTGTGTCCTGG + Intergenic
1165266719 19:34667412-34667434 GCCCAGGAGAACCTGGGCCCGGG + Intronic
1165314029 19:35043988-35044010 ACCCTTCAGCATCTGTGTCCAGG - Intronic
1165463614 19:35959186-35959208 GCCCTGCAGCTCCTCTGCCCCGG - Intergenic
1165792565 19:38500716-38500738 TCCCCTCTGCACCTTTGCCCAGG - Exonic
1166863296 19:45821821-45821843 GCCCATGACCCCCTGTGCCGCGG - Intronic
1166965472 19:46527177-46527199 CACCATCAGCACTGGTGCCCGGG - Intronic
1167501339 19:49850613-49850635 GCCCATTAGCCCCGGCGCCCAGG - Intergenic
1167864057 19:52309655-52309677 GCCCACCAGAACCCCTGCCCAGG - Intronic
1168063324 19:53906343-53906365 CCCCATCAGGCCCTGAGCCCAGG - Exonic
925066349 2:931792-931814 GGCCTTCAGCATCCGTGCCCAGG - Intergenic
925066366 2:931843-931865 GGCCTTCAGCATCCGTGCCCAGG - Intergenic
925066383 2:931894-931916 GGCCTTCAGCATCCGTGCCCAGG - Intergenic
925066400 2:931945-931967 GGCCTTCAGCATCCGTGCCCAGG - Intergenic
925066417 2:931996-932018 GGCCTTCAGCATCCGTGCCCAGG - Intergenic
925066433 2:932047-932069 GGCCTTCAGCATCCGTGCCCAGG - Intergenic
925066449 2:932098-932120 GGCCTTCAGCATCCGTGCCCAGG - Intergenic
925066466 2:932149-932171 GGCCTTCAGCATCCGTGCCCAGG - Intergenic
925066483 2:932200-932222 GGCCTTCAGCATCCGTGCCCAGG - Intergenic
925066500 2:932251-932273 GGCCTTCAGCATCCGTGCCCAGG - Intergenic
925066517 2:932302-932324 GGCCTTCAGCATCCGTGCCCAGG - Intergenic
925066534 2:932353-932375 GGCCTTCAGCATCCGTGCCCAGG - Intergenic
925066550 2:932404-932426 GGCCTTCAGCATCCGTGCCCAGG - Intergenic
925066567 2:932456-932478 GGCCTTCAGCATCCGTGCCCAGG - Intergenic
925066584 2:932508-932530 GGCCTTCAGCATCCGTGCCCAGG - Intergenic
925092001 2:1163558-1163580 TCCCAACAGCACCTGCGACCTGG + Intronic
927497570 2:23561128-23561150 ACCCACCACCACTTGTGCCCTGG + Intronic
927540299 2:23903985-23904007 TCCCGTCATCACCTGTTCCCTGG - Intronic
928354281 2:30595488-30595510 CCCAACCAGAACCTGTGCCCTGG + Intronic
929860733 2:45675265-45675287 GCCCCTTAGCACCTTAGCCCAGG + Intronic
930441279 2:51410077-51410099 TTCCATCAGCCCCTGTTCCCTGG + Intergenic
932009227 2:67958703-67958725 GCCCAGCAATTCCTGTGCCCTGG - Intergenic
932141354 2:69281003-69281025 CCCCACCACCACCTGTTCCCAGG + Intergenic
935530689 2:104229518-104229540 AGCCATCAGCACCTCTGTCCAGG + Intergenic
935720625 2:105975942-105975964 TCTCTTCAGCACCTGTGCCTTGG + Intergenic
936347930 2:111689207-111689229 TCCCACCAGAAGCTGTGCCCAGG + Intergenic
937303112 2:120855419-120855441 GTCCATCAGCATGTGTACCCAGG + Intronic
937366348 2:121264616-121264638 GCCCACCAGCATCCCTGCCCTGG - Intronic
939994999 2:148911768-148911790 GCCCTTCAGTACCTGAGCCTTGG + Intronic
943326560 2:186505820-186505842 CCTCATCACCACCTGTTCCCTGG - Exonic
945730607 2:213528146-213528168 GCCCATCAGAACCTCTTCCATGG + Intronic
948174777 2:235934494-235934516 GTCCATCAGATCCTGTGCCCTGG - Intronic
948573789 2:238936807-238936829 CCCCATCAGCGCTTGAGCCCTGG - Intergenic
948619773 2:239227139-239227161 TCCCACCAGCCCCTGTGCCCCGG - Intronic
948790995 2:240376828-240376850 GCCCACCAGCCCCTCTACCCTGG + Intergenic
948825233 2:240570759-240570781 GCCCATCAGCACCTGTGCCCGGG + Intronic
948881083 2:240857481-240857503 GGCCAGCAGCAGCAGTGCCCTGG - Intergenic
948943434 2:241207643-241207665 GCTCTCCAGCGCCTGTGCCCTGG + Exonic
1170008752 20:11697610-11697632 GCCCATCAGAACTTCTGCACAGG + Intergenic
1171446371 20:25207291-25207313 GCCCGTCTGCAGCTGTCCCCAGG - Exonic
1171896280 20:30813194-30813216 GTCCATCAGTACCTTTGTCCCGG - Intergenic
1172048768 20:32100351-32100373 GACCATCATCACCTCTGCCTGGG - Intronic
1172116075 20:32574401-32574423 GCCCAGCAGAGCCTGTGCCTTGG + Intronic
1175381486 20:58567286-58567308 GCACCCCAGCACCTGTGCTCTGG - Intergenic
1175777810 20:61664014-61664036 ACCCCTCAGCACCTGTCACCAGG - Intronic
1176094048 20:63331507-63331529 GCTCCTCAGCACCTCTGCCCAGG + Intronic
1179631758 21:42683278-42683300 GGCCATCAGAAGCTGTCCCCAGG + Intronic
1179766234 21:43575009-43575031 GCCCTGCTGCTCCTGTGCCCTGG - Intronic
1180068373 21:45424081-45424103 TCCCCCCAGCACCAGTGCCCGGG - Intronic
1180599785 22:17008275-17008297 GCCTGTGAGCACCTGCGCCCGGG - Intergenic
1181481834 22:23204834-23204856 GCACATCATCACCTCCGCCCTGG - Intronic
1181595848 22:23913927-23913949 GACCATCTGCCCGTGTGCCCAGG - Intergenic
1181624476 22:24113959-24113981 GCCCAGCACCACATGTGCTCAGG + Intronic
1183229973 22:36575703-36575725 GCCCATCAAGACCTCTCCCCAGG + Intronic
1184130683 22:42514880-42514902 TCTCCTTAGCACCTGTGCCCCGG - Intronic
1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG + Intronic
1184384675 22:44167325-44167347 ACCCCTTAGCACCTGCGCCCAGG - Intronic
1184423494 22:44395476-44395498 GCCCAACAGCAGCTGTGGTCAGG - Intergenic
1184697319 22:46147319-46147341 GTCCATCAGCACCTGGCCCTGGG - Intergenic
1184715403 22:46279164-46279186 GCCCATGTGTACCTGGGCCCAGG + Intronic
1185341050 22:50291273-50291295 GCACATCAGAGGCTGTGCCCTGG - Intronic
953336630 3:42099243-42099265 ACCCATCAGCAACTCCGCCCCGG - Intronic
953583585 3:44179361-44179383 GGACACCAGCAGCTGTGCCCAGG - Intergenic
954105360 3:48406910-48406932 ACCCAGCAGCTGCTGTGCCCTGG - Intronic
954141595 3:48609564-48609586 GCGCAATAGCACTTGTGCCCCGG + Exonic
962850943 3:139307964-139307986 GCCCACCAGCCCCCGTGCCTGGG + Intronic
966643225 3:182213892-182213914 GGCCATCAGCCCCTGTGGCCGGG + Intergenic
967323834 3:188219521-188219543 GCCTTTCAGCACCTGAGCCAGGG - Intronic
967611770 3:191514815-191514837 GCCTTTCAGCCCCTGTGCTCAGG - Intergenic
968624852 4:1622484-1622506 GCCCCTCAGCGGCAGTGCCCTGG - Intronic
968656182 4:1779411-1779433 GCCCCTCAACACCTGTCCCCTGG - Intergenic
968708010 4:2092385-2092407 GCTCAGCAGCAGCTGTGCGCAGG + Intronic
968744547 4:2352951-2352973 GGCCCCCAGCACCTGTCCCCTGG + Intronic
968901969 4:3436182-3436204 GCCCATCAGCAGGAGTGCACAGG + Intronic
969251517 4:5971371-5971393 GGCCACAGGCACCTGTGCCCCGG - Intronic
969700095 4:8763143-8763165 CCACATCAGCACTTGTGCTCAGG + Intergenic
974103246 4:57440377-57440399 GATCATCAGCACCAGTGCTCAGG - Intergenic
975094869 4:70446029-70446051 TCCCATCAGCCCCTGTGCTTGGG - Intronic
980027078 4:127780732-127780754 GCCCAGCAGGACCAGGGCCCAGG + Intergenic
982494757 4:156077190-156077212 GGCCAGCAGCACCTCTGCCTGGG + Intergenic
983715326 4:170775855-170775877 GGCCCCCAGCAGCTGTGCCCAGG - Intergenic
984350110 4:178579272-178579294 GTGCAGCAGCTCCTGTGCCCAGG + Intergenic
985444979 4:190017027-190017049 GCCCATCAGCCCCTCTCCCCCGG + Intergenic
985499805 5:235825-235847 GGCCCTCACCACCTGTGCTCCGG - Intronic
985737584 5:1593867-1593889 GGCCCTCACCACCTGTGCTCCGG + Intergenic
985825819 5:2190826-2190848 GTCCATCTGCACCTCTGCCATGG + Intergenic
988109939 5:26807425-26807447 GGGCATCTGCAGCTGTGCCCAGG - Intergenic
991035002 5:62120309-62120331 GGCCATCACCAGCTCTGCCCTGG - Intergenic
992118436 5:73565286-73565308 GGCCTCCAGCCCCTGTGCCCGGG - Exonic
993260490 5:85651791-85651813 GCCCTTGAGCCCCTGTGCTCTGG - Intergenic
994859369 5:105168292-105168314 GGCCCTCAGAACATGTGCCCAGG - Intergenic
996864869 5:128109289-128109311 GACAATCACAACCTGTGCCCTGG - Intronic
997689185 5:135814160-135814182 GCCCATGAGCACCATTGCCATGG + Intergenic
997713081 5:136022436-136022458 CCAGATCAGCACCTTTGCCCTGG - Intergenic
998096049 5:139395968-139395990 CCCCACCAGCGCCTGTCCCCAGG - Intergenic
1001288659 5:170441171-170441193 GCCCAGCAGGGCCTCTGCCCTGG + Intronic
1002439261 5:179255911-179255933 GCCCAGCAGCATCTGTGCAAAGG - Intronic
1002780006 6:358592-358614 GCCCATTAGGACCTGGACCCTGG + Intergenic
1003453903 6:6262841-6262863 GCCCTTCTTCACCTGTTCCCTGG + Intronic
1003995703 6:11537877-11537899 GCCCATCAGCACCGGCCTCCTGG + Intergenic
1007482671 6:42160344-42160366 GCCTATAAGCCCCTGTGCCCTGG + Intronic
1009263605 6:61527011-61527033 GCCTATCTGGACCTGTGCCCAGG + Intergenic
1011627044 6:89291225-89291247 GCCCCTCATCAGCTGTGGCCTGG + Intronic
1013191418 6:107806945-107806967 GCACAGGAGCACCTGAGCCCAGG - Intronic
1013461253 6:110377416-110377438 GCCCATCATCAACCATGCCCAGG - Intergenic
1016863971 6:148747808-148747830 GCCCGTGAGCATCTGTGCCGCGG + Intronic
1017739585 6:157395044-157395066 GCCCTTCATCTCGTGTGCCCTGG + Intronic
1017825548 6:158079171-158079193 GGGCACCAGCACCTGTGCCCTGG + Intronic
1018840406 6:167512482-167512504 GGCACTCAGCCCCTGTGCCCAGG - Intergenic
1019543063 7:1560153-1560175 GCCCATCAGCCCCAGATCCCAGG + Intronic
1019576510 7:1740195-1740217 GCCCATCTGCACCTGCTCCCAGG - Intronic
1021793469 7:24229249-24229271 GACCATCAAAACCTGTGCCAAGG + Intergenic
1022374705 7:29802683-29802705 GCCCATCATCACCTCTCTCCAGG - Intergenic
1022473220 7:30694406-30694428 TCCAAACAGAACCTGTGCCCGGG + Intronic
1024224999 7:47319775-47319797 GCCCACCAGCCCATGTGCCAGGG + Intronic
1024250998 7:47505555-47505577 GACCAGCAGCCCCTGTGACCTGG - Intronic
1026030942 7:66793392-66793414 GCCCATCATCACATGAGGCCAGG + Intronic
1026443255 7:70461808-70461830 GCCCACCTCCACCTGTCCCCAGG - Intronic
1029957111 7:104651757-104651779 GCACATCAGAGCGTGTGCCCTGG + Intronic
1031814652 7:126418336-126418358 ACCCATAAGCATGTGTGCCCTGG - Intergenic
1032011225 7:128349430-128349452 GCCCATCAGCTCCTGGGGACTGG - Intergenic
1033010738 7:137619794-137619816 GCCCAGCAGCACCAGAGTCCTGG + Intronic
1033320630 7:140336331-140336353 GCCCAAGATCACCTGAGCCCAGG + Intronic
1034412869 7:150950409-150950431 GCCCTTCAGCACCTGGGGGCAGG + Exonic
1035108185 7:156459322-156459344 GCCCATCAACACCTGTTCATTGG - Intergenic
1035269334 7:157710720-157710742 GCGCAAGGGCACCTGTGCCCAGG - Intronic
1035319174 7:158017448-158017470 GCCCAGGAGCACCTGTGTGCAGG + Intronic
1035337258 7:158137861-158137883 GCCCCTCAGCACCACTACCCCGG - Intronic
1037500516 8:19481235-19481257 GCCCATCGACCTCTGTGCCCTGG + Intronic
1037811266 8:22088636-22088658 GCTCATCAGCCCATGTGCCTGGG + Intergenic
1038005233 8:23424296-23424318 GCCTATCAGATCCTGTGCCTGGG + Intronic
1042570390 8:70157133-70157155 GCCCATCAGGCCCTGTGCAGTGG - Exonic
1042932576 8:74028071-74028093 GCCCATCAGGAGTTTTGCCCAGG - Intronic
1043539059 8:81238930-81238952 GGCCCTCATCACCTGTGTCCTGG - Intergenic
1043625044 8:82245831-82245853 GTACATGAGCACCTGTGGCCAGG - Intergenic
1044617817 8:94160084-94160106 GCTCATCAGCATCAGTGGCCTGG + Exonic
1046486628 8:114895957-114895979 GCCCTTGAGCCCCTGTGCTCAGG + Intergenic
1049442311 8:142614981-142615003 CACCATCAGCCTCTGTGCCCAGG + Intergenic
1049483548 8:142839559-142839581 ACGCATCAGCAGCTGGGCCCAGG + Intronic
1049601264 8:143508805-143508827 GCCCAGCTTCCCCTGTGCCCGGG + Intronic
1049767756 8:144362828-144362850 CCCCATCAGCACCGGTGCTTGGG + Intergenic
1049792502 8:144478391-144478413 GCCCGGCGGGACCTGTGCCCTGG - Intronic
1049797401 8:144503035-144503057 GCCCATGTTAACCTGTGCCCCGG + Intronic
1052223974 9:26061605-26061627 GAACATGAGCACCTGTGCCAAGG + Intergenic
1053175761 9:35922596-35922618 GCCCACCACCACCTCTACCCTGG + Intergenic
1053462881 9:38284373-38284395 GCACATCAGCACGAGTGCGCAGG + Intergenic
1056070454 9:82981319-82981341 GCTCATCATCACCAGTGACCTGG - Exonic
1056267855 9:84917379-84917401 GCCCATAAGCACGTGTGCAGTGG + Intronic
1056323393 9:85457776-85457798 GCCAGTCCACACCTGTGCCCAGG + Intergenic
1056710845 9:88991198-88991220 GCCCTTCGGCCCCTGTTCCCAGG - Exonic
1057479326 9:95432255-95432277 GCCCATCACCACCTGTTCTGAGG - Intergenic
1057793594 9:98140257-98140279 CTCCAACAGCACCTGTCCCCTGG - Intronic
1058455749 9:105136532-105136554 GCTCTTGAGCACCTGTGCTCAGG - Intergenic
1060660436 9:125402222-125402244 GCCCCTCAGCTCCTCTGCTCAGG + Intergenic
1061573505 9:131492072-131492094 GGCCCTCACCACCTCTGCCCTGG + Intronic
1061858816 9:133457407-133457429 GCCCAGCAGCGCCTGTGCACTGG - Intronic
1061896900 9:133652899-133652921 GACCATCAGCACCTGCCACCTGG - Intronic
1062669446 9:137698570-137698592 GCCCATCTGCATCTGGGCCCTGG - Intronic
1186220645 X:7345642-7345664 GCCCATCAGGAGTTTTGCCCAGG - Intronic
1186647011 X:11517946-11517968 GCACATCCGCACATGTACCCCGG + Intronic
1190844907 X:54182836-54182858 GTCCACCAGCACCCGGGCCCCGG + Exonic
1191915864 X:66200619-66200641 GCACATCAGTCTCTGTGCCCAGG - Exonic
1192177335 X:68894321-68894343 GCCCAGCAGGGCCTGAGCCCTGG + Intergenic
1192395267 X:70774168-70774190 GCCCAGCAGCACCAGGGCTCGGG + Intronic
1196007240 X:110849973-110849995 GCCCCTCAACACCTCTTCCCTGG + Intergenic
1196316626 X:114233732-114233754 GCCCTTCAGAACCTGTGTACAGG + Intergenic