ID: 948825349

View in Genome Browser
Species Human (GRCh38)
Location 2:240571143-240571165
Sequence CTGAACACCCTGGCAGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 352}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948825336_948825349 21 Left 948825336 2:240571099-240571121 CCCAAGGGGGAGGCTGCGTTTGT 0: 1
1: 0
2: 0
3: 6
4: 83
Right 948825349 2:240571143-240571165 CTGAACACCCTGGCAGCCCAGGG 0: 1
1: 0
2: 0
3: 29
4: 352
948825342_948825349 -10 Left 948825342 2:240571130-240571152 CCCCAGGTGGGCCCTGAACACCC 0: 1
1: 0
2: 3
3: 26
4: 287
Right 948825349 2:240571143-240571165 CTGAACACCCTGGCAGCCCAGGG 0: 1
1: 0
2: 0
3: 29
4: 352
948825333_948825349 24 Left 948825333 2:240571096-240571118 CCCCCCAAGGGGGAGGCTGCGTT 0: 1
1: 0
2: 0
3: 10
4: 112
Right 948825349 2:240571143-240571165 CTGAACACCCTGGCAGCCCAGGG 0: 1
1: 0
2: 0
3: 29
4: 352
948825332_948825349 25 Left 948825332 2:240571095-240571117 CCCCCCCAAGGGGGAGGCTGCGT 0: 1
1: 0
2: 0
3: 14
4: 103
Right 948825349 2:240571143-240571165 CTGAACACCCTGGCAGCCCAGGG 0: 1
1: 0
2: 0
3: 29
4: 352
948825331_948825349 26 Left 948825331 2:240571094-240571116 CCCCCCCCAAGGGGGAGGCTGCG 0: 1
1: 0
2: 2
3: 9
4: 169
Right 948825349 2:240571143-240571165 CTGAACACCCTGGCAGCCCAGGG 0: 1
1: 0
2: 0
3: 29
4: 352
948825334_948825349 23 Left 948825334 2:240571097-240571119 CCCCCAAGGGGGAGGCTGCGTTT 0: 1
1: 0
2: 0
3: 5
4: 101
Right 948825349 2:240571143-240571165 CTGAACACCCTGGCAGCCCAGGG 0: 1
1: 0
2: 0
3: 29
4: 352
948825335_948825349 22 Left 948825335 2:240571098-240571120 CCCCAAGGGGGAGGCTGCGTTTG 0: 1
1: 0
2: 0
3: 12
4: 151
Right 948825349 2:240571143-240571165 CTGAACACCCTGGCAGCCCAGGG 0: 1
1: 0
2: 0
3: 29
4: 352
948825330_948825349 30 Left 948825330 2:240571090-240571112 CCAGCCCCCCCCAAGGGGGAGGC 0: 1
1: 0
2: 4
3: 21
4: 263
Right 948825349 2:240571143-240571165 CTGAACACCCTGGCAGCCCAGGG 0: 1
1: 0
2: 0
3: 29
4: 352
948825337_948825349 20 Left 948825337 2:240571100-240571122 CCAAGGGGGAGGCTGCGTTTGTG 0: 1
1: 0
2: 1
3: 7
4: 122
Right 948825349 2:240571143-240571165 CTGAACACCCTGGCAGCCCAGGG 0: 1
1: 0
2: 0
3: 29
4: 352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948825349 Original CRISPR CTGAACACCCTGGCAGCCCA GGG Intronic
900132230 1:1092025-1092047 CTGAACACCCAGGCGGGCAAAGG - Exonic
900933604 1:5751873-5751895 CTGAAAACCCTGCCAGCTCCTGG + Intergenic
901393982 1:8967071-8967093 CTCAACACTCTGGGAGGCCAAGG - Intronic
901562825 1:10086356-10086378 CTGAACACTTTGGGAGGCCAAGG - Intronic
901806218 1:11740252-11740274 CTGCACTTCCTGGCAGCCCAGGG - Intronic
903147942 1:21387398-21387420 CTCAGCACCCTGGGAGGCCAAGG - Intergenic
903220266 1:21865407-21865429 GAGGACACCCTGGCACCCCAGGG - Intronic
903261473 1:22133863-22133885 CTGATCTCCCTGGCAGGGCAAGG - Intronic
903635113 1:24808194-24808216 CTCAGCACCTTGGCAGGCCAAGG - Intronic
903971073 1:27119244-27119266 CTGGTCACCCTGGCAACCCAGGG - Intronic
904115057 1:28155612-28155634 CTCAACACTCTGGGAGGCCAAGG + Intronic
905012384 1:34756138-34756160 CTGTGCACCCTGGGACCCCAAGG - Intronic
906000909 1:42424040-42424062 CTGAGCACACTGCCTGCCCAGGG + Intergenic
906380441 1:45328961-45328983 CTGAACTCCCAGCCAGCCCCGGG - Intergenic
906988542 1:50712909-50712931 CTGAACACTTTGGGAGGCCAAGG + Intronic
907083900 1:51651090-51651112 CAGAAGACTCTGGGAGCCCAGGG + Intronic
907463479 1:54620086-54620108 CTGGACACAGTGGGAGCCCAGGG - Intronic
907517295 1:55000656-55000678 CTGAACAGAATGACAGCCCAGGG - Intronic
909548008 1:76868499-76868521 CTAAACACACTGCCAGACCATGG - Exonic
909566281 1:77056853-77056875 CTGTATACCTTGGAAGCCCATGG - Intronic
910540828 1:88355151-88355173 CTGAGATCCCTGGCAGCCAATGG + Intergenic
911056277 1:93711025-93711047 GAGAACACCCAGTCAGCCCATGG - Intronic
912264820 1:108146735-108146757 TTGAACAGCCTTGCATCCCAGGG + Intronic
914516520 1:148379236-148379258 CTGAACCGCCTGGGGGCCCAAGG + Intergenic
914723411 1:150307824-150307846 CCCACCACCCTGGGAGCCCAAGG - Intronic
915067465 1:153238528-153238550 CTGAGCACCCTGCCAGTCCTAGG + Intergenic
915965247 1:160301520-160301542 CTCAACACTCTGGGAGGCCACGG + Intronic
916885748 1:169066105-169066127 CTCAACACCTTGGGAGGCCATGG + Intergenic
918026956 1:180759935-180759957 TTGAACAGCCTTGCATCCCAGGG - Intronic
919384318 1:196899543-196899565 CCGAACACCTTGGGAGGCCAAGG - Intronic
920723472 1:208411791-208411813 CTGTAGGCCATGGCAGCCCAGGG - Intergenic
920871711 1:209800504-209800526 CTGAACACTCTGGGAGGCTAAGG + Intronic
920952372 1:210584582-210584604 CAGAAAAGCCTGACAGCCCAGGG - Intronic
923398598 1:233591930-233591952 CTCAACACTCTGGGAGGCCAGGG - Intergenic
923588894 1:235301285-235301307 CTGAACACTTTGGGAGGCCAAGG + Intronic
924096990 1:240562500-240562522 CTGAACACCAAGGCAGCCCCTGG - Intronic
1064608581 10:17072481-17072503 CTGAGCACCTTGGGAGGCCAAGG + Intronic
1065235649 10:23648917-23648939 CTGAACTCCCAGGCTGCCCTGGG + Intergenic
1066065333 10:31757477-31757499 GTGAATACCCAGGCAGGCCAAGG - Intergenic
1066484302 10:35828564-35828586 CTCACCTCCCTGACAGCCCAGGG - Intergenic
1069867648 10:71513568-71513590 CTGATCACCCTGGCAGACCCTGG - Intronic
1070804877 10:79265140-79265162 CTGACAACCCGGGCAGCCCTTGG + Intronic
1071667971 10:87578623-87578645 CTGAACTCCCGTGCAGACCATGG - Intergenic
1073556479 10:104457193-104457215 CTGCACGTCCTGACAGCCCAGGG + Intergenic
1074966732 10:118497358-118497380 TTGAACACACGTGCAGCCCAGGG - Intergenic
1075103830 10:119524210-119524232 CTGAACAGGAAGGCAGCCCAGGG - Intronic
1075773319 10:124959708-124959730 CTGAGCACTTTGGAAGCCCAAGG - Intronic
1076351050 10:129815649-129815671 CTGAACAGCCTGGTTGCCCAAGG + Intergenic
1076740485 10:132480570-132480592 CTTGGCACCCTGGCAGTCCAAGG + Intergenic
1077086915 11:757542-757564 CACAGCACCCTGGCAGGCCAAGG - Intronic
1077133903 11:989069-989091 CTGTACACCTTGGGAGGCCAAGG + Intronic
1077392157 11:2305075-2305097 CTGAAAACCCTGCCAGCCCTGGG - Intronic
1077409551 11:2397120-2397142 CAGAGCACCCTGGGACCCCAGGG - Exonic
1079121161 11:17686201-17686223 CAGAACATCCTGGCTGTCCAGGG - Intergenic
1081634634 11:44712685-44712707 CTGAGCTTCCTGGCAGCCAAGGG - Intergenic
1085298176 11:75442668-75442690 CAGCAGACTCTGGCAGCCCAGGG - Intronic
1085373544 11:76036296-76036318 CTGAACACTTTGGGAGGCCAAGG + Intronic
1086482856 11:87261873-87261895 CTCAACACTTTGGCAGGCCAAGG - Intronic
1086620428 11:88881996-88882018 CTGCCCACCTTGGCATCCCAAGG - Intronic
1087305092 11:96479844-96479866 CTGCTCACCCAGGCAGCCAATGG + Intronic
1088231739 11:107679973-107679995 CTGAACACTTTGGGAGGCCAAGG + Intergenic
1088885309 11:114001405-114001427 CTGAAATCCATGGCAGCCCATGG + Intergenic
1089152250 11:116373178-116373200 CTGAAAACCCTGGCCTCCCCTGG + Intergenic
1089348690 11:117808967-117808989 CTGACCACCTGGGCAGCCCTGGG - Intronic
1090717326 11:129441928-129441950 CTGAGCACCACGGCATCCCAGGG - Intronic
1090841850 11:130496884-130496906 CTGAACACCTTGGGAGGCCAAGG - Intergenic
1092324278 12:7512754-7512776 CTGAGCACCAGGGGAGCCCATGG - Intergenic
1093641183 12:21528088-21528110 CTGCACACCCTGGCAGCCAGAGG - Intronic
1096075738 12:48802877-48802899 CTCAACACCTTGGGAGGCCAAGG + Intergenic
1096311128 12:50521891-50521913 CTCAACACTCTGGGAGGCCAAGG - Intronic
1097177022 12:57149220-57149242 CCAAACAGCCTGGCATCCCATGG - Intronic
1097283610 12:57861143-57861165 CTGAACACTTTGGGAGGCCATGG - Intergenic
1098030193 12:66245780-66245802 CTGAACACTTTGGGAGGCCAAGG - Intronic
1100525424 12:95414993-95415015 CCCAACACCCTGGGAGGCCAAGG + Intergenic
1101245081 12:102877450-102877472 CTGACCACCCTGTGAGTCCATGG - Exonic
1101465686 12:104946522-104946544 CTCAACACTTTGGGAGCCCAAGG - Intronic
1101616644 12:106344224-106344246 CTGAAAACCGTGGCAGCCAGGGG - Intronic
1101647736 12:106646678-106646700 CTGACAAGCCTGGCATCCCACGG - Intronic
1101955453 12:109208456-109208478 CTGAACACTTTGGGAGGCCAAGG - Intronic
1102252167 12:111394746-111394768 CTGAGCCCCTTGCCAGCCCAAGG - Intergenic
1102901764 12:116644241-116644263 CCCAACACGCTGGCAGGCCAAGG - Intergenic
1103340032 12:120216297-120216319 CTCATCAGTCTGGCAGCCCACGG + Intronic
1105467285 13:20657391-20657413 CTGAATAGCCTTGCAGCCAAAGG + Intronic
1110920111 13:81073610-81073632 CTCAACACTTTGGCAGGCCAAGG - Intergenic
1113250076 13:108442926-108442948 CTGCACACGCTGGCAGACTATGG + Intergenic
1113909047 13:113833250-113833272 CAGCTCACCCTGGCTGCCCACGG - Intronic
1114398475 14:22388054-22388076 CTGGTCCCCCTGGCAGCCCTCGG + Intergenic
1117234003 14:53752471-53752493 CTGGACTCCCCGGTAGCCCAGGG - Intergenic
1117483395 14:56171013-56171035 CTGAAAAGCGTGCCAGCCCAGGG + Intronic
1119284053 14:73436566-73436588 CTCAACACTTTGGGAGCCCAAGG - Intronic
1119839158 14:77778118-77778140 CTCAACACCTTGGGAGGCCAAGG + Intergenic
1120019771 14:79515445-79515467 CTGAAGAGGCTGGCAGCTCAGGG + Intronic
1120716292 14:87844474-87844496 CTGAAACCCCTGCCAGCCCAGGG - Intronic
1120950533 14:90037060-90037082 CTTAACACTCTGGGAGGCCAAGG - Intronic
1121547862 14:94775486-94775508 TCAAAAACCCTGGCAGCCCAGGG - Intergenic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1122423387 14:101591164-101591186 CTGAAGACTCTGGCTTCCCAGGG + Intergenic
1122769379 14:104091246-104091268 CTGAGCCCCCTGGATGCCCAGGG + Intronic
1122870159 14:104634808-104634830 ATGAACACCCAGGTACCCCATGG + Intergenic
1122980406 14:105189463-105189485 CCCAGCACCCTGGCAGACCAAGG + Intergenic
1123043685 14:105500920-105500942 CGGAACAGCCTGGAGGCCCACGG + Intergenic
1124354778 15:28986715-28986737 CCGAACACTCTGGGAGGCCAAGG - Intronic
1124556566 15:30731437-30731459 CTACTCACCCTGGCAGCCCCAGG + Intronic
1125605933 15:40939953-40939975 CTGAGCACCTTGTCTGCCCAGGG + Intergenic
1128459639 15:67856872-67856894 CTTAGCACCTTGGCAGCCCGAGG + Intergenic
1130328752 15:82903360-82903382 CTCAACACCTTGGGAGGCCAAGG + Intronic
1132327440 15:100983537-100983559 CTGAGCATCCCGGCAGCCTATGG + Exonic
1132569168 16:636577-636599 CTGAAAACCCTGGACGGCCATGG - Intergenic
1132624924 16:887135-887157 CTGAGCGGGCTGGCAGCCCACGG + Intronic
1132925247 16:2425884-2425906 CTGTACGCCCTGGAAACCCAGGG - Intergenic
1132986119 16:2768575-2768597 CTGAAGATCCTTCCAGCCCAGGG - Intronic
1133184299 16:4084473-4084495 CTCAACACTCTGGGAGGCCAAGG + Intronic
1133481413 16:6174342-6174364 CTGAACACTTTGGGAGGCCAAGG + Intronic
1134670352 16:16050212-16050234 CTGAACACTTTGGGAGGCCAAGG + Intronic
1136084675 16:27876442-27876464 CTGAGCTTCCTGGCAGCCGATGG + Intronic
1137374736 16:47942900-47942922 CTCAACACTCTGGGAGGCCAAGG - Intergenic
1137590583 16:49690976-49690998 GTGAGCTCCCCGGCAGCCCATGG + Intronic
1138177058 16:54909870-54909892 CTTAGCACCCTGGGAGGCCAAGG + Intergenic
1138458247 16:57133347-57133369 CTGGCCTCCCTGGCAGCCCAGGG - Intronic
1139339165 16:66256635-66256657 CTGATCACTTTGGCAGCCCCAGG + Intergenic
1140343040 16:74184320-74184342 CTCAACACTTTGGGAGCCCAAGG + Intergenic
1141355538 16:83342351-83342373 CTGAACACCCTGGTATCCAGTGG - Intronic
1141548429 16:84787808-84787830 CCCAACACTCTGGGAGCCCAAGG + Intergenic
1141802082 16:86316842-86316864 TTGAGCTTCCTGGCAGCCCAAGG + Intergenic
1141954389 16:87360788-87360810 TTGAACACACAGGCAGCACAGGG - Intronic
1142121966 16:88390917-88390939 CTGAAACCTCTGGCAGCTCATGG + Intergenic
1142160758 16:88556179-88556201 CTGAAAACCCGCCCAGCCCATGG + Intergenic
1142196181 16:88740296-88740318 CTGTCCACGCTGGCCGCCCAGGG + Intronic
1142211974 16:88812594-88812616 GTGAACCCCCTGGCCGCCCGAGG + Intergenic
1142260252 16:89039516-89039538 CTGAACACCCAAGGAGGCCACGG - Intergenic
1142469452 17:155241-155263 CTGAACACTTTGGGAGGCCAAGG - Intronic
1142638556 17:1271969-1271991 CTGAGCACTGTGGGAGCCCAAGG + Intergenic
1142885685 17:2910947-2910969 CTGAACACTTTGGGAGGCCAAGG - Intronic
1144103746 17:11967355-11967377 CTCAGCACCCTGGGAGGCCAAGG - Intronic
1144760666 17:17705377-17705399 CCGAGCACTCTGGGAGCCCAAGG + Intronic
1145302109 17:21648039-21648061 CCTAACACACTGACAGCCCACGG - Intergenic
1145348201 17:22055277-22055299 CCTAACACGCTGACAGCCCACGG + Intergenic
1146939435 17:36834092-36834114 CTCAACACTTTGGCAGGCCAAGG - Intergenic
1147374577 17:40016118-40016140 CTGAACAGCCTGGCAGGACATGG + Intronic
1147744402 17:42686417-42686439 CTGAATATCCTAGCAGCCCTTGG + Intronic
1147876650 17:43626451-43626473 CTCAACACTCTGGGAGGCCAAGG - Intergenic
1148068691 17:44893362-44893384 CTGACCACCTTGGCCTCCCAAGG + Intronic
1148822627 17:50368390-50368412 CTGATCACCCTTTCAGCCCCAGG - Intronic
1149799172 17:59550735-59550757 CTCAACACTTTGGGAGCCCAAGG - Intergenic
1150118799 17:62581251-62581273 CTCAGCACCCTGGGAGGCCAAGG - Intronic
1150522737 17:65886814-65886836 CTGAACCCTATGGCAGCCCGCGG - Intronic
1151040665 17:70856871-70856893 CTGAACACCTTGGAAGGCCAAGG + Intergenic
1151615110 17:75205098-75205120 CCCAACACTTTGGCAGCCCAAGG - Intergenic
1151821559 17:76499793-76499815 CTGCCCACCCTCCCAGCCCAGGG + Intronic
1151858764 17:76742752-76742774 CCCAACACTCTGGGAGCCCAAGG - Intronic
1152235448 17:79136066-79136088 CTGAGCTCCCTGGCATCCCGTGG + Intronic
1152486501 17:80597762-80597784 CTCAACACTCTGGGAGGCCAAGG - Intronic
1155540634 18:26864646-26864668 CTGAACTCACCGGCAGCCCAGGG + Intronic
1156028746 18:32688612-32688634 TTGAACTCACTGCCAGCCCAAGG - Intronic
1156282895 18:35658302-35658324 CTGAACACCCTGACACCCCCAGG - Intronic
1158472589 18:57750866-57750888 CTGAACACTTTGGGAGGCCAAGG + Intronic
1159374558 18:67576405-67576427 CTGAACACTTTGGGAGGCCAAGG + Intergenic
1159608364 18:70498833-70498855 CTGGATACCTTGGCAGCCAATGG + Intergenic
1160152713 18:76407161-76407183 CTCAACACTCTGGAAGGCCAAGG + Intronic
1161553081 19:4925075-4925097 CTCAACACTCTGGGAGGCCAAGG - Intronic
1162345118 19:10114268-10114290 CTGCTCACGCTGGCAGCCTACGG + Exonic
1162461140 19:10815128-10815150 CTGGACAGCCTTGCAGCACAGGG - Intronic
1162699144 19:12500664-12500686 CCCAACACTCTGGGAGCCCAAGG + Intronic
1162792488 19:13070238-13070260 CTGAGCACCCTGTCAGCTCGGGG - Intronic
1163537666 19:17886556-17886578 CCTAACACCCTGGGAGGCCAAGG - Intronic
1163647026 19:18495343-18495365 CTCCACACCCCAGCAGCCCAGGG - Intronic
1163702128 19:18791220-18791242 CTGCTCACCCTGGCTGCCCTCGG - Exonic
1164988814 19:32669745-32669767 CTGAACACTTTGGGAGGCCAAGG + Intronic
1165770539 19:38377440-38377462 CCCAACACTCTGGGAGCCCAAGG - Intronic
1165955774 19:39501249-39501271 CTCAACACTCTGGGAGGCCAAGG - Intronic
1167852419 19:52212333-52212355 CTGAACACTTTGGAAGACCAAGG - Intronic
1202633516 1_KI270706v1_random:21774-21796 CTGAACACTTTGGGAGGCCAAGG - Intergenic
925897896 2:8487495-8487517 CTCAGCAACCTGGCAGCCCCTGG - Intergenic
926752074 2:16205821-16205843 CAGAAAAGCCTTGCAGCCCAGGG - Intergenic
927685781 2:25169303-25169325 CAGACCACCCTGCCAGCTCATGG - Intergenic
928368906 2:30724627-30724649 CTGGACACCCTGGCATCTCAAGG + Intronic
928429933 2:31208926-31208948 CAGAACAACCTGGCAGCTTATGG - Intronic
929000709 2:37344798-37344820 CTGACCCCCCTGGATGCCCAGGG - Exonic
929696169 2:44117715-44117737 CTCAACACTCTGGGAGGCCAAGG - Intergenic
929768786 2:44873850-44873872 CTGAACACACTGGTAGTCCCTGG + Intergenic
930029485 2:47049475-47049497 GGGGACCCCCTGGCAGCCCAAGG + Intronic
931987787 2:67758101-67758123 GTGAACATCCTGGGAGCACAGGG - Intergenic
932904095 2:75731181-75731203 CTGACCAGTCTGGCAGCCCTTGG - Intergenic
935096055 2:99945450-99945472 CTGCCCACCCAGGCATCCCAGGG + Intronic
936416783 2:112322489-112322511 CTCAACACCTTGGAAGGCCAAGG - Intronic
937244647 2:120484864-120484886 ATGAACACCTTGGCAGCCTTGGG + Intergenic
937451256 2:122003485-122003507 CTCCACACCCTGGCAGCAGATGG - Intergenic
938668332 2:133563028-133563050 CTGAACACTCTGGCAAGTCATGG - Intronic
938782704 2:134599781-134599803 CTCAACACTCTGGGAGGCCAAGG - Intronic
939934590 2:148274979-148275001 CTCAACACTCTGGGAGGCCAAGG - Intronic
940773984 2:157867582-157867604 CTGAAAACTCTGGCAGCCCCAGG - Intronic
941380693 2:164788736-164788758 CTCAGCACTCTGGCAGGCCAAGG + Intronic
944239947 2:197476562-197476584 CCCAACACCCTGGGAGGCCAAGG - Intergenic
945188999 2:207166802-207166824 CTCTGCACCCTGGCAGCCCGTGG - Intronic
945314006 2:208350889-208350911 CTCATCACCCTGGCAGGCCCGGG + Exonic
945371487 2:209023977-209023999 TTGAACACCCTTGTATCCCAGGG - Intergenic
948825349 2:240571143-240571165 CTGAACACCCTGGCAGCCCAGGG + Intronic
1168772701 20:425873-425895 CTGAACACTCTGGGAGGCCGAGG - Intronic
1168940605 20:1708049-1708071 CTGGAATCCCTGGAAGCCCAGGG + Intergenic
1170312983 20:15012787-15012809 CTGAGCTCCCAGGCAGCCCTGGG - Intronic
1170569993 20:17627267-17627289 CTGAAAACCCTGGCCCCCCAAGG + Intronic
1170827699 20:19810438-19810460 CTGGGGGCCCTGGCAGCCCATGG - Intergenic
1171190713 20:23157237-23157259 CTGAGCCCCCTGGCAGCCATGGG - Intergenic
1171518695 20:25759467-25759489 CCGAACACGCTGATAGCCCAGGG - Intergenic
1174069101 20:47887593-47887615 ATGTTCACCCTTGCAGCCCATGG + Intergenic
1174525701 20:51169034-51169056 CTCAACACTCTGGGAGGCCAAGG - Intergenic
1175415076 20:58795733-58795755 CTGGGCACCTTGGCAGCACAGGG + Intergenic
1176175406 20:63720702-63720724 CTCAACACCTTGGGAGGCCAAGG - Intronic
1176373164 21:6074585-6074607 CTGGACACACTGGCAGCTCTGGG + Intergenic
1176645730 21:9347636-9347658 CTGAACACTTTGGGAGGCCAAGG - Intergenic
1176652842 21:9565872-9565894 CCTAACACACTGACAGCCCAGGG - Intergenic
1179417358 21:41209109-41209131 CTGAACACACCGCCAGGCCATGG + Intronic
1179627546 21:42657261-42657283 CTGTGCACCCTGGCAAGCCAAGG - Intronic
1179750313 21:43463658-43463680 CTGGACACACTGGCAGCTCTGGG - Intergenic
1179916371 21:44480751-44480773 CTGGAGCCCCTGGCTGCCCAGGG + Intergenic
1180367197 22:11951516-11951538 CTGAACACTTTGGGAGGCCAAGG + Intergenic
1180378884 22:12119819-12119841 CTGAACACTTTGGGAGGCCAAGG - Intergenic
1183365745 22:37405884-37405906 CTGAGCACCTTGGGAGGCCAAGG + Intronic
1183383526 22:37502461-37502483 CTGTAGACACTGGCAGCCCTTGG - Intronic
1183834968 22:40444815-40444837 CCCAGCACCCTGGCAGGCCAAGG + Intronic
1184151086 22:42639077-42639099 CTGAGCACTTTGGGAGCCCAAGG + Intronic
1184695307 22:46135573-46135595 CGGAATTCCCAGGCAGCCCATGG + Intergenic
1184988114 22:48149370-48149392 CTGAACACTTTGGGAGGCCAAGG + Intergenic
1185276792 22:49953403-49953425 CTGAACACCCTGTCCGCTCTTGG - Intergenic
950659366 3:14457269-14457291 CTCAAAACCCTGGCAGGGCAGGG + Intronic
950669296 3:14516236-14516258 CTACACTCCCTGGCAGCCAAAGG - Intronic
950881570 3:16326821-16326843 CTGAACTCGCTGGCGGCCTATGG - Exonic
952388346 3:32859506-32859528 CTCAACACTTTGGCAGGCCAAGG - Intronic
952805388 3:37344962-37344984 CTGAACACTTTGGGAGGCCAAGG + Intronic
953676742 3:45008494-45008516 CAGTACACCCTCACAGCCCATGG - Intronic
953878508 3:46679655-46679677 CTGAGCTTCCCGGCAGCCCATGG - Intronic
954216046 3:49125079-49125101 CTGAAGGCCCTGGGAGCCAACGG - Exonic
954563201 3:51576167-51576189 TTGAACAGCCTTGCATCCCAGGG + Intronic
954792259 3:53142180-53142202 CTGATCACCCTGCCTGCCCTTGG + Intergenic
955382737 3:58453162-58453184 CTGAACACTTTGGGAGGCCAAGG - Intergenic
956796835 3:72725375-72725397 CTGAGCTCCCATGCAGCCCAGGG + Intergenic
957401387 3:79719593-79719615 CTGACCTTCCTGGCAGCCAAAGG + Intronic
960506416 3:118500201-118500223 CTGAACACTTTGGGAGGCCAAGG + Intergenic
961541875 3:127605688-127605710 CTCAACACTCTGGGAGGCCAAGG - Intronic
962579359 3:136783889-136783911 GTGATCACTCTGGCATCCCAAGG + Intergenic
962819905 3:139038489-139038511 CTGAACTCCTTGGTAGCCAAGGG - Intronic
963444663 3:145388793-145388815 TTGAACACCTTGGGAGGCCAAGG + Intergenic
963897726 3:150704126-150704148 CTGAAACCCCTGGCAGCCTGCGG + Intergenic
964796817 3:160507246-160507268 CTCAACACTCTGGGAGGCCAAGG + Intronic
966898843 3:184466014-184466036 CTGAGCACAGTGGCAGTCCAAGG - Intronic
1202741157 3_GL000221v1_random:57430-57452 CTGAACACTTTGGGAGGCCAAGG + Intergenic
969440303 4:7212983-7213005 CTGAAGACCCGGGCAGCACAAGG - Intronic
970363070 4:15329672-15329694 CTGAACACTTTGGGAGGCCAAGG + Intergenic
970380717 4:15504658-15504680 ATAAACACCCTAGTAGCCCAGGG - Intronic
971270706 4:25142024-25142046 CCCAACACCCTGGGAGGCCAAGG + Intronic
972485429 4:39535511-39535533 CTCAACACTTTGGGAGCCCAAGG - Intergenic
972496056 4:39635927-39635949 CTGCCCACCTTGGCCGCCCACGG - Intronic
972573476 4:40331009-40331031 CTGCTCACCCTGCCAGCCCCTGG + Intergenic
972820702 4:42698610-42698632 TTGAACAGCCTTGCATCCCAGGG + Intergenic
973765866 4:54162006-54162028 CCGAACACTTTGGCAGCCCGAGG + Intronic
976298159 4:83492772-83492794 CTCAACACTTTGGCAGGCCAAGG - Intronic
976305348 4:83554241-83554263 CTGAGCACTCTGGGAGGCCAAGG - Intronic
977601535 4:98938705-98938727 CTCAGCACTCTGGCAGGCCAAGG + Intergenic
978139438 4:105300884-105300906 TTGAACAGCCTTGCATCCCAGGG - Intergenic
978507672 4:109477574-109477596 CTGAGCACCTTGGGAGGCCAAGG - Intronic
980678015 4:136115527-136115549 CTCAGCACCCTGGGAGGCCAAGG - Intergenic
981456457 4:144958912-144958934 TTGAACCACCTGGCATCCCAGGG + Intergenic
987921265 5:24284453-24284475 CCGAACACTCTGGGAGACCAAGG + Intergenic
988109616 5:26801221-26801243 CTCAACACTTTGGCAGGCCAAGG + Intergenic
988491325 5:31707916-31707938 CTGAACATCCTGGCTGGGCATGG - Intronic
997318218 5:132955526-132955548 CTGAACACTTTGGGAGGCCAAGG + Intronic
997320853 5:132977577-132977599 CTGAACACTTTGGGAGGCCAAGG - Intergenic
997509847 5:134446603-134446625 GTGAACACGCTAGCTGCCCAGGG - Intergenic
997567211 5:134897497-134897519 CTGAGCACTCTGGGAGGCCAAGG - Intronic
999399233 5:151251824-151251846 CTGAACCCCCGGCCAGGCCACGG + Intronic
1000529052 5:162395801-162395823 CTCAACACTTTGGGAGCCCAAGG + Intergenic
1001470279 5:172006921-172006943 CTTGACTTCCTGGCAGCCCAAGG + Intergenic
1001718402 5:173836302-173836324 CTGAACAGCCTGGCTACCCAGGG + Intergenic
1002311111 5:178314335-178314357 CTTAAAACCCTGGCAGCCTGTGG - Intronic
1003951210 6:11117423-11117445 CTCAACACCTTGGGAGGCCAAGG - Intronic
1004014338 6:11718546-11718568 CTGAACACCCAGGCATGCCCAGG - Intronic
1004220568 6:13743179-13743201 CTCCACACCCTGCAAGCCCAGGG - Intergenic
1004393457 6:15228263-15228285 CTGAGCACCCTGGGAGGCCGAGG + Intergenic
1004490441 6:16110057-16110079 CTGAACATGCTTGCAGCTCAGGG - Intergenic
1005973384 6:30778845-30778867 CTGAATACCCACCCAGCCCAGGG + Intergenic
1006464211 6:34181696-34181718 CTGTCCACCCTGGCCTCCCAAGG - Intergenic
1008564105 6:52750634-52750656 TTCTACAGCCTGGCAGCCCAAGG - Exonic
1008568415 6:52791915-52791937 TTCTACAGCCTGGCAGCCCAAGG - Exonic
1008574574 6:52847967-52847989 TTCTACAGCCTGGCAGCCCAAGG - Intronic
1008579816 6:52896863-52896885 TTCTACAGCCTGGCAGCCCAAGG - Exonic
1008647757 6:53532490-53532512 CTTAACACACTGGCAGGCCAGGG + Intronic
1009383042 6:63055885-63055907 TTGAACAGCCTTGCATCCCAGGG - Intergenic
1011922678 6:92600410-92600432 TTGAACAACCTTGCATCCCAGGG - Intergenic
1013200844 6:107894421-107894443 CTCAGCACCCTGGGAGGCCAAGG + Intronic
1013748688 6:113375897-113375919 CCAAACCCCCTGCCAGCCCAGGG + Intergenic
1013821979 6:114165435-114165457 TTGAAAACCCTGGCAGGCGATGG - Intronic
1015198992 6:130557776-130557798 ATGTACACAATGGCAGCCCACGG + Intergenic
1017039200 6:150294305-150294327 CTTAGCTCTCTGGCAGCCCATGG + Intergenic
1017938703 6:159031673-159031695 AAGAACAGACTGGCAGCCCAGGG - Intergenic
1018472215 6:164106939-164106961 CTGGCCTGCCTGGCAGCCCAAGG + Intergenic
1018532335 6:164780819-164780841 CTCAGCACTCTGGCAGGCCAAGG + Intergenic
1019332764 7:468916-468938 CGAAGCACCCTGGCTGCCCACGG + Intergenic
1019374195 7:680475-680497 GTGAGCTCCCTGGAAGCCCACGG - Intronic
1019747887 7:2710686-2710708 CTGAAGACTCTGGCAGTCAAGGG + Intronic
1020060032 7:5144736-5144758 CGCCACACCCTGCCAGCCCATGG - Intergenic
1020167945 7:5823030-5823052 CGCCACACCCTGCCAGCCCATGG + Intergenic
1021126731 7:16859145-16859167 CTCAGCACTCTGGCAGGCCAAGG + Intergenic
1021940251 7:25672087-25672109 CTGAAAACCCAGGGAGGCCAAGG + Intergenic
1023176726 7:37442735-37442757 CTGGATACCATGGCAACCCAGGG + Intronic
1023643367 7:42283720-42283742 CTGCAATCCTTGGCAGCCCATGG + Intergenic
1023912891 7:44567982-44568004 CTGGAGACCCTGGCAGCACGCGG - Intronic
1025022483 7:55490413-55490435 CTCAAAACCCTGGCATGCCAGGG + Intronic
1025279188 7:57614584-57614606 CCTAACACTCTGACAGCCCAGGG - Intergenic
1025305543 7:57850916-57850938 CCTAACACTCTGACAGCCCAGGG + Intergenic
1027423709 7:78041423-78041445 CCCAACACTCTGGGAGCCCAAGG + Intronic
1028277248 7:88872299-88872321 CTGAACACCTTGGGAGGCCAAGG + Intronic
1029210610 7:98905265-98905287 CTGCACAGCCAGGCAGCACACGG - Intronic
1030336125 7:108328611-108328633 CTGATCACCCTGGGAGGCCTGGG - Intronic
1031538554 7:122964557-122964579 CTCAACACTCTGGGAGGCCAAGG + Intergenic
1031903599 7:127437151-127437173 CTCAACACGCTGGGAGGCCAAGG - Intergenic
1032359417 7:131241410-131241432 AAGAACACCTTAGCAGCCCAGGG + Intronic
1032568255 7:132970858-132970880 CCCAACACCCTGGGAGACCAAGG + Intronic
1032648990 7:133857505-133857527 CAGCACAGCCTGGCAGCCCAGGG - Intronic
1032707996 7:134438845-134438867 ATGAACACTCTGGCAGCTCTAGG + Intergenic
1033327983 7:140395125-140395147 CTGAACACTTTGGGAGGCCAAGG + Intronic
1034309300 7:150072566-150072588 CTGGGCACCTGGGCAGCCCATGG + Intergenic
1034460616 7:151196072-151196094 CTGAACACTCCTGAAGCCCACGG + Intronic
1034484795 7:151352691-151352713 CCCAACACCCTGGGAGGCCAAGG - Intronic
1034547481 7:151798563-151798585 CTCAACACTCTGGGAGGCCAAGG - Intronic
1034797557 7:154028070-154028092 CTGGGCACCTGGGCAGCCCATGG - Intronic
1035052947 7:156014318-156014340 CTGAAACCCCTGTCAGCCCAAGG - Intergenic
1035227945 7:157443811-157443833 CTGCGCACCCTGACAGCACATGG - Intergenic
1035706296 8:1678097-1678119 CTCAACAGCCTGGCGGCTCAAGG - Intronic
1036804167 8:11817189-11817211 TTGAACAGCCTTGCATCCCAGGG + Intronic
1036976547 8:13419533-13419555 TTGAACCACCTGGCATCCCAGGG + Intronic
1037512315 8:19596116-19596138 CTCAACACTCTGGAAGGCCAAGG - Intronic
1038390627 8:27196966-27196988 CTGAACACTTTGGGAGGCCAAGG + Intergenic
1038771117 8:30481214-30481236 CTCAACACTCTGGAAGGCCAAGG - Intronic
1038882335 8:31628300-31628322 CTGTACTCCCTGGCAGCCCCAGG - Intergenic
1039694025 8:39891428-39891450 CTTAACACTCTGGGAGGCCAAGG + Intergenic
1039760990 8:40575086-40575108 ATGACCACCCTGGCTGCTCAAGG + Intronic
1040504488 8:48034976-48034998 CTGAACACCCTGACACCACCGGG - Intronic
1041728182 8:61037905-61037927 CTGACCACCCTGCCAGAGCAAGG - Intergenic
1041741354 8:61160444-61160466 CTGCCAACTCTGGCAGCCCAGGG + Intronic
1042383345 8:68144718-68144740 CTCAACACTCTGGGAGGCCAAGG + Intronic
1042399840 8:68332208-68332230 CTCAGCACCCTGGCAACCCGCGG - Intronic
1044637639 8:94342405-94342427 CTCAACACTTTGGGAGCCCAAGG + Intergenic
1045687430 8:104726725-104726747 CACAACACCTTGGCACCCCATGG - Intronic
1045907894 8:107370445-107370467 CTGCACACCTTGGCCTCCCAAGG - Intronic
1046392833 8:113599482-113599504 CTGATTAGTCTGGCAGCCCAGGG - Intergenic
1047402246 8:124556989-124557011 CTTAAAACGCTGGCAGCCAAGGG + Intronic
1047657392 8:126992797-126992819 CTCAACACCTTTACAGCCCATGG + Intergenic
1047941018 8:129827307-129827329 CTCAACACCCTGGGAGGCCAAGG + Intergenic
1048334390 8:133491964-133491986 CTGGACAGCTTGGCAGCCCCTGG - Intronic
1049229723 8:141475630-141475652 CTGAGCTCCCCAGCAGCCCAAGG - Intergenic
1049539699 8:143202643-143202665 CTGGGCACCCTGGCTGCCCAGGG + Intergenic
1049612387 8:143561616-143561638 CTGCCAACACTGGCAGCCCAGGG - Intronic
1051377571 9:16419241-16419263 CTGCCCTCCCTGGCAGCCTAGGG - Exonic
1053268993 9:36737110-36737132 CTGAGCTCCCTGGCTGCCCAGGG - Intergenic
1053290971 9:36879508-36879530 GAGCACACCCAGGCAGCCCAGGG + Intronic
1054799956 9:69337256-69337278 CTCAACACTCTGGGAGGCCAAGG - Intronic
1055113605 9:72584515-72584537 CTCAACACCTTGGGAGGCCAAGG - Intronic
1055480226 9:76702306-76702328 CCCAACACCTTGGGAGCCCAAGG - Intronic
1056393560 9:86160774-86160796 TTGAACAGCCTTGCATCCCAGGG - Intergenic
1057210375 9:93198099-93198121 CTGTACACCCAGGCAGCCAGGGG + Intronic
1060375385 9:123112032-123112054 CTGAGCAGCCTGGCAGGCCCTGG - Intronic
1060495137 9:124112938-124112960 CTGGGGCCCCTGGCAGCCCAGGG - Intergenic
1061165450 9:128919663-128919685 CTGCTCAGCCTGTCAGCCCATGG - Intergenic
1061525626 9:131159162-131159184 CCCAACACCCTGGGAGGCCAAGG - Intronic
1061573849 9:131494177-131494199 CTGACCACCCTGGCACCTCCAGG - Intronic
1061801950 9:133117545-133117567 CCGCACACCTTGGCTGCCCACGG - Intronic
1062030983 9:134361915-134361937 GTGCACACCCTGGCCCCCCAGGG - Intronic
1062158093 9:135065311-135065333 CTGGGCACCATGCCAGCCCAGGG + Intergenic
1062402204 9:136377673-136377695 CTGGCCACCCTGGCCCCCCAAGG - Exonic
1203709795 Un_KI270742v1:87359-87381 CTGAACACTTTGGGAGGCCAAGG + Intergenic
1203541273 Un_KI270743v1:90184-90206 CTGAACACTTTGGGAGGCCATGG - Intergenic
1203630571 Un_KI270750v1:69413-69435 CCTAACACACTGACAGCCCAGGG - Intergenic
1186455960 X:9709972-9709994 CTCAGCACCCTGGGAGGCCAAGG + Intronic
1186528767 X:10274440-10274462 CTCAACACCTTGGGAGGCCAAGG - Intergenic
1188592947 X:31862010-31862032 CTGAAAACCTTGGCAGCACATGG + Intronic
1191177740 X:57523415-57523437 TTGAACAACCTTGCATCCCAGGG + Intergenic
1192685186 X:73296836-73296858 TTGAACAACCTTGCATCCCAGGG - Intergenic
1197011164 X:121565645-121565667 CTGAGCAGCCTGGTAGCCAAGGG + Intergenic
1197500659 X:127237712-127237734 CTGAGAACCCTGGAAGCCAATGG - Intergenic
1197759068 X:130015145-130015167 TTTGGCACCCTGGCAGCCCAGGG - Exonic
1198418923 X:136449363-136449385 ATGAACATCCTGGCAAGCCATGG + Intergenic
1199509283 X:148602296-148602318 TTGTACAGCCTGGCAGGCCATGG + Intronic