ID: 948826466

View in Genome Browser
Species Human (GRCh38)
Location 2:240575564-240575586
Sequence GAGCTTCTTCCCGGAGCTGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 160}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948826458_948826466 14 Left 948826458 2:240575527-240575549 CCAGCGTGGTGGCCCAGGACCTG 0: 1
1: 0
2: 3
3: 22
4: 251
Right 948826466 2:240575564-240575586 GAGCTTCTTCCCGGAGCTGAAGG 0: 1
1: 0
2: 2
3: 15
4: 160
948826462_948826466 -5 Left 948826462 2:240575546-240575568 CCTGCTGGACTCCTTCCTGAGCT 0: 1
1: 0
2: 0
3: 40
4: 293
Right 948826466 2:240575564-240575586 GAGCTTCTTCCCGGAGCTGAAGG 0: 1
1: 0
2: 2
3: 15
4: 160
948826460_948826466 2 Left 948826460 2:240575539-240575561 CCCAGGACCTGCTGGACTCCTTC 0: 1
1: 0
2: 6
3: 20
4: 234
Right 948826466 2:240575564-240575586 GAGCTTCTTCCCGGAGCTGAAGG 0: 1
1: 0
2: 2
3: 15
4: 160
948826461_948826466 1 Left 948826461 2:240575540-240575562 CCAGGACCTGCTGGACTCCTTCC 0: 1
1: 0
2: 6
3: 31
4: 337
Right 948826466 2:240575564-240575586 GAGCTTCTTCCCGGAGCTGAAGG 0: 1
1: 0
2: 2
3: 15
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948826466 Original CRISPR GAGCTTCTTCCCGGAGCTGA AGG Exonic
901445939 1:9308213-9308235 GAGCTTCTTGCCAGTGCTGTTGG + Intronic
905319490 1:37105809-37105831 GTGCTTCTGCCCTGAGCTGTTGG + Intergenic
907368089 1:53979144-53979166 GAGCTTCATCACTGAGCAGAGGG - Intergenic
916370692 1:164091039-164091061 TTTCTTCTTCCTGGAGCTGAAGG - Intergenic
916788582 1:168104812-168104834 CAGCTCCTTCCTGCAGCTGAGGG + Exonic
916804333 1:168243865-168243887 AAGCTTCTTCCTGGATCTGCAGG + Exonic
919949402 1:202348745-202348767 GCGCTTCAGCCCGGAGCAGAGGG - Exonic
922313280 1:224416554-224416576 GAGCTTGGTCCCTGACCTGAGGG + Intronic
922795939 1:228339864-228339886 CAGCTTCCTCCCAGAGGTGAGGG + Intronic
1062774926 10:136196-136218 CAGCTTCTCCCCGGAGCTCTGGG - Intronic
1063461342 10:6216601-6216623 GGGCTTATTCCTGGAGATGATGG + Intronic
1067176582 10:43954001-43954023 GAGCTTCTTTCCTGAGCCGAGGG + Intergenic
1068464808 10:57376003-57376025 GAGCCTCTTCCCAGGCCTGAAGG + Intergenic
1073249678 10:102114176-102114198 AAGCTGCATCCCGGGGCTGAGGG + Intronic
1074148582 10:110738746-110738768 GGGCATGTTCCTGGAGCTGAAGG + Intronic
1075612614 10:123865721-123865743 CAGCTACTGCCCAGAGCTGAGGG + Intronic
1075953059 10:126498630-126498652 GAGCTTCTTCCCCCAGCTGCTGG + Intronic
1077480556 11:2812549-2812571 GAGCTCCTTCCCGGAGAGGAGGG + Intronic
1078708713 11:13769617-13769639 TAGCTTCCTCCCGCAGCTGTAGG - Intergenic
1083268903 11:61560830-61560852 GAGCTTCTGCAGGGAGCAGAAGG + Intronic
1092148704 12:6232495-6232517 GAACTTCTTCCCTGAGATGAGGG + Intronic
1092234314 12:6796664-6796686 GAGCTTTGTCCTGGAGGTGAGGG - Intronic
1093218297 12:16388440-16388462 CAGCATCGTCACGGAGCTGAAGG + Intronic
1096559433 12:52424993-52425015 GAGCTGCTTCCAGGAGGAGAGGG - Intronic
1096622351 12:52872701-52872723 GAACTCCTTCCTGGAGCTGGGGG - Intergenic
1096840773 12:54378344-54378366 GAGCTTCTTCCCTGGGATGCTGG + Intronic
1097188102 12:57206349-57206371 CAGCTTCTGGCCGGAGCAGATGG + Intronic
1103561216 12:121794087-121794109 GGGGCTCTTCCCGGAGCTGGAGG - Exonic
1104440107 12:128787240-128787262 GAGCTTCTGCCCGGCGGAGATGG + Intergenic
1104895205 12:132160599-132160621 GAGCTTCTTCACAGAGGTGGTGG + Intergenic
1104901884 12:132193880-132193902 GAGCTTCTTCTCAGAGCAGAGGG + Intergenic
1106760066 13:32859273-32859295 CAGCTTCTTCCCAGAGCACAGGG + Intergenic
1108705301 13:52980093-52980115 GAATTCTTTCCCGGAGCTGAGGG - Intergenic
1112360006 13:98708752-98708774 CATCTTCTTCAAGGAGCTGATGG + Exonic
1113296216 13:108961637-108961659 GACCTTGTTCCAGGAGCTGGAGG - Exonic
1119400620 14:74359876-74359898 GAGCGTCTTCTCGGAGCTGGAGG + Exonic
1122165825 14:99823056-99823078 GGTCTTCTTCCCGGAGGAGATGG - Intronic
1126668924 15:51098443-51098465 AAGCTTCTACCCAGAGCTGAGGG + Intronic
1127811452 15:62568781-62568803 GTGCTTCTTCCAGCAGCTGCAGG - Intronic
1128341889 15:66827948-66827970 GAGCATCTTCCCTGAGCTACTGG - Intergenic
1131464913 15:92647232-92647254 GAGGTTCTTCCAGGACCAGATGG - Intronic
1132715676 16:1288870-1288892 GAGGGTCTTCCCAGAGCTCAGGG + Intergenic
1133969696 16:10558930-10558952 GAGCCTTTTCCCGGAACTGTAGG + Intronic
1137492028 16:48941067-48941089 GAGCTTCCATCCTGAGCTGAGGG - Intergenic
1138212007 16:55171360-55171382 GAGCTTCTCCCTGGTGCAGATGG - Intergenic
1138320118 16:56104596-56104618 GACCTGCTGCCCTGAGCTGATGG - Intergenic
1139565182 16:67770672-67770694 GAGCTTCTGCCGTGAACTGATGG - Intronic
1139692347 16:68649274-68649296 AAGCTTCCTCCCAAAGCTGATGG - Intronic
1142001514 16:87667015-87667037 GAGCTTCTGCCCGGAGCTGGGGG - Intronic
1144497884 17:15760676-15760698 GAAAATCTTCCTGGAGCTGATGG - Intergenic
1145161258 17:20575726-20575748 GAAAATCTTCCTGGAGCTGATGG - Intergenic
1145797735 17:27665729-27665751 GAGCATCTACTGGGAGCTGAGGG - Intergenic
1146842201 17:36163927-36163949 GAGCGTCTACTGGGAGCTGAAGG - Intergenic
1146866109 17:36336490-36336512 GAGCGTCTACTGGGAGCTGAAGG + Intronic
1146870412 17:36375778-36375800 GAGCGTCTACTGGGAGCTGAAGG - Intronic
1146877768 17:36426859-36426881 GAGCGTCTACTGGGAGCTGAAGG - Intronic
1147068978 17:37937102-37937124 GAGCGTCTACTGGGAGCTGAAGG + Intergenic
1147073294 17:37976402-37976424 GAGCGTCTACTGGGAGCTGAAGG - Intergenic
1147080503 17:38016639-38016661 GAGCGTCTACTGGGAGCTGAAGG + Intronic
1147084815 17:38055940-38055962 GAGCGTCTACTGGGAGCTGAAGG - Intronic
1147096449 17:38140599-38140621 GAGCGTCTACTGGGAGCTGAAGG + Intergenic
1147100763 17:38179906-38179928 GAGCGTCTACTGGGAGCTGAAGG - Intergenic
1147414578 17:40279213-40279235 GAGCACCTTCCAGGGGCTGAAGG - Exonic
1147845111 17:43399371-43399393 GAGCCTCTTCTCAGAGCTTATGG - Intronic
1148824898 17:50385435-50385457 GGGCTACTTCCAGGAGCAGAAGG - Intronic
1149445160 17:56707774-56707796 GAGCTTCCTTCGGGAGATGAGGG - Intergenic
1149845352 17:60006370-60006392 GAGCGTCTACTGGGAGCTGAAGG - Intergenic
1152777773 17:82213183-82213205 GAGCTTTTGCCCTGAGATGAAGG + Intergenic
1152920170 17:83062559-83062581 CAGCGGCTTCCCAGAGCTGAGGG + Intergenic
1156022009 18:32610273-32610295 GTGCTTCTTCCTGGGGCTGCTGG - Intergenic
1156509734 18:37626338-37626360 GGGCTGCCTCCAGGAGCTGAGGG - Intergenic
1160783008 19:886172-886194 GAACTTCTCCCCGAAGCTGGAGG + Exonic
1161374750 19:3933658-3933680 GAGCTTCATGCCGGTGCGGAGGG - Exonic
1161408767 19:4104721-4104743 GAGCCTCTCCCCGGAGATGAGGG + Intronic
1162182856 19:8882500-8882522 TACCTTCTTCCCTGATCTGAGGG - Intronic
1163424866 19:17235757-17235779 GCCCTTCTTCCCCGAGCTGCCGG - Exonic
1163674924 19:18650893-18650915 CAGCTTCCTACCGGGGCTGAGGG - Intronic
1165105917 19:33469645-33469667 GAGCTTCTAGCAGGAGCTGGTGG - Intronic
929977948 2:46653398-46653420 GGGCTTCTTCCCAGAGGTGAAGG - Intergenic
929996007 2:46826621-46826643 GAGGTTCTGCCCGGGGCTAAGGG + Intronic
933839442 2:86274843-86274865 GAGCTTCTTGCTGTGGCTGAGGG - Intronic
940119817 2:150252142-150252164 AAGCTTCTTCCCTGTGTTGATGG + Intergenic
946135633 2:217644600-217644622 GAGCATCATCCCAGAGCTGCAGG - Intronic
946284113 2:218689873-218689895 GACCTTCTTACAGGACCTGATGG + Exonic
948826466 2:240575564-240575586 GAGCTTCTTCCCGGAGCTGAAGG + Exonic
1170030548 20:11939570-11939592 GTGCCTCTTCCCTGGGCTGAAGG - Intergenic
1171152105 20:22836192-22836214 GGGCTTCTTCCCACAGCTGCTGG - Intergenic
1172067891 20:32234457-32234479 GTGCTTCTTCCTGCAGGTGAAGG + Exonic
1174163677 20:48569651-48569673 AAGCTCCTTCCAGGAGGTGAGGG + Intergenic
1175036575 20:56005561-56005583 GCTCATCTTCCCGGAGCGGAAGG - Intergenic
1178894454 21:36547652-36547674 GACCTGCTTCCTGGAGTTGAGGG - Intronic
1179577202 21:42315380-42315402 GAGCTGCGTCCCGGAGCCCACGG - Exonic
1181105464 22:20572131-20572153 TAGATTGTTCCTGGAGCTGATGG + Intronic
1181265677 22:21629359-21629381 AAGCTGCTTCCGGGAGCTGCTGG - Exonic
1181328875 22:22073951-22073973 GAGCTTCTCCTGGGAGCTGATGG - Intergenic
1182304908 22:29361242-29361264 GAGCCCCTTCCCGGAGCTGCTGG + Intronic
1182312222 22:29417377-29417399 GAGCCCCTTCCCGGAGCTGCTGG + Intronic
1182688043 22:32135865-32135887 GAGCTCCTTCCCGGAGCTGCTGG - Intergenic
1185193272 22:49452207-49452229 CACCTTCTTCCCAGAGCTGTTGG - Intronic
950550110 3:13661244-13661266 GAGCAGATTCCAGGAGCTGAGGG - Intergenic
957307789 3:78480724-78480746 GAGCTCCTTCCCACAGCTGGTGG - Intergenic
958868744 3:99532379-99532401 GAGCTTCCACCAGGAGCAGAGGG + Intergenic
959336816 3:105077622-105077644 GAGCTACCTCTCTGAGCTGAAGG - Intergenic
965674353 3:171179343-171179365 GAGGTTATTTCCGGAGCTGATGG + Intronic
966094926 3:176188703-176188725 GAGCTTCTCCCAGGAGCACATGG - Intergenic
967035113 3:185643248-185643270 GTGCCTCTTCCCGGAACTGCCGG + Intergenic
968977160 4:3827938-3827960 CAGCGTCTTTCCAGAGCTGAGGG - Intergenic
974103052 4:57438514-57438536 CAGTTGCTTCCAGGAGCTGACGG - Intergenic
975260280 4:72289800-72289822 GAGGGTCTTCCTGTAGCTGAAGG - Intronic
975871626 4:78785473-78785495 GAGCTTCTACCCGGATCTCAAGG - Intronic
976294412 4:83455575-83455597 GAGCTCGTGCCCGGAGATGAGGG - Exonic
980640078 4:135565957-135565979 TAGCTTCCTCCAGGATCTGAGGG + Intergenic
981920420 4:150079218-150079240 GGCCTTCTTCTCCGAGCTGAGGG - Exonic
983271216 4:165564126-165564148 GAGCTACTTCTGAGAGCTGAAGG - Intergenic
984767960 4:183413955-183413977 GAGCTTCTTCCAGGAGGAGAGGG - Intergenic
987392075 5:17386078-17386100 CAGCCTCTTCCCGGAGTAGATGG - Intergenic
989650764 5:43687423-43687445 GAGCAATTTCCCGGAACTGATGG - Intronic
992193246 5:74314795-74314817 CAGCTTCTTCCTGGTTCTGATGG - Intergenic
992675944 5:79106550-79106572 GAGCTACATACTGGAGCTGATGG + Intronic
993392759 5:87341283-87341305 GATCTTCTTCCCGGCCCTAAAGG - Exonic
997346485 5:133196090-133196112 TAGCTTCTTCCTGGAGCTTGGGG + Intergenic
998040286 5:138947152-138947174 GGGCTACTTCCAGGAGCTGCTGG - Exonic
998137381 5:139681278-139681300 CTTCTTCTTGCCGGAGCTGATGG - Exonic
1005511135 6:26512531-26512553 GGGCTTGTTTCTGGAGCTGAGGG + Intergenic
1006401846 6:33822341-33822363 GAGCCCCTTCCCGGAGGTGCTGG + Intergenic
1006848266 6:37078235-37078257 TAGCTTCTTCTTGGAGCTGGAGG + Intergenic
1007225135 6:40308494-40308516 CACCTGCTTCCCGTAGCTGAAGG + Intergenic
1007501895 6:42304861-42304883 TAGCTCCTCCCAGGAGCTGAGGG + Intronic
1014084464 6:117327288-117327310 CAGCTGTTCCCCGGAGCTGAGGG + Intronic
1017036902 6:150275117-150275139 GGCTTTCTTCCCAGAGCTGAAGG - Intergenic
1018801948 6:167229799-167229821 GAGCTTCATCTCTCAGCTGAGGG - Intergenic
1019512048 7:1422583-1422605 GAGCCTGTTCCCGGACCAGATGG - Intergenic
1019635077 7:2071111-2071133 AAGCTTCATCCCGGGGCTGGGGG + Intronic
1019708014 7:2505595-2505617 GAGCTCATGCCCGGACCTGAGGG + Intergenic
1019750905 7:2729131-2729153 GAGCCTCTTCGCGGCGCTGTTGG - Exonic
1023142567 7:37116893-37116915 GAGCTTCTTGCCAGAGATAATGG - Intronic
1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1026905477 7:74060533-74060555 GATCTCCTTCCCTGAGCTCAGGG - Intronic
1027231286 7:76274170-76274192 GAACTTCCTCCAGGATCTGAAGG - Intronic
1027281637 7:76613431-76613453 GAGCTCCTGCTGGGAGCTGAAGG + Intronic
1028477482 7:91266757-91266779 GAACTTCCTCCAGGAGTTGAGGG - Exonic
1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029759277 7:102592294-102592316 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1030272920 7:107689080-107689102 GAGCTTGTTCTCGGAGATGCTGG + Exonic
1032534861 7:132654404-132654426 GAGTTTCTACCTGAAGCTGAGGG + Intronic
1033333408 7:140433448-140433470 AAGGTTCTTTCTGGAGCTGAAGG - Intergenic
1035933151 8:3806582-3806604 GAGCTTCTTCCCAGAGTAGTAGG + Intronic
1036391568 8:8328412-8328434 GAGCTTCTTCCCGCTGTTGGTGG + Exonic
1036463826 8:8978006-8978028 GATTATCTTCCAGGAGCTGAGGG - Intergenic
1036593898 8:10194826-10194848 GAGTCTCTTCCCAGGGCTGAGGG - Intronic
1037965387 8:23129932-23129954 AAGCTTCTGCCCCAAGCTGAGGG - Intergenic
1037985459 8:23288245-23288267 GCGCTCCTTCCCGGGGCTCACGG - Intronic
1038865549 8:31435380-31435402 AAGGTTCTTCAGGGAGCTGATGG - Intergenic
1039428320 8:37505405-37505427 GAGCTGCTTCCTGGAGCAGGTGG - Intergenic
1040788229 8:51192781-51192803 GAGCTCCTTCCAGGGACTGATGG + Intergenic
1046103012 8:109636082-109636104 GAACTTCTTCCATGAGCTCAAGG - Intronic
1047017843 8:120742546-120742568 GAGCTTCCTCCTACAGCTGAAGG + Intronic
1047422548 8:124718935-124718957 GAGTTTCTTCCAGAAGCTCAAGG - Intronic
1047819639 8:128504449-128504471 AAGCAACTTCCCAGAGCTGAAGG - Intergenic
1056604635 9:88076614-88076636 GAGCTTCTGCCAGGGGCAGAAGG - Intergenic
1056789614 9:89617127-89617149 CACCTTCTTCTCAGAGCTGATGG + Intergenic
1057903121 9:98964831-98964853 GAGGTTCTTCCCAGCTCTGAAGG + Intronic
1062215994 9:135390219-135390241 GAGCTTCTTCCTGGAGGAGGAGG - Intergenic
1062270214 9:135704802-135704824 GAGCTACTTCCTGCTGCTGAAGG - Intronic
1062321016 9:135990612-135990634 GAGCTGCTTCGTGGAGCAGACGG + Intergenic
1186486045 X:9935212-9935234 GAGCTTCTCCCGGGAGCCGGGGG + Intronic
1186590369 X:10924424-10924446 AAGGTTCTTCCCTGAGCTGGTGG + Intergenic
1186590543 X:10925572-10925594 AAGGTTCTTCCCTGAGCTGGTGG - Intergenic
1189295633 X:39915561-39915583 GAGCTCCTTGTCGGAGCTCAGGG - Intergenic
1194664524 X:96663008-96663030 GAGCTTCTCCCAGCAGCTCAGGG + Intergenic
1194847785 X:98833030-98833052 GTGTTGCTTCCAGGAGCTGAGGG + Intergenic
1195321416 X:103724670-103724692 GAACTCCTTCCCTGAGCTGCAGG + Intronic
1197819334 X:130529612-130529634 GAGCTATTTCCCAGGGCTGATGG - Intergenic
1198282307 X:135154187-135154209 GAGTTTCTTTCCAGAGCTGCTGG - Intergenic
1198284593 X:135177160-135177182 GAGATTCTTTCCAGAGCTGCTGG - Intergenic
1198288652 X:135218335-135218357 GAGTTTCTTTCCAGAGCTGCTGG + Intergenic
1198666799 X:139033110-139033132 GAGTTTCCTCACAGAGCTGAGGG - Intronic