ID: 948829199

View in Genome Browser
Species Human (GRCh38)
Location 2:240589533-240589555
Sequence AAGGCCTCCTGGTACTCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 154}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948829199_948829202 4 Left 948829199 2:240589533-240589555 CCTGCTGAGTACCAGGAGGCCTT 0: 1
1: 0
2: 1
3: 16
4: 154
Right 948829202 2:240589560-240589582 AAGCAGAGCTGTGCCGCAGCCGG 0: 1
1: 0
2: 0
3: 22
4: 173
948829199_948829204 21 Left 948829199 2:240589533-240589555 CCTGCTGAGTACCAGGAGGCCTT 0: 1
1: 0
2: 1
3: 16
4: 154
Right 948829204 2:240589577-240589599 AGCCGGATCTCCTGCTGTGTTGG 0: 1
1: 0
2: 0
3: 6
4: 114
948829199_948829207 23 Left 948829199 2:240589533-240589555 CCTGCTGAGTACCAGGAGGCCTT 0: 1
1: 0
2: 1
3: 16
4: 154
Right 948829207 2:240589579-240589601 CCGGATCTCCTGCTGTGTTGGGG 0: 1
1: 0
2: 0
3: 10
4: 100
948829199_948829208 24 Left 948829199 2:240589533-240589555 CCTGCTGAGTACCAGGAGGCCTT 0: 1
1: 0
2: 1
3: 16
4: 154
Right 948829208 2:240589580-240589602 CGGATCTCCTGCTGTGTTGGGGG 0: 1
1: 0
2: 0
3: 9
4: 107
948829199_948829205 22 Left 948829199 2:240589533-240589555 CCTGCTGAGTACCAGGAGGCCTT 0: 1
1: 0
2: 1
3: 16
4: 154
Right 948829205 2:240589578-240589600 GCCGGATCTCCTGCTGTGTTGGG 0: 1
1: 0
2: 1
3: 4
4: 110
948829199_948829209 28 Left 948829199 2:240589533-240589555 CCTGCTGAGTACCAGGAGGCCTT 0: 1
1: 0
2: 1
3: 16
4: 154
Right 948829209 2:240589584-240589606 TCTCCTGCTGTGTTGGGGGAAGG 0: 1
1: 1
2: 4
3: 40
4: 428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948829199 Original CRISPR AAGGCCTCCTGGTACTCAGC AGG (reversed) Intronic
900624393 1:3601512-3601534 CAGCCCTCCTGGTACTGGGCCGG + Intronic
901654569 1:10762060-10762082 AAGGCCTCCGGGGACTCTGAGGG - Intronic
906639186 1:47431496-47431518 AAGGCCTCAGGCTACTGAGCAGG + Intergenic
907241644 1:53084333-53084355 AAGGCCTTCTGGCACCCCGCTGG + Intronic
907288206 1:53395722-53395744 GAGGCTTCCTGGAGCTCAGCTGG - Intergenic
907497064 1:54852228-54852250 AAGGCCGCCAGGCACTGAGCTGG - Exonic
911253566 1:95608078-95608100 AAGGCCCTCTGGTATTCAGAGGG + Intergenic
918125871 1:181583001-181583023 AAGGCCTCCTGCTATTCTGATGG + Intronic
920340593 1:205272936-205272958 GACCTCTCCTGGTACTCAGCAGG - Exonic
922563942 1:226589128-226589150 AAAGCCTCTTGGAACTCAGTGGG - Intronic
923005118 1:230043274-230043296 ATTGCCTCCTGGCACTTAGCTGG + Intergenic
923016166 1:230128144-230128166 AAGGCCTCTTAGTACTCTTCTGG + Intronic
923016467 1:230130425-230130447 AAGGACTCCCTGTGCTCAGCCGG + Intronic
1062798830 10:364448-364470 ATGGCCTCATGGTGGTCAGCGGG - Exonic
1063889526 10:10615363-10615385 GTGGCCTCCTGGACCTCAGCGGG - Intergenic
1063909797 10:10818214-10818236 AAGGCCTCCAGGAACTCCTCTGG + Intergenic
1065407223 10:25382644-25382666 AAGGCCTCCTGGTAATCATAGGG - Intronic
1065655827 10:27948850-27948872 AATGCCTCCTGGTCATCAGAAGG - Intronic
1067220903 10:44343637-44343659 AAAGCCTCCAGCTACTCAGGAGG - Intergenic
1073870121 10:107853699-107853721 GAGGCTTCCTGGTGCTCAGATGG - Intergenic
1077723242 11:4647973-4647995 AAGGCCACCTGGAAGTCATCTGG + Intronic
1078265820 11:9755837-9755859 AAGTCCTGCTGGACCTCAGCTGG - Intergenic
1078318409 11:10310709-10310731 AAGGCCTTCTCCTTCTCAGCTGG - Intronic
1078720758 11:13881190-13881212 AAGGCCTTCAGGTAAGCAGCTGG + Intergenic
1078849115 11:15148041-15148063 AAGGCCTCCAGGAGCACAGCAGG + Intronic
1083048023 11:59754145-59754167 AAGCCCTCCTGGTACTAAGGCGG + Intronic
1083176003 11:60950975-60950997 CAGGCCTCCTGCCACTCACCTGG + Exonic
1086477301 11:87191078-87191100 AAGGCCTCCTTGCAACCAGCCGG - Intronic
1086889209 11:92237013-92237035 AATGCCTGCTGCTACCCAGCAGG - Intergenic
1088178803 11:107085470-107085492 AAAGCCTGCTGGTACTCTGTAGG + Intergenic
1088992229 11:114963647-114963669 AAGTCCTCCTGTTACTCAGTAGG - Intergenic
1089339533 11:117748180-117748202 AAGAACACCTGGTACTTAGCAGG + Intronic
1091321525 11:134655635-134655657 AAGGCGACTTGGTGCTCAGCAGG - Intergenic
1091358666 11:134957594-134957616 AAGGACCCCTGGTTCTTAGCAGG - Intergenic
1092096055 12:5842757-5842779 AAGGCCTCCACGTAGTCAACCGG + Intronic
1093458551 12:19387736-19387758 AATGCCTCTGGGTACTCACCAGG - Intergenic
1096542104 12:52313701-52313723 AAGGCTGCCAGGTACTCAGGAGG + Intergenic
1103516187 12:121509844-121509866 AGGGCCTCCTGGTCCTCAGAGGG + Exonic
1104768922 12:131348268-131348290 ACGGCCTCCTGGCCCTCAGGGGG - Intergenic
1104810831 12:131619380-131619402 ACGGCCTCCTGGCCCTCAGGGGG + Intergenic
1105775125 13:23652868-23652890 AAGGGTTCCTGGCACACAGCTGG - Intronic
1106592739 13:31111099-31111121 AAGGGCACCTGGTGCCCAGCTGG - Intergenic
1108423064 13:50270610-50270632 AAGGTGTCCTGGGCCTCAGCTGG - Intronic
1108727863 13:53201427-53201449 AGGGCCTCCTGGTGCACAGCGGG - Intergenic
1113343839 13:109454115-109454137 AAGACCTCCTGTCACTAAGCCGG - Intergenic
1113840357 13:113355830-113355852 CCGGCCTCCTTGTACTCAGCTGG - Intronic
1117913720 14:60656756-60656778 AAGCCCTCCTGGAAGCCAGCAGG + Intronic
1119371606 14:74150032-74150054 AAAGCCTCCTATTTCTCAGCAGG - Intronic
1121187633 14:91989958-91989980 AAGGCAGGCTGGAACTCAGCAGG - Intronic
1121779455 14:96613063-96613085 AAGCCCACCTGAAACTCAGCAGG - Intergenic
1123017456 14:105382187-105382209 GAGGGCTCCTGCTACACAGCAGG + Intronic
1124387577 15:29223302-29223324 AAGTCCTCCTGGTTCTGGGCTGG + Intronic
1126351055 15:47745198-47745220 CAGGCTTCCTGGTACTCACCTGG + Intronic
1127700580 15:61496331-61496353 TATGCCTCCTGGGACTCACCTGG - Intergenic
1128641245 15:69339399-69339421 AAGGCCGCCAGGTACCCAGACGG - Intronic
1128765814 15:70250573-70250595 AAGGCCTCCTAGGTCTCACCCGG + Intergenic
1129262975 15:74379160-74379182 AAGGCCTCCGTCTACACAGCAGG + Intergenic
1131507664 15:93031443-93031465 AAGACCACCAGGTGCTCAGCGGG - Intergenic
1131646281 15:94348530-94348552 AACGTCTCCTGGTTCTCACCTGG - Intronic
1133435167 16:5772975-5772997 AAGGCTTCCTGGAACACACCAGG - Intergenic
1134022488 16:10930701-10930723 AAGGTCTCATGGCACTTAGCAGG - Exonic
1134623149 16:15705067-15705089 AAGGACTGCTGGAACTCAGGAGG - Intronic
1138224158 16:55278226-55278248 AAGGCCTCCTGATATGCAGTAGG + Intergenic
1139233222 16:65307478-65307500 TATGCCTTCTTGTACTCAGCAGG - Intergenic
1140314602 16:73882940-73882962 AAGGCCCACTGGTAGACAGCAGG - Intergenic
1140960633 16:79908851-79908873 AAGCCCTCCTGGGCCTCATCTGG - Intergenic
1141681227 16:85545123-85545145 AACGCCTCCTGGGACGCAGACGG - Intergenic
1142068641 16:88077024-88077046 AAGGGCTCCTGCTACTCCCCTGG - Exonic
1142288106 16:89179646-89179668 AAGGTCTCCTGGGAGCCAGCGGG + Intronic
1142715485 17:1745009-1745031 GGGGGCTCCTGGTGCTCAGCTGG + Exonic
1143259544 17:5587858-5587880 AAGGCCTCACTGTACTCTGCTGG - Intronic
1143922304 17:10340131-10340153 AAGATCTGCTGGTACTCACCAGG + Exonic
1144772726 17:17768920-17768942 CAGGCCACCTGGTATTCAGAAGG + Intronic
1145413201 17:22692238-22692260 AGGGGCTCCTGCTTCTCAGCAGG - Intergenic
1146547834 17:33754407-33754429 AAGGCCTCCTAGCTCTAAGCAGG + Intronic
1148739408 17:49883971-49883993 AAGCCCTCCTGGTTTTCACCAGG + Intergenic
1150197339 17:63314020-63314042 AAGGCCTCCTGCTACGCCACGGG - Intronic
1151980484 17:77505526-77505548 AAGGTCTCCTGGAGCTCAGAAGG + Intergenic
1152383411 17:79954389-79954411 AAGGCCACCTGCCACTCACCAGG - Intronic
1152727836 17:81956428-81956450 TAGGCCCCCTGGCACACAGCCGG + Intronic
1153539719 18:6140516-6140538 ATGGGCTCCTGGTCCTCAGCAGG - Intronic
1153619179 18:6960930-6960952 AATGCCACCTTGTACTCTGCAGG - Intronic
1157305961 18:46518014-46518036 AAGGCCTCATGGTCTGCAGCGGG + Intronic
1158277142 18:55780563-55780585 CAGGCCGCCGGCTACTCAGCTGG + Intergenic
1159130107 18:64271743-64271765 AAGGACTCAAGTTACTCAGCTGG - Intergenic
1160965121 19:1744062-1744084 CAGGCCTCCTGGGAGCCAGCTGG - Intergenic
1161729500 19:5950572-5950594 AAGGCTGCCTGGTGCTCAGGCGG + Intronic
1163398120 19:17075871-17075893 GAGGCTGCCTGGTACTCACCTGG - Exonic
1163755792 19:19105546-19105568 AAGGCCTCCTGGAGATAAGCGGG - Exonic
1166008487 19:39924364-39924386 AAAGCCCCCAGGTACTCACCAGG + Exonic
1166633810 19:44431748-44431770 TAGGCCTCATGGTTCTCACCTGG + Intronic
1166976526 19:46608190-46608212 AAGGCCTCCTTGAACTCTGGGGG - Exonic
1167150088 19:47703376-47703398 AACGGGGCCTGGTACTCAGCAGG - Intergenic
1168101660 19:54144668-54144690 GAGGCCTCCTGGCACCCAGAGGG + Intronic
926079271 2:9970887-9970909 AAAGCTTCTTGGTACTTAGCTGG - Intronic
928221344 2:29405827-29405849 ATGCCCTTCTGGTACTTAGCAGG + Intronic
928404705 2:31005741-31005763 AATGCTTCCTGGGACTCAGCAGG + Intronic
929660313 2:43777751-43777773 AGGGCCTTCTGGGACTCATCTGG - Intronic
931683251 2:64770025-64770047 AAGGGCTCCTGATACAGAGCTGG - Intergenic
933870161 2:86558248-86558270 AAGGCATCCTCATCCTCAGCAGG + Intronic
935124760 2:100213759-100213781 GAGGCCTCTTGGACCTCAGCAGG + Intergenic
937378548 2:121354869-121354891 AAGGCCTCCTGGTGCTCTTCGGG + Intronic
938097943 2:128475509-128475531 CAGGCCTCCTGGTACACAGTTGG + Intergenic
938382289 2:130843442-130843464 AAGGCCTGCTGGCAGACAGCTGG - Intronic
939858605 2:147391054-147391076 AAAGCCTCAGGGTACCCAGCTGG - Intergenic
944128229 2:196318307-196318329 TAGGCCTCCTGTTTCTGAGCGGG - Intronic
944370145 2:198973407-198973429 CAGGCTGCCTGGTACACAGCTGG + Intergenic
945942910 2:215967642-215967664 AAGGCCACTTGGTGCTCAGTAGG - Intronic
947777326 2:232723852-232723874 AAAGCCTCCAGCTACTCAGGAGG - Intronic
948496409 2:238352553-238352575 CAGGCCTCCTGGTCCACACCTGG - Intronic
948805607 2:240452517-240452539 AGGGGCTCCTGGGTCTCAGCAGG - Intronic
948829199 2:240589533-240589555 AAGGCCTCCTGGTACTCAGCAGG - Intronic
1172405691 20:34687260-34687282 ACGGCCTCCTGGTCCTGGGCTGG + Intergenic
1173866268 20:46314322-46314344 CAGCCCTCCTGGTGCTCAGCAGG - Intergenic
1175284909 20:57831462-57831484 AAGGCCAGCTGCTCCTCAGCTGG - Intergenic
1175634272 20:60567453-60567475 AGGGCCTCCTGCTTCCCAGCTGG + Intergenic
1175961672 20:62640424-62640446 AAGGCCTCCTGGTGCTCCTAGGG + Intergenic
1176002539 20:62839484-62839506 AAGGCCTCCTGGTTTTGAGAAGG - Intronic
1180581673 22:16844719-16844741 GGGGCCTCCTGGTGCCCAGCAGG + Intergenic
1181168211 22:20994426-20994448 AAGGCCTCGGGGGACTCAGATGG - Intronic
1183293798 22:37018614-37018636 GACGCGTCCTGGTACTCACCAGG - Exonic
1183520746 22:38294882-38294904 AAGGGCTCTTGGTACACAGAGGG - Intronic
1184471494 22:44698604-44698626 AAGGCCTCCAGGTGCCCACCGGG - Intronic
1184956707 22:47892058-47892080 AATGGCTCCTGCTTCTCAGCAGG - Intergenic
1185019726 22:48367109-48367131 AGGGCTTCCTGGTTCACAGCTGG + Intergenic
949133837 3:538005-538027 AAGGCCTCATGGCAGGCAGCAGG - Intergenic
950407840 3:12815791-12815813 AAAGCCTCCTGGTAGTGGGCAGG + Intronic
952102715 3:30033650-30033672 AATGCCTTCTGGGACTCGGCAGG + Intergenic
955444904 3:58999404-58999426 AAGGTCTCCTGTTACTCAGTGGG - Intronic
955947158 3:64206463-64206485 AGGCCCTCCTGCCACTCAGCTGG + Intronic
959641520 3:108642955-108642977 AAGGCCTCCAGGTTCTGGGCAGG - Intronic
960090356 3:113632436-113632458 AAGGCACCCTGGTACTAGGCAGG + Intergenic
962874280 3:139523916-139523938 CAGGCATCGTGGTGCTCAGCAGG - Intronic
966616609 3:181920014-181920036 GAGGCCTCCTTGAACTCAGGAGG + Intergenic
968578353 4:1378236-1378258 AAGCCGTCCTGGTACACAGAGGG + Intronic
971300107 4:25434929-25434951 CAGGCCTGCTGGAACTCTGCAGG + Intergenic
973654253 4:53029367-53029389 AAGGCCTTCTGGTAAACAGGTGG + Intronic
975670472 4:76775118-76775140 AAGGACTTCGGGGACTCAGCGGG - Intronic
977282306 4:95056513-95056535 CAGGCCTCATGGGACCCAGCAGG + Intronic
979301981 4:119096652-119096674 AAGGCCTCCTGGTACATAGTAGG + Intergenic
980801927 4:137762843-137762865 GATGAGTCCTGGTACTCAGCAGG - Intergenic
982173203 4:152681489-152681511 AAGACCTGCTGGTACTGAGTTGG + Intergenic
987063901 5:14269149-14269171 AGGACCTCATGGTCCTCAGCCGG + Intronic
987295625 5:16548274-16548296 TAGGCCTCCTGGTTATCAGCAGG + Intronic
989104490 5:37848411-37848433 ACAGCCTCCTGGTAGTCACCTGG - Intergenic
992116258 5:73540979-73541001 AAGGACTCCTGGTGCTCAGGTGG + Intergenic
1000073573 5:157763857-157763879 AAGGCCTCCTAGCACTCACTTGG - Intergenic
1007232218 6:40356243-40356265 ATGGCCTCCTGTTACCCTGCAGG + Intergenic
1012866256 6:104621999-104622021 AAGGCATCCTTACACTCAGCAGG + Intergenic
1014479423 6:121917455-121917477 AAGGCCACCAGGTACTCACTGGG + Intergenic
1018006113 6:159623757-159623779 ATGTCTTCCTGGTACTCAACTGG - Intergenic
1022419776 7:30209585-30209607 AGGGCCTCCTGGAAATCAACTGG + Intergenic
1022537543 7:31107243-31107265 CAGGCCTCCTGGCACTCGCCTGG + Exonic
1028085326 7:86629433-86629455 AAGCCCTCTTGGTCCTCGGCTGG - Intergenic
1029261068 7:99303235-99303257 CAGGCAGCCTGGTCCTCAGCAGG - Intergenic
1030328963 7:108252573-108252595 AAGGCCTGTTAATACTCAGCAGG + Intronic
1033490873 7:141842298-141842320 AAGGACACCTGCTCCTCAGCTGG - Intergenic
1034265768 7:149779966-149779988 CAGGCCTCGTGGTACTCAGCAGG - Intergenic
1036225701 8:6955798-6955820 CAGGCCCACTGGTACCCAGCAGG - Intergenic
1036642556 8:10593272-10593294 AAGGTCTCCTGGTCCCCACCCGG - Intergenic
1040030252 8:42817350-42817372 CAGGACTCCTGGTTGTCAGCTGG - Intergenic
1045189557 8:99869331-99869353 GAGGCATCCTGCTCCTCAGCAGG + Intronic
1048052944 8:130836565-130836587 AAGGCCTCCTGAAATTCAACAGG + Intronic
1048878633 8:138855915-138855937 AAGGCCTCCTCTTCCACAGCAGG - Intronic
1056731381 9:89169255-89169277 CAGGCCTCCTAGTCCTCAGGTGG - Intronic
1059335850 9:113567927-113567949 AAGGCCCCCAGGGACCCAGCTGG - Intronic
1060970495 9:127734938-127734960 AGGGCCTCCTGGACCTCAACGGG + Intronic
1061415232 9:130443999-130444021 GAGGACTCCCGGTCCTCAGCCGG - Intergenic
1061583744 9:131553819-131553841 GAGGCCCTCTGGTGCTCAGCTGG + Intergenic
1062031693 9:134364798-134364820 AGGGCTGCCTGGGACTCAGCTGG + Intronic
1203778128 EBV:85416-85438 AAGGGCTCCTGCTGGTCAGCAGG + Intergenic
1198651988 X:138873198-138873220 CAGGTCTCCTGGTACTGATCTGG - Intronic