ID: 948830208

View in Genome Browser
Species Human (GRCh38)
Location 2:240594926-240594948
Sequence GCTGCTGCTTAGACCCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 212}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948830208 Original CRISPR GCTGCTGCTTAGACCCTGCC AGG Intronic
900210948 1:1455635-1455657 GCGACTGCTTGGACCGTGCCGGG + Intronic
900325183 1:2105242-2105264 GCAGCTGGTTTGTCCCTGCCTGG + Intronic
900704494 1:4071856-4071878 GCTGCTGCTGAGCCACTTCCAGG + Intergenic
900747175 1:4368401-4368423 GCTGCTGCTTATAAGTTGCCAGG - Intergenic
901053389 1:6437204-6437226 CCTGCTGCTCAGATCCTGCTTGG + Intronic
901204403 1:7485587-7485609 TCTGCTGCTGGGACCCTGCCAGG + Intronic
902181182 1:14689749-14689771 GGGGCTGCTTAGACCCTGGCAGG + Intronic
902527173 1:17066713-17066735 GCTGCTTCATAGACACGGCCTGG - Intergenic
905621818 1:39454911-39454933 GGTGCTGCTTAGCCCATGTCAGG - Exonic
905905156 1:41612975-41612997 GGTGCTGCATTCACCCTGCCAGG - Intronic
905964659 1:42081666-42081688 GCTACTGCCAACACCCTGCCGGG - Intergenic
909958387 1:81803676-81803698 GCTGCAGCTCAGACGCTCCCAGG - Intronic
910934439 1:92476002-92476024 GCTGCTGCTTGCAGCCAGCCAGG + Exonic
913220959 1:116660023-116660045 ACTGCTGCTGAGCCCCAGCCTGG - Intronic
915306580 1:154983260-154983282 GCTGTCGCTTAGACTCTTCCAGG - Intergenic
917121985 1:171652533-171652555 GCTGCTGCTTCTGGCCTGCCTGG - Exonic
917217454 1:172692693-172692715 GCTGCCGCTTGGCCCCTGTCAGG + Intergenic
917671855 1:177280792-177280814 GCAGCTGGTTTGACCCTTCCTGG + Exonic
918111191 1:181456708-181456730 TCTGCTGCTTAGTGCCTTCCTGG - Intronic
918149458 1:181785504-181785526 GCTGCTTCTAAGTCCTTGCCGGG - Intronic
922576616 1:226665164-226665186 GCTGCTGCTCAGCCCCAGGCAGG - Intronic
922911506 1:229221556-229221578 CCTGCTGCTGTGACCCTGCATGG - Intergenic
923456322 1:234168632-234168654 TCTGCTGCTGAGTGCCTGCCAGG + Intronic
924440157 1:244079239-244079261 GCTGGGGCTTAGACCCTGGTGGG + Intergenic
1063084236 10:2800517-2800539 TCTGCTGCATAGCCCCTGGCAGG - Intergenic
1069621961 10:69842867-69842889 GCTGCTGCTGGGTCACTGCCGGG - Intronic
1069957971 10:72063178-72063200 GCCCCTGCTCTGACCCTGCCTGG - Intronic
1070761834 10:79028753-79028775 GCTGCTGCCTCTACCCTGCCAGG + Intergenic
1074054567 10:109910926-109910948 GCTGTAGCTTAAACCCTGCTGGG + Intronic
1074663515 10:115690751-115690773 GCTGCTGCTTAGGTCTTGGCAGG + Intronic
1075709113 10:124521299-124521321 GCTGCTCCATAGAGCCTGGCTGG - Intronic
1075777291 10:124997086-124997108 GCTGCTGCTCAGCCCTTGCTTGG - Intronic
1075962932 10:126584989-126585011 TCTCCTGCTTAGACTCTGCAGGG - Intronic
1076624911 10:131815862-131815884 GCTGCTGCCTGGACCCCTCCTGG - Intergenic
1076730850 10:132438236-132438258 GCTGCAGCTTCCTCCCTGCCCGG + Intergenic
1077182295 11:1222246-1222268 GCTGCTTCCTCAACCCTGCCAGG + Intergenic
1077364636 11:2156552-2156574 GCAGCTGCTCAGACCCTGGGTGG + Intronic
1083264248 11:61538900-61538922 GTAGCTCCTTAGACCCTACCTGG - Intronic
1083402499 11:62433670-62433692 GCTGCTGCATAAGCCCTGCTTGG - Intronic
1083865957 11:65453097-65453119 GCTTCTGCTTGGCCCCTACCTGG - Intergenic
1083961357 11:66016583-66016605 GCTGCTGCTAATGCCCTGCTGGG + Intergenic
1084642101 11:70432153-70432175 CCTGCTGCCTTTACCCTGCCGGG + Intronic
1085021615 11:73213582-73213604 GCTGCCTCCTAGACCCTACCTGG - Intergenic
1088885004 11:113999356-113999378 GCTGCTGCTTAGATATGGCCTGG - Intergenic
1089554435 11:119308299-119308321 GCTCCTGCTAACAGCCTGCCAGG + Intergenic
1090403853 11:126465790-126465812 GCTGCTGCTCCCTCCCTGCCCGG - Intronic
1091932504 12:4407476-4407498 GCTGCTCCTTCTCCCCTGCCTGG + Intergenic
1092081876 12:5723294-5723316 GCTGCTGCTTGGAGGCTGCTAGG + Intronic
1092526912 12:9315087-9315109 GCTGCTGCTGTCATCCTGCCCGG + Intergenic
1092540362 12:9416693-9416715 GCTGCTGCTGTCATCCTGCCCGG - Intergenic
1096036270 12:48473811-48473833 GCTGGTGCTCAGACCCTTCTGGG - Intergenic
1097802925 12:63934758-63934780 GCAGCAGCTCAGCCCCTGCCTGG + Intronic
1106361941 13:29039053-29039075 GATGCTGGATAGACCCAGCCAGG + Intronic
1106796125 13:33207898-33207920 GCTCCTGCTCCTACCCTGCCTGG + Intronic
1111184906 13:84720752-84720774 CCTGCTGCTTAAACCCTTCAGGG - Intergenic
1111354497 13:87080372-87080394 CCTGCTGCTTAGACCCCCTCTGG - Intergenic
1111814669 13:93136238-93136260 GTTTCTCCATAGACCCTGCCTGG + Intergenic
1112896276 13:104304176-104304198 GCTGGTGATTTGACCCTTCCAGG - Intergenic
1113061901 13:106331336-106331358 GCTGCTGCTCATACCCTGACAGG + Intergenic
1113763665 13:112867529-112867551 GACGCTGCAGAGACCCTGCCAGG - Intronic
1114406761 14:22464028-22464050 GCTGCTGCTGACACCCAGCCAGG - Intergenic
1116937593 14:50758140-50758162 GCTGCTCCGAAGCCCCTGCCTGG + Exonic
1118336614 14:64858691-64858713 GCTGGTGCCTGGACCCTGCCTGG + Intronic
1120230055 14:81832285-81832307 CCTGCTGCTTAAATCCTGTCTGG - Intergenic
1121032115 14:90667124-90667146 GCTGCCACTTAGCCCATGCCAGG + Intronic
1122113044 14:99514920-99514942 GCTGCTTCTGAGATCCAGCCTGG - Exonic
1122301870 14:100735964-100735986 GTTGCTGCTCAGATTCTGCCAGG - Exonic
1123017338 14:105381721-105381743 GCTGCTGCTGTGGCCCTCCCAGG + Intronic
1123946121 15:25239732-25239754 GCTGAAGCTCAGACCCTTCCTGG + Intergenic
1123948216 15:25249098-25249120 GCTGAAGCTCAGACCCTCCCTGG + Intergenic
1124183121 15:27496990-27497012 GGTGCTGCTGAGACCTGGCCTGG - Intronic
1124221619 15:27854393-27854415 GCTCCTTCTCAGACCCTGCAAGG - Intronic
1126704350 15:51393802-51393824 GCTGTTACTTAGACCTTGACTGG + Intronic
1128269152 15:66293620-66293642 GCTGCTGCTGAGGACCTTCCAGG + Exonic
1128615839 15:69108836-69108858 GGTGCTACTCAGAGCCTGCCAGG + Intergenic
1131166645 15:90146593-90146615 GCAGCTGCTTAGAACAAGCCTGG - Intergenic
1131387480 15:92019117-92019139 GTTGCTGCTTTCAGCCTGCCAGG + Intronic
1132119941 15:99167968-99167990 GAAGCTACTTAGACCCTGCTGGG + Intronic
1138390945 16:56669562-56669584 GCTGCTTGTTTCACCCTGCCGGG - Intronic
1140906005 16:79409649-79409671 GTTGCTGTTTATACCATGCCAGG - Intergenic
1141629276 16:85277857-85277879 GCTGCTGCTGGGCCTCTGCCTGG + Intergenic
1141878308 16:86841550-86841572 GATGCTGCTTTGGGCCTGCCTGG + Intergenic
1142427996 16:90010991-90011013 GCTGCTTCCTGGACCCTGCATGG + Intronic
1142975879 17:3643961-3643983 ACTGCAGCTTTGACCCCGCCAGG - Intronic
1143578692 17:7810765-7810787 GCTGATTCTTAGGCTCTGCCAGG - Intronic
1145302678 17:21652261-21652283 CATGCTGCTGAGAACCTGCCTGG - Intergenic
1145347625 17:22050927-22050949 CATGCTGCTGAGAACCTGCCTGG + Intergenic
1146892068 17:36512657-36512679 GGGGCTGCTCAGACACTGCCAGG - Intronic
1147335468 17:39724829-39724851 GCTGCCTCTTAGACCATGTCCGG + Exonic
1147732043 17:42610042-42610064 GCTCCTGATTGGAACCTGCCCGG + Intronic
1150169655 17:62979833-62979855 ACTGCAGCCTAGACCCTCCCAGG - Intergenic
1150290627 17:63979512-63979534 GTTGGTGCTTTGTCCCTGCCAGG - Intergenic
1152286763 17:79417087-79417109 GCTGCCCCTTCCACCCTGCCAGG - Intronic
1155014384 18:21818304-21818326 GCTGCTCATTAGAACCTGCTGGG - Intronic
1155320871 18:24617683-24617705 GCTGTGGCTGAGACCCAGCCAGG - Intergenic
1157675130 18:49562897-49562919 GCTTGTGCTTAGAAGCTGCCGGG + Intronic
1158471229 18:57738824-57738846 TCTCCTGCTTACACCCTTCCTGG + Intronic
1158587472 18:58754219-58754241 GCTGCTGCTTATACCGTAACGGG + Intergenic
1160507875 18:79437356-79437378 GCTGCTGGTCACTCCCTGCCTGG - Intronic
1160520944 18:79507589-79507611 GCGCCTGCTGAGACACTGCCAGG - Intronic
1160914704 19:1491028-1491050 GCCGCTGCCCAGACCCCGCCGGG - Exonic
1163193587 19:15697515-15697537 GGTGCAGCTTATACCCTGGCAGG + Intergenic
1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG + Intergenic
1165481570 19:36067600-36067622 GCTGATGCACAGGCCCTGCCAGG + Intronic
1167230651 19:48280847-48280869 GCTACTCCTTAAACCCTGGCCGG - Intronic
926715616 2:15921559-15921581 GCTGGTGCTTAGACCTTAGCAGG - Intergenic
927503262 2:23596213-23596235 CCATCTGCTTTGACCCTGCCAGG + Intronic
931349073 2:61471630-61471652 GCTACGGCGTAGACCCGGCCCGG - Intergenic
931681333 2:64751655-64751677 GCTGCTGCTCAGACTCTGCCTGG + Intergenic
931959007 2:67460943-67460965 GCTGCTGCTTCTCCCCTGCTTGG - Intergenic
932261392 2:70330627-70330649 ACTGCTGCTTAGGGCCAGCCTGG + Intergenic
932566854 2:72916227-72916249 GCCGCTGCCAAGACCCGGCCTGG + Intergenic
933951981 2:87338819-87338841 GCTGCTGCTAACACTCTGACTGG - Intergenic
934134082 2:88978660-88978682 GCTGCTGCTAACACTCTGACTGG + Intergenic
934150385 2:89142766-89142788 GCTGCTGCTAACACTCTGACTGG + Intergenic
934216909 2:90039265-90039287 GCTGCTGCTAACACTCTGACTGG - Intergenic
934236223 2:90235154-90235176 GCTGCTGCTAACACTCTGACTGG - Intergenic
935775442 2:106467612-106467634 GCGGCTGCCTCGACCCGGCCCGG - Intronic
937242817 2:120473577-120473599 GCAACTGCTTAAATCCTGCCAGG + Intergenic
937290951 2:120781371-120781393 GCTGCTGCTCTGACCCCGGCAGG - Intronic
942150996 2:173075973-173075995 GCTGCTGCTCACGCCCCGCCCGG + Exonic
943046476 2:182867100-182867122 GCTGCGGCTGCGACCCTGGCTGG + Exonic
948335903 2:237206948-237206970 GCTGATGCCTGGGCCCTGCCTGG + Intergenic
948756781 2:240164753-240164775 GCTGTAGCTGAGACCATGCCTGG - Intergenic
948830208 2:240594926-240594948 GCTGCTGCTTAGACCCTGCCAGG + Intronic
948978854 2:241482342-241482364 GCTGCTGCTTAGCCAGTGCTGGG + Intronic
1168773921 20:433044-433066 GCTGGGGCTGAGACCCAGCCTGG - Intergenic
1170778432 20:19401617-19401639 GCTGCTGTCAGGACCCTGCCTGG + Intronic
1171294877 20:24008664-24008686 GCTGCTGCATCAAGCCTGCCTGG - Intergenic
1171519273 20:25763792-25763814 CATGCTGCTGAGAACCTGCCTGG - Intronic
1171557653 20:26092699-26092721 CATGCTGCTGAGAACCTGCCTGG + Intergenic
1172303572 20:33865983-33866005 GCTGGTGCCTAGACCCTCTCTGG + Intergenic
1172505000 20:35455161-35455183 GCCGCTGCTAAGGCCCTGCGGGG - Intronic
1174056648 20:47802834-47802856 GCTGGTGCCTAGAGCATGCCTGG - Intergenic
1174830250 20:53805685-53805707 GCTGCTGCTCAGGCCTGGCCTGG + Intergenic
1175902204 20:62364434-62364456 GCACCTGCTCAGTCCCTGCCTGG + Intronic
1177418361 21:20824328-20824350 ACTGCAGCTTCAACCCTGCCTGG + Intergenic
1179138029 21:38697745-38697767 GTTGGTGCTTAGACCATGCCAGG + Intergenic
1180822484 22:18840229-18840251 ACTGCTGCTGAGCCCCAGCCTGG - Intergenic
1181190482 22:21135797-21135819 ACTGCTGCTGAGCCCCAGCCTGG + Intergenic
1181208722 22:21274724-21274746 ACTGCTGCTGAGCCCCAGCCTGG - Intergenic
1181689214 22:24549081-24549103 CCTCCTGCCTAGACCCTGCAGGG + Intronic
1182098792 22:27643500-27643522 GCTGCCTCTCAGACCCTTCCTGG - Intergenic
1183476710 22:38039596-38039618 GCAGCTGCGTACAACCTGCCAGG - Intronic
1184567184 22:45299059-45299081 GCTGTTGCTCAGCCTCTGCCGGG + Intergenic
1185333581 22:50261974-50261996 GCTCCTGCTGAGACCCCCCCAGG - Intergenic
1203218216 22_KI270731v1_random:20721-20743 ACTGCTGCTGAGCCCCAGCCTGG + Intergenic
1203272623 22_KI270734v1_random:66134-66156 ACTGCTGCTGAGCCCCAGCCTGG - Intergenic
953355361 3:42251769-42251791 GATGCTGTTGAGACCCTGTCAGG + Intergenic
954121301 3:48501642-48501664 TCTGCAGTTTAGACCCTGCTTGG - Intronic
954372783 3:50177372-50177394 GCTGCTCCTGAGACCCCGGCAGG - Intronic
958158599 3:89787709-89787731 GCTGCTGCTCAGCTCCAGCCTGG + Intergenic
959837178 3:110932935-110932957 GATGCTGCTGAAACCCTGCTGGG - Intergenic
962272966 3:133991703-133991725 GCTGGGCCTGAGACCCTGCCTGG + Intronic
964380958 3:156098709-156098731 TCTGGTGCTTAGAACTTGCCAGG + Intronic
968508294 4:982512-982534 GCTGCTGCTCCACCCCTGCCCGG + Intronic
968562253 4:1290162-1290184 GCGGCGGCTTTGGCCCTGCCAGG + Intronic
968635031 4:1673806-1673828 GCTGCTGCCTTGACACTGCTGGG - Intronic
968669754 4:1842781-1842803 TCTGCAGCATAGACCATGCCTGG + Intronic
971871426 4:32245275-32245297 GTTGCTGCTTAGACTCTGTCAGG + Intergenic
973668256 4:53185528-53185550 GTTGCTGGTAGGACCCTGCCAGG - Intronic
978503437 4:109433473-109433495 GCTGCTGCTCCGGCCCGGCCAGG - Intergenic
980282206 4:130736747-130736769 GATGCTGTTGTGACCCTGCCAGG + Intergenic
981594018 4:146398898-146398920 CCTGCTGCTTACACAGTGCCTGG - Intronic
985655392 5:1129124-1129146 GCTGCTGCCTAGGGCCTGCCAGG + Intergenic
986006914 5:3676382-3676404 GCTTCTGCTTTGAGTCTGCCGGG - Intergenic
986065307 5:4229222-4229244 GCTGCTGCTGTGACCATGGCTGG - Intergenic
986333843 5:6738168-6738190 GCTGCTGAATAGAGCCGGCCAGG - Intronic
989102870 5:37837420-37837442 CCTGCTGCTTTTGCCCTGCCGGG - Intronic
990538832 5:56751885-56751907 GCTTCTCCTCAGAGCCTGCCAGG - Intergenic
992816352 5:80443716-80443738 GCTGCTGCAAAGATCCTGGCAGG + Intronic
995332008 5:110956647-110956669 GGTGCTGTCAAGACCCTGCCAGG + Intergenic
995798215 5:115963049-115963071 GCTGCTGCATAGCCTCTTCCAGG + Exonic
1003405380 6:5823475-5823497 TCTGCTGCTTTGATTCTGCCAGG - Intergenic
1004205826 6:13591490-13591512 GCTGGTACCCAGACCCTGCCTGG + Intronic
1007315000 6:40979948-40979970 GCTGCTGACTAGACACAGCCAGG - Intergenic
1009339728 6:62539121-62539143 GCTGCTGCATAAACCTTTCCAGG + Intergenic
1013442070 6:110180410-110180432 TCTTCTGCGGAGACCCTGCCAGG - Exonic
1013583313 6:111557049-111557071 ACTGCAGCTTTGACCTTGCCGGG - Exonic
1017029220 6:150206103-150206125 GCAGCTTCTTAGACACAGCCTGG + Intronic
1017126086 6:151065861-151065883 GCTGTTGCTCAGACCATACCTGG + Intronic
1018138818 6:160806471-160806493 GCTGCTTCTCAGGCCTTGCCTGG - Intergenic
1018913836 6:168120808-168120830 GCTGCTGTTCAGATCCTGTCTGG + Intergenic
1018972127 6:168536942-168536964 CCTGCTGCCCCGACCCTGCCAGG - Intronic
1018975088 6:168558448-168558470 GCTGCTGCTGGGAGCCTCCCTGG + Intronic
1019352002 7:558782-558804 GCTGATGCTAAGACCTTGGCTGG - Intronic
1022103046 7:27180500-27180522 TCTGCTGCTCTGGCCCTGCCTGG + Intergenic
1022108272 7:27212424-27212446 GCTGCTGGTTAGTCTCTGGCTGG - Intergenic
1024611459 7:51068017-51068039 GCCGCTGCCTAGCCCCAGCCTGG + Intronic
1025236356 7:57237344-57237366 GCTGGTGCCTAGAGCATGCCTGG + Intergenic
1025279755 7:57618735-57618757 CATGCTGCTGAGAACCTGCCTGG - Intergenic
1025304977 7:57846766-57846788 CATGCTGCTGAGAACCTGCCTGG + Intergenic
1025739816 7:64185049-64185071 GATGCTGCTCACATCCTGCCAGG - Intronic
1026278366 7:68900195-68900217 GCTGCTGGTTAGAGCCAGCATGG - Intergenic
1026483311 7:70797166-70797188 GATGCTGATAAGACGCTGCCAGG - Intergenic
1027531308 7:79337363-79337385 TCTGCTGCATTGGCCCTGCCAGG + Intronic
1029199027 7:98826491-98826513 GCTTCTCCGCAGACCCTGCCAGG - Intergenic
1032121513 7:129160410-129160432 GCTGCTGCTTAGCACCAGCCTGG + Intronic
1035467915 7:159091738-159091760 GCTGCGGCTGGGAGCCTGCCTGG + Intronic
1037527416 8:19740352-19740374 GCAGCTGCTTTGAGGCTGCCTGG - Intronic
1037571497 8:20161849-20161871 GCTGCTGGGTAGACTCAGCCCGG - Intronic
1037890210 8:22620092-22620114 GGGGCTGCTTAGCCCCAGCCAGG - Exonic
1038612847 8:29070686-29070708 GCTGCTGGTCAGGCCCAGCCGGG - Exonic
1039093442 8:33857389-33857411 GCTTCTCCTAAGAGCCTGCCAGG - Intergenic
1041510530 8:58650213-58650235 GCTGCTGCCTAGGCCTAGCCTGG - Intronic
1043999728 8:86865155-86865177 GCTGCTGCTCAAACCCTGTGGGG + Intergenic
1044320096 8:90791790-90791812 GCTGCTGCTTCGCCGCCGCCGGG - Exonic
1044779726 8:95731787-95731809 GTTGCTGTTTAGTCCCTGCTTGG - Intergenic
1047374335 8:124281694-124281716 CCAGCTCCTTAGAGCCTGCCTGG - Intergenic
1049172378 8:141169571-141169593 GCTTGTGCTTAGACCCAGCGGGG + Intronic
1049176230 8:141194282-141194304 GCTGCCCCCTAGAGCCTGCCAGG + Exonic
1049381482 8:142318543-142318565 GCTGCTGCGCAGCTCCTGCCCGG - Exonic
1052359564 9:27539610-27539632 GCTCTTGCTCAGACCCTACCAGG - Intergenic
1052826558 9:33180320-33180342 TCTGTTGCTTAGACCCCGGCTGG - Intergenic
1055942641 9:81664962-81664984 TCTACTGCTTAGCACCTGCCAGG + Intronic
1056196569 9:84234915-84234937 GCTGCTGGCCAGACACTGCCAGG - Intergenic
1058014721 9:100017766-100017788 GTAGCTGCTTAGGCCCTACCAGG - Intronic
1058647548 9:107144648-107144670 GCTGCTGCTTAGCCCTTTGCTGG - Intergenic
1060486783 9:124052632-124052654 CCTGCTGCTGTGACCCCGCCAGG - Intergenic
1060593559 9:124834582-124834604 GCTGCTGTCTAGTCCCTGCCTGG - Intergenic
1061887766 9:133601305-133601327 GCTTCAGCAAAGACCCTGCCTGG + Intergenic
1062350083 9:136134198-136134220 GCTGCAGCTTGGACACGGCCTGG + Intergenic
1187621468 X:21061083-21061105 GCTGCAGTTCTGACCCTGCCGGG + Intergenic
1197891650 X:131275530-131275552 GCTGCTGCTACCACCCTGACTGG - Exonic
1200869897 Y:8086460-8086482 TCTGCTACCTAGACCCAGCCAGG - Intergenic