ID: 948832337

View in Genome Browser
Species Human (GRCh38)
Location 2:240604135-240604157
Sequence GCGGCTTGGGGGAGACACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948832324_948832337 14 Left 948832324 2:240604098-240604120 CCTGGGAACACCTGCGGGGAGAA 0: 1
1: 0
2: 1
3: 8
4: 115
Right 948832337 2:240604135-240604157 GCGGCTTGGGGGAGACACCTGGG 0: 1
1: 0
2: 1
3: 7
4: 108
948832319_948832337 21 Left 948832319 2:240604091-240604113 CCATAACCCTGGGAACACCTGCG 0: 1
1: 0
2: 1
3: 6
4: 86
Right 948832337 2:240604135-240604157 GCGGCTTGGGGGAGACACCTGGG 0: 1
1: 0
2: 1
3: 7
4: 108
948832325_948832337 4 Left 948832325 2:240604108-240604130 CCTGCGGGGAGAAGCGCCCTTGG 0: 1
1: 0
2: 0
3: 7
4: 95
Right 948832337 2:240604135-240604157 GCGGCTTGGGGGAGACACCTGGG 0: 1
1: 0
2: 1
3: 7
4: 108
948832323_948832337 15 Left 948832323 2:240604097-240604119 CCCTGGGAACACCTGCGGGGAGA 0: 1
1: 0
2: 0
3: 14
4: 155
Right 948832337 2:240604135-240604157 GCGGCTTGGGGGAGACACCTGGG 0: 1
1: 0
2: 1
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948832337 Original CRISPR GCGGCTTGGGGGAGACACCT GGG Intronic
900305170 1:2003057-2003079 GTGGCATGGGGGAGAGACTTTGG + Intronic
900507033 1:3034888-3034910 CAGGCCTGGGGCAGACACCTGGG - Intergenic
900822407 1:4899682-4899704 GCGGGTAGGGGGTGATACCTGGG - Intergenic
903915719 1:26762968-26762990 GCTGCCTGGGGTAGCCACCTGGG - Exonic
904313731 1:29646408-29646430 CCTGCTTGGTGGTGACACCTTGG - Intergenic
904990352 1:34587765-34587787 GGGGATTGGGTGAGACTCCTGGG - Intergenic
905009289 1:34736351-34736373 GGGGCTTTGGGGAGAAAGCTGGG + Intronic
906297733 1:44659344-44659366 GCTGTTTGGGGGAGAGATCTGGG + Intronic
912262269 1:108121881-108121903 GAGGCTGGGAGGAGGCACCTGGG - Intergenic
914689255 1:150010773-150010795 GCGGGTTGGTGGTGACACCCAGG + Intergenic
915458376 1:156054828-156054850 GCGGCCCGCGGGAGGCACCTCGG + Exonic
919769309 1:201147109-201147131 GCGGCTGGGGGTAGAACCCTGGG - Intronic
922184059 1:223258515-223258537 GGGGCTGGGGGGAGTCACCTGGG + Intronic
923562375 1:235051014-235051036 GGGGCTTGGGGCAGGCCCCTAGG - Intergenic
1072741372 10:97911990-97912012 GCTGGTTGTGGGAGACACCACGG + Intronic
1073289997 10:102408821-102408843 GCGGCTTGTGGGAGGCACCGAGG - Intronic
1076618364 10:131771415-131771437 GGGGCCTGGTGGAGCCACCTGGG - Intergenic
1077215448 11:1393556-1393578 GTGGCGTGGGGGAGGGACCTAGG + Intronic
1077455268 11:2674432-2674454 GAGGCTGGGGGGAGGCACGTGGG + Intronic
1084325919 11:68399974-68399996 GGGGCTTGGGGGAGTGTCCTGGG + Intronic
1090435654 11:126684445-126684467 GAGGCTTTGTGGAGGCACCTTGG - Intronic
1092225364 12:6744940-6744962 GGGGCATGGGGAAGAGACCTTGG - Intergenic
1094350149 12:29515389-29515411 GCTGCTGGGAGGAGACTCCTTGG - Intronic
1096475832 12:51908166-51908188 GCGCCTAGGGTGAGACTCCTAGG - Intronic
1101881422 12:108628644-108628666 CCGGGTTGGGGGAGGCATCTTGG + Intronic
1103988087 12:124780535-124780557 GCAGCTTGGGGTGGGCACCTGGG - Intronic
1113770819 13:112907395-112907417 GTGGCTTGGTGGAGAATCCTCGG + Intronic
1116365544 14:44058252-44058274 GTGAATTGCGGGAGACACCTGGG + Intergenic
1117097335 14:52312286-52312308 GTGGCTTTGGGGAGAGAGCTTGG + Intergenic
1117329027 14:54694566-54694588 GGGGCTCAGGGGAGAAACCTGGG + Intronic
1117397456 14:55325031-55325053 GGGGCCTGTGGGAGACAACTGGG - Intronic
1122151721 14:99729428-99729450 GCTGCATGGGGAAGCCACCTGGG + Intergenic
1123930620 15:25170103-25170125 GCTGCTTGGAGAAGACGCCTGGG + Intergenic
1124399176 15:29333520-29333542 CCGGCTTTGGGGGGACACGTGGG + Intronic
1128982376 15:72197219-72197241 GCGGCTGCGGGGAGGCAGCTCGG - Intronic
1129909012 15:79210758-79210780 GCTGCTTGTTGGAGTCACCTGGG + Intergenic
1131549202 15:93342080-93342102 GAGGCTTGGGGGAGAAACTGAGG + Intergenic
1132674806 16:1117162-1117184 GAGGCTGGGGGGACCCACCTCGG - Intergenic
1132756738 16:1488928-1488950 GCGGCTGGAGGGAGACTGCTGGG - Intronic
1132847349 16:2006660-2006682 GGGGCCTGGGGGAGATGCCTGGG + Intronic
1132945317 16:2528972-2528994 CCTGCTTGGGGGACACAGCTAGG - Exonic
1134455075 16:14389539-14389561 GCTGCATGGGAGAGTCACCTGGG - Intergenic
1135422632 16:22315226-22315248 GGGTCCTGGGGGAAACACCTCGG + Intronic
1135521616 16:23182637-23182659 GCGGCCTGGGGAAAGCACCTGGG + Intergenic
1135594107 16:23728184-23728206 GAGGCTTGAGGGAGGCTCCTGGG + Intergenic
1138330881 16:56214379-56214401 GGGTCTAGGGGCAGACACCTGGG + Intronic
1141648163 16:85378327-85378349 GCGGCTTGGGGCAGCCTCCTGGG + Intergenic
1142425657 16:90000974-90000996 GGGGCTTGCGTGGGACACCTTGG + Intergenic
1143791288 17:9298033-9298055 GCTGTTTGGGGAAGACACTTGGG - Intronic
1144657323 17:17045088-17045110 GGGGCTTGGGGGAGACTGATGGG - Intronic
1146156605 17:30529761-30529783 AAGGGTTGGAGGAGACACCTGGG - Intergenic
1148598252 17:48873918-48873940 GGGGCCTGCAGGAGACACCTTGG - Intergenic
1156291085 18:35748964-35748986 CCAGCTTGGGGGATGCACCTGGG + Intergenic
1160450164 18:78957428-78957450 GAGGCTTGGGGGGGCCACATGGG + Intergenic
1160768812 19:821444-821466 GGGGCCCGGGGGAGACGCCTCGG - Intronic
1160938885 19:1610690-1610712 GCTGCTTGGCAGAGTCACCTGGG + Exonic
1165443374 19:35843607-35843629 GAGGCTTGGGGAAGACACTTGGG + Intronic
1165896573 19:39145230-39145252 GGGCCCTGGGGGAGGCACCTGGG - Intronic
1166343406 19:42151450-42151472 GGGGCTGGGGGGACGCACCTGGG + Intronic
1166801879 19:45462887-45462909 TCTGCTTGGGGGAGACGGCTGGG - Intronic
1167429803 19:49447760-49447782 GCGGTTTGGGGAACACCCCTAGG - Intronic
1167743815 19:51339810-51339832 GCGGAGGGGCGGAGACACCTAGG - Intronic
925768881 2:7263170-7263192 GTGGCTTCTGGGAGACATCTGGG + Intergenic
931431496 2:62212370-62212392 GGGGCTTGGGGTACACACATGGG - Intronic
931763660 2:65436476-65436498 GGGGCTTGGGGGAGACAGCTGGG - Intergenic
934769096 2:96896522-96896544 GCCGCTTAGGGCAGACACCTAGG + Intronic
935151443 2:100440190-100440212 GCGGCTTTGCGGGCACACCTCGG - Intergenic
945789121 2:214281477-214281499 GCGGCTTGGCAGAGACTTCTAGG + Intronic
948374442 2:237512177-237512199 AAGGCCTGGGGGAGACGCCTGGG - Intronic
948494627 2:238339449-238339471 GCGCCTGGGGGGAAACACCCAGG + Intronic
948832337 2:240604135-240604157 GCGGCTTGGGGGAGACACCTGGG + Intronic
1168892101 20:1301243-1301265 GGGGCTCCTGGGAGACACCTGGG - Intronic
1174039063 20:47686377-47686399 GCAGCATGGGGGAGTCTCCTGGG + Intronic
1176274023 20:64253559-64253581 GGGGAATGGTGGAGACACCTTGG + Intergenic
1178615838 21:34132146-34132168 GTGGCCTGGGAGAGACATCTTGG + Intronic
1179024545 21:37668591-37668613 GCAGATTGGGAGATACACCTCGG + Intronic
1180878331 22:19185868-19185890 GCTGCTGGGAGGAGACAGCTGGG - Intronic
1184189990 22:42888043-42888065 GGGGCTGGGGGCAGAGACCTGGG - Intronic
1184796850 22:46737934-46737956 GCGGCTTGGGGGACCCGGCTGGG - Intronic
950501677 3:13367883-13367905 TCCTCTTGGGGGACACACCTGGG + Intronic
954447583 3:50554959-50554981 TCGGCATGAGGGAGACACCAGGG + Intergenic
961522208 3:127473389-127473411 GCCACCTGGTGGAGACACCTGGG + Intergenic
961820650 3:129574083-129574105 GTGGCGTGGAGGAGACACCGAGG - Intronic
962879683 3:139564539-139564561 GCTGCTTGGGTGTGACACTTTGG - Intronic
964570184 3:158102597-158102619 GAGGCTTGGGGGACACACTCGGG - Intronic
968525736 4:1055820-1055842 CCGGCTGGCGGGAGAGACCTGGG + Intergenic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
969498333 4:7539055-7539077 GGGGCCTGGGGGAAACAACTTGG - Intronic
976259683 4:83134120-83134142 GCGACTAGGGGGAAAAACCTTGG - Intronic
978637109 4:110822760-110822782 GAAGCTTGGGGGAGACAGCTGGG + Intergenic
983779180 4:171646091-171646113 GGGGCTTGGGGGCTACAGCTGGG + Intergenic
995571586 5:113487819-113487841 GCGGCTTGGTGGACACCCCAGGG - Intronic
996213802 5:120843321-120843343 GCTGCTTGGGTGAGACAAATAGG - Intergenic
1003030417 6:2596394-2596416 GAGGCATGGGGGAGCCACTTGGG + Intergenic
1006116108 6:31776997-31777019 GGGGCGTGGGGGAGGAACCTTGG - Intronic
1011798783 6:90986174-90986196 GCGCCTTGGGGGTGAAACATAGG - Intergenic
1013516730 6:110894270-110894292 GGGTCTTGGGGGAGACACCAGGG - Exonic
1013554798 6:111245356-111245378 GTCACTTGGGGCAGACACCTTGG - Intergenic
1014525452 6:122496020-122496042 GGGGGTTGGGGGACACAGCTGGG - Intronic
1018861499 6:167713450-167713472 GAGGCTGGTGGAAGACACCTGGG + Intergenic
1025106253 7:56174404-56174426 GCGTGTTGGGGGAGGCGCCTGGG + Intergenic
1025723701 7:64038427-64038449 GCTGCTTGGGCTACACACCTGGG + Intronic
1034337988 7:150335673-150335695 CCGGCCTGGGTGAGACTCCTGGG + Intronic
1034559241 7:151869509-151869531 GTGCCTTGCGGGAGTCACCTTGG - Intronic
1035610750 8:962504-962526 GCGCCTTGAGGGAGCCTCCTGGG + Intergenic
1035778552 8:2209245-2209267 TTGGCTTGTGGGACACACCTGGG + Intergenic
1036171457 8:6489349-6489371 GCAACCTGGGGGAGACACCAGGG + Intronic
1039617158 8:38965229-38965251 GAGGCTGGGTGAAGACACCTGGG + Intronic
1048414424 8:134210426-134210448 GGCGCTTTGGGGAGACAGCTGGG - Intergenic
1058566415 9:106289966-106289988 GCTCCTGGGGGGAGACTCCTGGG + Intergenic
1061458165 9:130713583-130713605 GAGGCTCGCGGGAGCCACCTTGG - Intergenic
1061541171 9:131278385-131278407 GTGGCTTGGTGGAGACAGCGCGG + Intergenic
1061644383 9:131988652-131988674 GGGGATTGGGGGAGAGACCAGGG + Intronic
1061675316 9:132212287-132212309 GCGGCTTAGGGGTGACACGGTGG - Intronic
1061790141 9:133054864-133054886 GCACCTTGTGGGTGACACCTGGG + Intronic
1062707515 9:137953619-137953641 GAGGCTTGGAGGAGGCACCGGGG + Intronic
1200217646 X:154375042-154375064 CCGGCTTGGGACAGACACCAGGG - Intergenic