ID: 948833960

View in Genome Browser
Species Human (GRCh38)
Location 2:240615310-240615332
Sequence CAGGGGAAACAGACGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 536
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 487}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948833960_948833969 8 Left 948833960 2:240615310-240615332 CCCTTCTCCGTCTGTTTCCCCTG 0: 1
1: 0
2: 3
3: 45
4: 487
Right 948833969 2:240615341-240615363 GCTTAGGGATCGTTCATTTCAGG 0: 1
1: 0
2: 0
3: 7
4: 104
948833960_948833963 -8 Left 948833960 2:240615310-240615332 CCCTTCTCCGTCTGTTTCCCCTG 0: 1
1: 0
2: 3
3: 45
4: 487
Right 948833963 2:240615325-240615347 TTCCCCTGCCTGTGATGCTTAGG 0: 1
1: 0
2: 0
3: 17
4: 188
948833960_948833970 9 Left 948833960 2:240615310-240615332 CCCTTCTCCGTCTGTTTCCCCTG 0: 1
1: 0
2: 3
3: 45
4: 487
Right 948833970 2:240615342-240615364 CTTAGGGATCGTTCATTTCAGGG 0: 1
1: 0
2: 0
3: 7
4: 63
948833960_948833964 -7 Left 948833960 2:240615310-240615332 CCCTTCTCCGTCTGTTTCCCCTG 0: 1
1: 0
2: 3
3: 45
4: 487
Right 948833964 2:240615326-240615348 TCCCCTGCCTGTGATGCTTAGGG 0: 1
1: 0
2: 0
3: 7
4: 149
948833960_948833971 18 Left 948833960 2:240615310-240615332 CCCTTCTCCGTCTGTTTCCCCTG 0: 1
1: 0
2: 3
3: 45
4: 487
Right 948833971 2:240615351-240615373 CGTTCATTTCAGGGCCAGTGAGG 0: 1
1: 0
2: 1
3: 5
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948833960 Original CRISPR CAGGGGAAACAGACGGAGAA GGG (reversed) Intronic
900411087 1:2513020-2513042 CAGGTGAAGCAGCGGGAGAATGG - Exonic
900704730 1:4073251-4073273 AAGGGGAAAAAGAAGGAGAGTGG + Intergenic
900849967 1:5135034-5135056 CAGTAGATAAAGACGGAGAAAGG - Intergenic
901736647 1:11316742-11316764 CAGGGGCAAGAGAAGGAGAGAGG - Intergenic
901798962 1:11696215-11696237 AAGGGGAGACAGAGGGAGTAAGG - Intronic
902205252 1:14863747-14863769 CAGGGGAAACTGAAGGTGCACGG + Intronic
902724491 1:18325746-18325768 CTGGGAAAACAGATGGAGACAGG - Intronic
902758473 1:18565258-18565280 CATGGAAAACAGCCAGAGAAGGG + Intergenic
902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG + Intergenic
903218951 1:21858277-21858299 CATGGGAATCAGAGGGAAAAGGG - Intronic
903880164 1:26502731-26502753 CAGGAGAATGAGATGGAGAAAGG - Intergenic
904810004 1:33157276-33157298 CCTGGGAAACAGAGGGAGACTGG + Intronic
904816380 1:33203930-33203952 CAGGGGAAACAGTCAGTAAAAGG - Intergenic
905788751 1:40778922-40778944 GAGGAGACACAGAGGGAGAAAGG - Intergenic
906653221 1:47528263-47528285 TAAGGGAAACAGACAGAGAAGGG + Intergenic
907159381 1:52359641-52359663 TAGGGGAAACAGGCTCAGAAAGG - Intronic
908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG + Intronic
908528265 1:65008670-65008692 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
910257797 1:85265464-85265486 TATGGGAAACTGAGGGAGAAGGG + Intergenic
910490415 1:87763466-87763488 GAGGAGAAAAAGAAGGAGAAGGG + Intergenic
910859514 1:91730234-91730256 CAGAGGAAACAGACGAGGACAGG - Intronic
911658169 1:100468139-100468161 CAGGGGAACAAGAGGTAGAAAGG - Intronic
911824148 1:102460209-102460231 CAGAGGAAAGAGATAGAGAAAGG - Intergenic
912738585 1:112172808-112172830 AAGGGGAAATAGAAGGAAAAAGG - Intergenic
913062410 1:115220444-115220466 GAGGGGAAACAAATGGAGACTGG + Intergenic
913251289 1:116913615-116913637 CAGGGGAAACAATCAGAGTAGGG - Intronic
915239999 1:154514464-154514486 CAGGGGAAACACACGGAATGGGG + Intronic
915306599 1:154983362-154983384 CAAGGGAAAGAGCCGGTGAAGGG + Exonic
915652901 1:157332211-157332233 CAGGGGAGGCAGAGGGAGACAGG - Intergenic
915716565 1:157950148-157950170 GAGGGGAAACAGAGGGAGGGAGG + Intergenic
915744199 1:158143508-158143530 AAGGGAAAACAGAAGAAGAATGG + Intergenic
916046697 1:161005327-161005349 CCGGGGCAACAGAGTGAGAAAGG - Intronic
916058549 1:161083993-161084015 CAGGGGATACTGATGGAGAAAGG - Intronic
916287900 1:163131229-163131251 CAGGAGAAAGAGAGAGAGAAGGG - Intronic
916820543 1:168393978-168394000 CAGGGGAGAAAAAAGGAGAATGG + Intergenic
916824383 1:168430042-168430064 CAGGTGAGACAGATGGAAAAGGG + Intergenic
917020206 1:170578790-170578812 AAAGGGAAACAGACAGAGAAGGG - Intergenic
917707266 1:177647238-177647260 CAGGACAAACAGATGAAGAAAGG - Intergenic
917811443 1:178662247-178662269 CATCGGAACCAGACAGAGAAGGG + Intergenic
918157247 1:181860430-181860452 CAGGTGAAAAAGAAGGGGAATGG + Intergenic
918517181 1:185375954-185375976 CAGGGAAAACAATCCGAGAAAGG - Intergenic
918807746 1:189071323-189071345 CAGGGGAAGCAAAGGGAGTAGGG + Intergenic
919316052 1:195971365-195971387 CAGGTGGAAAAGACGCAGAAAGG + Intergenic
919409205 1:197222697-197222719 CAGGGGAAATGAACTGAGAATGG - Intergenic
920116319 1:203624380-203624402 AAGGGGAAAGAAAGGGAGAAAGG + Intergenic
920780904 1:208990181-208990203 GAGGGGAAACAGAGGGAGAGGGG + Intergenic
920805039 1:209224968-209224990 AAAGGGAAAGAGAAGGAGAATGG - Intergenic
920816689 1:209341085-209341107 CAGGGGAAAGTAAGGGAGAAAGG - Intergenic
921128189 1:212196475-212196497 CAGGGGAATCACATGGTGAAAGG - Intergenic
921283813 1:213591411-213591433 GGTGGGAAACAGAAGGAGAATGG - Intergenic
921687026 1:218101735-218101757 CAGGGGAAGGAAAAGGAGAAAGG + Intergenic
922331274 1:224578801-224578823 AAGAGGAGAAAGACGGAGAAGGG - Intronic
923051323 1:230393097-230393119 AAGGGGAAAAAGAAGGGGAAGGG + Intronic
923084734 1:230694785-230694807 CATGGGAGAGAGACAGAGAAGGG + Intergenic
923321923 1:232842785-232842807 CAAAGGAAACAGATGGAGGATGG + Intergenic
1063362376 10:5469001-5469023 CAGGGGAAACAGACCCAGGAGGG + Intergenic
1063662268 10:8043107-8043129 GACGGGAAACAGGCGGAGAGAGG + Intergenic
1065638289 10:27753194-27753216 GAGGGAAAAGAGAGGGAGAAAGG - Intergenic
1065638307 10:27753272-27753294 GAGGGAAAAGAGAGGGAGAAAGG - Intergenic
1065991105 10:31011337-31011359 CAGGGGAAACCGAGGGAAATGGG - Intronic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1067522541 10:47019223-47019245 CTGGGGAAAAAGAAGGAGATTGG + Intergenic
1067935446 10:50608339-50608361 GAGGGGAAAGAGAAGGAAAAGGG + Intronic
1068037227 10:51776034-51776056 GTGGGGAAACCGACTGAGAAAGG - Intronic
1068489645 10:57706967-57706989 CAGAGCCAACAGACAGAGAAGGG + Intergenic
1069032863 10:63616347-63616369 TAGGGGAAACAGACGGTAATGGG - Intronic
1069729760 10:70602946-70602968 CAGGGCACACAGGCGGAGGAGGG + Intergenic
1069839665 10:71331713-71331735 TAGGGGAAACAGGCAGAGCAGGG - Intronic
1069844940 10:71364492-71364514 CACGGGAATCAGAGAGAGAAAGG + Intergenic
1069859435 10:71461293-71461315 CAGGGGACTCCGAGGGAGAAAGG - Intronic
1070504792 10:77103772-77103794 GAGGGGAAAAAGATGGAGAGGGG - Intronic
1070574212 10:77665279-77665301 CAGAGGAAACAGGGTGAGAAAGG + Intergenic
1070660252 10:78300585-78300607 CTGGGGAAACAGAAAGTGAAGGG - Intergenic
1070747028 10:78939871-78939893 CAGGGGAAGAAGACACAGAAGGG - Intergenic
1071135183 10:82445536-82445558 TAAGGGAAACAGTGGGAGAAAGG - Intronic
1071567924 10:86681110-86681132 CAGGGGGAACAGACACAGAACGG + Intronic
1071889944 10:89993479-89993501 CAGGGGAAAGGGTGGGAGAATGG - Intergenic
1072295882 10:94009228-94009250 CAGGGGCAAGAGACAGAGAAGGG + Intronic
1072801186 10:98393432-98393454 AAGGGGAAGCAGCTGGAGAATGG - Intronic
1073293291 10:102423901-102423923 CAGGGGAAACAGATGGGGATAGG + Intronic
1074532358 10:114306031-114306053 GAGGGGACACAGATGCAGAAGGG + Intronic
1074572003 10:114632737-114632759 CCGATGAAACAGAGGGAGAAGGG - Intronic
1074863006 10:117527069-117527091 CTTAGGAAACAGACAGAGAAAGG + Intergenic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075551667 10:123397215-123397237 CAGGGAAAACACACAGACAAAGG - Intergenic
1075667671 10:124242674-124242696 CAGGGGAAACAGAGGGGGAAGGG + Intergenic
1075923989 10:126235889-126235911 CAAGGGGAACACACGGAGGAGGG + Intronic
1076928512 10:133508972-133508994 CAGGAGGAAGAGAGGGAGAAAGG + Intergenic
1078084415 11:8225100-8225122 GTGGGGAGACAGATGGAGAAAGG + Intronic
1078714740 11:13829104-13829126 GTGGGGAGACAGAGGGAGAAGGG - Intergenic
1079601377 11:22316158-22316180 CAGGGGAGACAGAGGCAGGAGGG - Intergenic
1080157406 11:29127913-29127935 AAGGGGAAAGGGAAGGAGAAGGG + Intergenic
1080930454 11:36804815-36804837 CTGGGGAAAGAGTCTGAGAAAGG + Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1083741655 11:64714458-64714480 CAGGGTAACCAGACTGGGAAGGG + Intronic
1085392286 11:76188675-76188697 ATGGGGAAACAGACACAGAAGGG + Intronic
1085816080 11:79738851-79738873 AAGGGGAAGGAGACGGAAAAGGG + Intergenic
1090098749 11:123771572-123771594 CATGGGAATGAGAAGGAGAAAGG - Intergenic
1090857940 11:130627075-130627097 CAAGGGAAAAAGAAGGACAAAGG + Intergenic
1091070616 11:132559167-132559189 GAGGGGAAAGAGAGGGAGAGAGG + Intronic
1091192573 11:133707356-133707378 AAGGGGAAAGAGAAGGGGAAAGG + Intergenic
1092202210 12:6592818-6592840 CTGGTGAAGCAGATGGAGAAAGG + Intronic
1092607125 12:10132795-10132817 CAGGGCAGAAAGACGGGGAAAGG - Intergenic
1093903802 12:24665564-24665586 CTGGGGAAACAGAAGCAGAAAGG + Intergenic
1094094499 12:26688539-26688561 CAGAGGAAGAAGAAGGAGAAGGG + Intronic
1094451449 12:30586819-30586841 CACTGGAAACAGAATGAGAATGG - Intergenic
1094672703 12:32586599-32586621 AAGGGAAAACAGATGGAGCAGGG + Intronic
1094691800 12:32776696-32776718 CAGGGGAAACAGACAGTGAACGG + Intergenic
1096587090 12:52629842-52629864 CAAGGGGAACAGATTGAGAAGGG - Intergenic
1096748646 12:53744893-53744915 CAGGGGAAGCAGAGAGAGAATGG - Intergenic
1097151708 12:56984110-56984132 CAGGGGAGAGAGACAGAGACAGG + Intergenic
1098170878 12:67745917-67745939 AAAGAGAAACAGACAGAGAAGGG - Intergenic
1100043893 12:90355199-90355221 CAGGGAGAAAAGACTGAGAATGG + Intergenic
1100098749 12:91076588-91076610 GAGGAGAAGGAGACGGAGAAGGG + Intergenic
1100784427 12:98064150-98064172 CACAGGAAACAGAGAGAGAAGGG + Intergenic
1101234849 12:102778150-102778172 GAGGAGAAAGAGAAGGAGAAGGG - Intergenic
1101731360 12:107429025-107429047 CAGGGGAAAGAGAGGGAGAGAGG + Intronic
1101787787 12:107900836-107900858 CAGGAGAAAGAGAGAGAGAAGGG - Intergenic
1102251774 12:111392214-111392236 CAGGGGAAACAGACTGGGCGCGG + Intergenic
1103072579 12:117957123-117957145 GAGGAGAAACAGAGGGCGAAGGG - Intronic
1103797888 12:123517367-123517389 TATGGCAAACATACGGAGAAAGG + Intronic
1103851560 12:123936920-123936942 CAAGAGAAGCAGAAGGAGAATGG + Exonic
1104795029 12:131511331-131511353 CAGGAGACACAGACTCAGAAAGG + Intergenic
1105984359 13:25550645-25550667 AAGGAGAAACGGAAGGAGAATGG - Intronic
1106788156 13:33127929-33127951 GAGAGGAAAGAGACGGAGACAGG + Intronic
1106845444 13:33733120-33733142 CAGGTGAAACAGAGGTAGACAGG + Intergenic
1106969938 13:35127078-35127100 CAGGGAAAACTGACCTAGAATGG + Intronic
1107073045 13:36292808-36292830 CAGGGAAAACAGACAGTGTAGGG + Intronic
1107229569 13:38091831-38091853 AAGGGAAAACAGAGGAAGAAGGG + Intergenic
1108087131 13:46805128-46805150 CAGGAGAGACAGAGAGAGAAGGG - Intergenic
1108472429 13:50780877-50780899 CAGGGGAAACGAGCGGAGACAGG - Intronic
1109617766 13:64859152-64859174 CAGGGGAAAGAGTGGGAGTAGGG - Intergenic
1109707386 13:66114293-66114315 AATTGGAAACAGACAGAGAAAGG - Intergenic
1110147839 13:72214445-72214467 CAGGAGAAAAAGACAGAGATTGG - Intergenic
1110574199 13:77037369-77037391 CAGGAGAAACAGACTGAGTGGGG - Intergenic
1110748734 13:79087624-79087646 CAGGTGAAATAGATTGAGAAAGG + Intergenic
1110852200 13:80258646-80258668 CAGGAGAAAAAGAGGGAGAGTGG + Intergenic
1110880766 13:80569513-80569535 TATGGGCAACAGAAGGAGAAAGG - Intergenic
1111294137 13:86257699-86257721 CAGGGGTAAGAGGCAGAGAAAGG - Intergenic
1111317943 13:86585539-86585561 CAGGAGGAAGAGAGGGAGAAAGG - Intergenic
1111714482 13:91862967-91862989 AAGGGGAAAGAGAAGGAGAAAGG - Intronic
1113375194 13:109758936-109758958 AAGGGGAAAGGGAAGGAGAAGGG + Intronic
1114517396 14:23308774-23308796 CAGGAGAGAAAGAAGGAGAAAGG - Intronic
1115654450 14:35429941-35429963 CAGGGGAAACAAATAGAGAAGGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117402488 14:55370942-55370964 GAGGGGAAAAAGAAGCAGAAAGG - Intronic
1118294575 14:64557408-64557430 AAGGGGAAAGAGAAGGAGAAGGG + Intronic
1118617187 14:67582092-67582114 AAGGGGAGACGGACCGAGAACGG + Exonic
1118746666 14:68779018-68779040 CAGGACAAACAGCCGGAGAGGGG + Intergenic
1119478641 14:74946409-74946431 CTAGGGAAACAGACAGAGAGAGG + Intronic
1119634883 14:76265839-76265861 CAGGAGGAAGAGACAGAGAAGGG + Intergenic
1120286647 14:82510951-82510973 CAGGGAAAAAAGAGGGAAAAAGG - Intergenic
1120649557 14:87115421-87115443 CAGGGAAAGCAGAGGGAAAAGGG - Intergenic
1120932170 14:89859767-89859789 CAGAGGAAACAGGCAGAGGAGGG + Intronic
1121003090 14:90465976-90465998 CAGGGGAGAGAGAGGGAGACTGG + Intergenic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1122392789 14:101401803-101401825 AAGAGGAAAGAGAAGGAGAAGGG - Intergenic
1123736377 15:23188189-23188211 AAGGGGAAAGCGAAGGAGAAAGG - Intergenic
1124287083 15:28411166-28411188 AAGGGGAAAGCGAAGGAGAAAGG - Intergenic
1124295618 15:28500463-28500485 AAGGGGAAAGCGAAGGAGAAAGG + Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1126020342 15:44394306-44394328 CAGGGGATACATTCTGAGAAAGG + Intronic
1126689720 15:51279970-51279992 AAGGAGAAACAGAGAGAGAAGGG + Intronic
1126694027 15:51310813-51310835 CAGAGGAAAGAGGGGGAGAAAGG + Intronic
1127343118 15:58066605-58066627 GAGGGGAAACAGCCGGAAGAGGG - Intronic
1127601937 15:60546485-60546507 CAGGAGAAACAGATAGAGACAGG + Intronic
1128705752 15:69836549-69836571 CAGTGGAAACAGAAACAGAAAGG - Intergenic
1128867417 15:71125107-71125129 AAGGGGAAAGGGAAGGAGAAAGG + Intronic
1129134122 15:73531238-73531260 CAAGGGAAACAGACTCAGTAGGG + Intronic
1129172976 15:73819102-73819124 TGGGGGACCCAGACGGAGAACGG - Intergenic
1129497344 15:75997728-75997750 CAGGGCCAAGAGATGGAGAAGGG - Intronic
1129671765 15:77611657-77611679 CAGGGGATAAAGCCTGAGAAAGG + Intergenic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130894380 15:88158969-88158991 CAAGGGATAGAGAGGGAGAAGGG + Intronic
1131070705 15:89463944-89463966 CAGGTGAAATAGATGGAGAGTGG - Intergenic
1131393362 15:92067305-92067327 CACGGGAAGCAGAGGGAGGAGGG - Intronic
1131819478 15:96257679-96257701 CAGGGGGAACAGGCAGAAAAGGG + Intergenic
1132327689 15:100985456-100985478 CAGGGGAAATTGAGGCAGAAAGG + Intronic
1132758161 16:1495998-1496020 CAGGGAAAACAGAGCGAGCATGG - Intronic
1133547512 16:6822106-6822128 TGGGGGAGACAGACTGAGAAAGG + Intronic
1134230103 16:12422365-12422387 CAGGGGAAACAGATACACAAGGG - Intronic
1134718963 16:16370596-16370618 AAGGGGAGAGAGATGGAGAAAGG - Intergenic
1134771428 16:16812667-16812689 CAGAGGCAACAGACCTAGAAGGG - Intergenic
1135052997 16:19207515-19207537 CAGGAGGAAGAGACAGAGAATGG + Intronic
1135124609 16:19798039-19798061 CAGGGGTAAGAGGCAGAGAAAGG + Intronic
1135795975 16:25442876-25442898 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
1136096665 16:27961985-27962007 GAGGGGAAACTGAGGCAGAAGGG - Intronic
1137387975 16:48058390-48058412 CAGGGAAAACACATAGAGAAAGG - Intergenic
1137977289 16:53042406-53042428 GAGGGGAAACAGAGGAAGAGAGG - Intergenic
1138518609 16:57555955-57555977 CAGGGGAGAGAGAGAGAGAAGGG - Intronic
1139018128 16:62714847-62714869 AAGGAGAAAAAGAAGGAGAAGGG - Intergenic
1140042739 16:71419773-71419795 CAGGGTAAACATACAGAGGAAGG + Intergenic
1140209664 16:72960228-72960250 GAGGGGAAAGAGAGAGAGAAAGG + Intronic
1140665687 16:77225132-77225154 CAGGAGAGACAGAAGGAAAATGG - Intergenic
1140808175 16:78552783-78552805 CAGAGAGAACAGAGGGAGAAAGG - Intronic
1140874397 16:79137680-79137702 CGGGGGAAGGAGACGGAGGAGGG - Intronic
1141263070 16:82471327-82471349 AAGGAGAAACAGAAGGGGAAGGG - Intergenic
1142607647 17:1090925-1090947 CAGGGGACACAGCCAGAGATGGG + Intronic
1143836499 17:9696879-9696901 CAGGGGAACCAGAGGGGAAAGGG - Intronic
1143881981 17:10036767-10036789 AAGGGGAAAAAGAGGGAGAGTGG - Intronic
1144146236 17:12401246-12401268 CAGGATAAACAAAAGGAGAAAGG + Intergenic
1144753018 17:17663103-17663125 AGGGGGAAACAGGCTGAGAAAGG + Intergenic
1144763048 17:17718127-17718149 CAGGGGAAGCAGGGGGAGAGGGG - Intronic
1145062891 17:19743695-19743717 CAGGGGAGAGAGCCGGTGAAGGG + Intronic
1145110625 17:20158234-20158256 AGGGGGAAGCAGAAGGAGAAGGG + Intronic
1145809969 17:27758776-27758798 CAGGGGAATCAGGCCCAGAAAGG - Intronic
1146370710 17:32264359-32264381 CAGGGGAACTGGAAGGAGAAGGG - Intergenic
1147219330 17:38919334-38919356 CAGGGGCAACAACAGGAGAATGG + Exonic
1147319351 17:39636643-39636665 CAGGGGAAGCAGGAGGAAAAGGG + Intergenic
1147890048 17:43710781-43710803 AAGGGCAAAGAGAGGGAGAAAGG + Intergenic
1148144343 17:45353216-45353238 AAGGGGAAACACACTGAGGAGGG - Intergenic
1148694223 17:49549421-49549443 CAGGGCAGGCAGAGGGAGAAAGG + Intergenic
1148914724 17:50966246-50966268 CATGGGAAACAGGTGGAGATGGG - Exonic
1149389277 17:56173281-56173303 CAGGGGGAACAGAAGGCAAAGGG - Intronic
1149576692 17:57718726-57718748 CAGGAGAGAAAGAAGGAGAAAGG + Intergenic
1150117352 17:62564976-62564998 TAGGGGAAACAGACAAAAAAAGG - Intronic
1150563213 17:66313070-66313092 CAGAGGAAACAGAAGTAGAGAGG - Intronic
1152204373 17:78966700-78966722 CAGGAGAGACAGACCGAGATAGG - Intergenic
1152518892 17:80843850-80843872 CAGGGGCAGCAGACTGAAAATGG - Intronic
1152905025 17:82965298-82965320 CTGGGACAACAGAGGGAGAAGGG - Intronic
1153118415 18:1689801-1689823 CAGGGAAAGCAGAGGAAGAAGGG + Intergenic
1153506488 18:5804394-5804416 CAGGAGAAAGAGAGGGAGAGAGG - Intergenic
1153732223 18:8025934-8025956 CAGGGAGAGCAGAAGGAGAAAGG + Intronic
1153737663 18:8088726-8088748 CTGGGGAAAAAGGCGTAGAATGG - Intronic
1155012305 18:21792083-21792105 CAAGGGATACAGACAGGGAAAGG - Intronic
1155655196 18:28184435-28184457 AAAGGGAAAGAGAGGGAGAAAGG - Intergenic
1156412552 18:36846605-36846627 AAGGGGAAACAGACTGTAAAAGG - Intronic
1159067877 18:63589798-63589820 CTGGGGAAAAGGACTGAGAAAGG + Intronic
1159427779 18:68311571-68311593 CAGGGGAAACTGATTGACAAAGG - Intergenic
1160949098 19:1657246-1657268 CAGGGGAAGCTGAGGGACAAAGG + Intergenic
1161009776 19:1954619-1954641 CAGTGGAGACAGTCAGAGAAGGG + Intronic
1161864608 19:6824964-6824986 CAGGGGAAGGAGACAGAGAGAGG - Intronic
1163003786 19:14384719-14384741 AAGGGGAAACAGGAGGAGATGGG - Intronic
1163117656 19:15197961-15197983 CAGGGGTAATAGAAGGGGAAGGG + Intronic
1164693003 19:30224940-30224962 GAGGAGAGAGAGACGGAGAAGGG - Intergenic
1164743578 19:30594731-30594753 CAGGGGAAACAGGAGAAGAGTGG - Intronic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1166776459 19:45315770-45315792 GAGGGGAGAGAGACAGAGAAGGG - Intronic
1166800124 19:45451376-45451398 CAGGGGAGACAGACAGACAAGGG + Intronic
1166880816 19:45929017-45929039 CAGGGGCAAGTGATGGAGAATGG - Intergenic
1167427918 19:49439022-49439044 CAGGGGACAAGGACAGAGAAGGG + Intronic
1167785172 19:51630114-51630136 CAGGGGTAAGAGAAGGAGCAGGG + Intronic
1167787271 19:51646538-51646560 CAGGGGTAAGAGAAGGAGCAGGG + Exonic
1168251571 19:55145308-55145330 AAGGGGAAGGAGAAGGAGAAGGG + Intronic
1168485129 19:56755006-56755028 AAGGGGAAAATGAAGGAGAAAGG + Intergenic
925144841 2:1574324-1574346 CAGGGCAGACAGGCGGTGAAGGG + Intergenic
926459276 2:13108985-13109007 CAGGGGAAAAGGTGGGAGAAGGG + Intergenic
926899985 2:17740245-17740267 TAGGAGAAACAGATGGACAAGGG - Intronic
927001736 2:18802594-18802616 CAGGGGAAAGAAAAGGATAATGG + Intergenic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
927680185 2:25133770-25133792 CAGGGGACACAGAGGGGAAAAGG - Intronic
927834483 2:26382330-26382352 TAGCGGAAACATAGGGAGAATGG + Intronic
928305912 2:30170260-30170282 CAGAGGAGACAGACACAGAAAGG - Intergenic
928691247 2:33801433-33801455 CAGGGGAGACAGTAGGAGAGAGG + Intergenic
929269111 2:39953457-39953479 CAGGGAAAACAGTAAGAGAAAGG + Intergenic
930265980 2:49199542-49199564 CAGGGGACACAGAGGGACAATGG - Intergenic
930282073 2:49381248-49381270 CAGTGGAATCAAACGGAGATAGG - Intergenic
931787327 2:65631810-65631832 GAGGCGAAAAAGATGGAGAAGGG - Intergenic
931903274 2:66815081-66815103 CAGGAGAAAGAGAGAGAGAAGGG - Intergenic
932434767 2:71696575-71696597 CACGGGAAAAAGACGGCCAAGGG - Intergenic
934983156 2:98864415-98864437 CTGGGGAAACACAGGTAGAATGG + Intronic
935123560 2:100202624-100202646 GAGGGGAAACTGAGGCAGAAAGG + Intergenic
935426627 2:102925722-102925744 CTGGGGAAAAAAAAGGAGAAAGG + Intergenic
936703705 2:115044301-115044323 AAGGAGAAACAGAGAGAGAAGGG + Intronic
937749724 2:125460808-125460830 CAAGGGAAAAAGAAAGAGAAGGG - Intergenic
939307254 2:140427339-140427361 AAGGGTAAAGACACGGAGAAGGG - Intronic
940196013 2:151094845-151094867 CAGGAGAAAGAGAGAGAGAAGGG + Intergenic
940784052 2:157962990-157963012 CAAGGGAAAGAGACAGTGAAGGG + Intronic
941010769 2:160297197-160297219 CAGGGGAGAAAGATGGAGGAGGG + Intronic
941553893 2:166951387-166951409 CAGGAGAAACAGAGAGATAAAGG + Intronic
941743540 2:169062233-169062255 CAGAGAAAACAGACTCAGAAGGG - Intergenic
943704846 2:191023485-191023507 CAGGGGAAACAGAGAGAACATGG + Intergenic
943731381 2:191306689-191306711 AAGGGGGATCAGAGGGAGAAAGG + Intronic
945266409 2:207895503-207895525 CAGGGGAAGGAGACTGTGAAAGG - Intronic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946230484 2:218288087-218288109 GAGGGGAAAGAGACAGACAAAGG + Intronic
947243476 2:228020961-228020983 CAGTGGGTACAGAAGGAGAAGGG + Intronic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
948589209 2:239038684-239038706 AAGAGGAGACACACGGAGAAGGG - Intergenic
948833960 2:240615310-240615332 CAGGGGAAACAGACGGAGAAGGG - Intronic
1168855142 20:1002640-1002662 AAGGAGGAACAGACAGAGAAAGG - Intergenic
1169817585 20:9674133-9674155 CAGCAGAAACAGAATGAGAATGG + Intronic
1169967401 20:11232831-11232853 CAGTGGAAACTGACAGAGGATGG + Intergenic
1170372056 20:15659829-15659851 CAGGGGAAACAGACATATGAGGG + Intronic
1170440984 20:16378421-16378443 AAGGGGAAAGAGAGGGAGACAGG + Intronic
1170647828 20:18212573-18212595 CAGGTGGAACAGAGAGAGAAAGG + Intergenic
1170919853 20:20667748-20667770 AAGGGGAAACAGATGGAGAAAGG + Intronic
1172438192 20:34945400-34945422 CAAGGGAAAGAGACAGAGAAGGG + Intronic
1173493859 20:43504907-43504929 ATGGGGAAACAGAAGGGGAATGG - Intergenic
1173556984 20:43973288-43973310 CAGGAGAAGCAGCCGGAGGAGGG - Intronic
1173646489 20:44636300-44636322 CAGGGGGAAGAGAGAGAGAAAGG + Intronic
1173939995 20:46902581-46902603 CAGGGCAGACAGATGGAGAAAGG - Intronic
1174024716 20:47564177-47564199 TTGGGGAAAAAAACGGAGAAAGG - Intronic
1174062350 20:47841737-47841759 CAGGTGAAAAAGAAAGAGAAGGG - Intergenic
1174121877 20:48271957-48271979 CAGGGGAAACAGCTTGAGATTGG - Intergenic
1174216519 20:48920743-48920765 GAGGGGAAAGAGTAGGAGAAAGG - Intergenic
1175127961 20:56766541-56766563 CAGGGGAGAGAGAGAGAGAAAGG - Intergenic
1175546216 20:59779608-59779630 CAGGGGAAAGAGAGGGAGAGAGG - Intronic
1175593370 20:60211665-60211687 CAAAGGAAACACATGGAGAATGG + Intergenic
1175733627 20:61370915-61370937 CGGGGGAAAGGGAGGGAGAAAGG - Intronic
1175904353 20:62372250-62372272 CAGGGGAAACAGGCGGAATGGGG + Intergenic
1175963045 20:62646640-62646662 CATGGGAAACAGACTCAGAATGG - Intronic
1176060830 20:63172182-63172204 CAGGGGAAAGACACAGAGACAGG + Intergenic
1176162831 20:63657205-63657227 CAGGAGAAAGAGAGAGAGAAGGG + Intergenic
1176587390 21:8601326-8601348 CATGGGAGACAGATGTAGAATGG + Intergenic
1176886771 21:14265807-14265829 CAGGAGAAACAGAGAGAGAGCGG - Intergenic
1177333606 21:19694704-19694726 CAGGGGCAACAGAAGTAGCATGG + Intergenic
1177724979 21:24955614-24955636 GAGGGGAAACAGTAGGATAAGGG - Intergenic
1178077746 21:29027913-29027935 CATGGGAAAGAAACGGACAAAGG + Exonic
1178436171 21:32560297-32560319 CAGGGAAAGCAGAGGAAGAAGGG + Intergenic
1179406742 21:41132552-41132574 CAGGGAAATGAGACAGAGAAAGG + Intergenic
1180270221 22:10578323-10578345 CATGGGAGACAGATGTAGAATGG + Intergenic
1180748920 22:18111136-18111158 CTGGGGAGCCCGACGGAGAAGGG + Intronic
1181392418 22:22593432-22593454 TAGGGGGAACAGATGGAGCAGGG + Intergenic
1181762431 22:25067521-25067543 CAGGGAACACAGAGGGTGAAAGG - Intronic
1181960164 22:26617045-26617067 CAGAGGAAGCAGACGGGGAAAGG - Intronic
1182057485 22:27371217-27371239 CTGGGGAGTCAGACGCAGAAGGG + Intergenic
1182111857 22:27729396-27729418 ATGGGGAAACAGACTCAGAAAGG - Intergenic
1182385168 22:29932868-29932890 CAGGGAAAAAATATGGAGAAAGG - Intronic
1182540420 22:31037540-31037562 CAGGGGAAACAGGCTCAGAGAGG - Intergenic
1182550927 22:31100398-31100420 AAGGGAAGACAGATGGAGAAGGG - Intronic
1182754559 22:32668376-32668398 GAGGGGAAAGAGAAGGGGAAAGG - Intronic
1182886407 22:33777666-33777688 AAGGGGAAGGAGAAGGAGAAGGG + Intronic
1183950221 22:41348595-41348617 AAGGGGAACAAGAGGGAGAAAGG - Intronic
1184458446 22:44624358-44624380 GATGACAAACAGACGGAGAAGGG + Intergenic
1184897657 22:47421049-47421071 CAGGGGAAGCAGCCAGGGAATGG - Intergenic
951795921 3:26538222-26538244 AAGGGGAAAGGGAAGGAGAAGGG + Intergenic
952523526 3:34185903-34185925 CAGGGGAAAAAGAGAGAAAAAGG + Intergenic
952539797 3:34356017-34356039 AAATGGAAACAGATGGAGAATGG + Intergenic
954142910 3:48619569-48619591 AAGGGGAAAAAGAAAGAGAAAGG + Intergenic
954189092 3:48943480-48943502 CACCGGAGACAGACAGAGAATGG + Intronic
955033862 3:55247612-55247634 CAAGGTAAAGAGAAGGAGAAAGG - Intergenic
955187818 3:56731931-56731953 CAATGGAAAAAGACAGAGAAAGG + Intronic
961546649 3:127639013-127639035 AAGGGGAGACAGATGGAGACAGG - Intronic
963060563 3:141221533-141221555 AAGGGGAATGAGACTGAGAAGGG + Intergenic
963602192 3:147388350-147388372 GAGGGGAAAGAAAAGGAGAAAGG - Exonic
965084505 3:164077476-164077498 CAGGGAAAGCAGAGGGAAAAAGG + Intergenic
965420332 3:168449945-168449967 GTGGGGAAACAAAGGGAGAATGG - Intergenic
965682479 3:171265746-171265768 CTGGGGAAACAGAGGGAAAGTGG + Intronic
965710063 3:171548295-171548317 CCTGGGCAACAGAGGGAGAATGG - Intergenic
966321604 3:178707078-178707100 AAGTGGAGACAGAAGGAGAAAGG + Intronic
966942637 3:184756608-184756630 CAGGGGCAGCACAGGGAGAACGG - Intergenic
967992884 3:195144687-195144709 CAGGGGAAACTGAAACAGAAAGG - Intronic
968236108 3:197030611-197030633 AAGGAGAAACAGGCGGAGAAGGG + Intergenic
968406278 4:342084-342106 CAGGGGAAACAGAAAGGAAATGG + Intronic
968603787 4:1522043-1522065 CAGGGGCAGCAGACGGACACAGG + Intergenic
969160739 4:5256487-5256509 CAGGGGAAGCAGTGGGAGAGTGG - Intronic
969979526 4:11140470-11140492 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
970126050 4:12812519-12812541 GAAGGGAAACAGGGGGAGAATGG + Intergenic
970301079 4:14681854-14681876 CAGGAGAAAGAGAAAGAGAATGG + Intergenic
970566855 4:17340015-17340037 CAGGGGAAACTTAGGGGGAAAGG + Intergenic
971115212 4:23638285-23638307 CAGGGGAAAGAGTGGGAGTAAGG - Intergenic
971495607 4:27261232-27261254 CAGGGGAATCAGAAGAATAATGG + Intergenic
972332741 4:38078990-38079012 CAGTAGAAACAGAAGCAGAAAGG + Intronic
974018592 4:56673046-56673068 CATGGGAAACAGAAAGGGAAAGG - Intronic
976815053 4:89138504-89138526 CAGGGTAAAAAGACTGAGAAAGG + Intergenic
977049754 4:92115195-92115217 CAGGGGAAAGAGAGTGAGAGGGG - Intergenic
977316172 4:95450590-95450612 CAGAGAAATAAGACGGAGAAAGG - Intronic
977459610 4:97308951-97308973 CAGGGGAGAGAGAAGGGGAAGGG - Intronic
977645385 4:99405894-99405916 CAGGGGAAAGGGTGGGAGAAGGG + Intergenic
977747647 4:100569468-100569490 CAGGGCAAGCAGAGGGAGATGGG - Intronic
978482542 4:109210741-109210763 CAGGGGAAACAGCTGGAACATGG - Intronic
978937114 4:114391085-114391107 CCAAGGAAAGAGACGGAGAATGG - Intergenic
979150275 4:117304485-117304507 CAGGTGAAAGAGAAGGTGAAAGG + Intergenic
981642670 4:146963205-146963227 CAGGTGAAACAAACAGAGAAAGG + Intergenic
982370442 4:154627424-154627446 CAGGGGAGGGAGACGGAGGAAGG - Intronic
982471884 4:155802357-155802379 CATTGGCAACAGACGGAGGAAGG - Exonic
984241003 4:177219214-177219236 CAAGGGAAAAAGAGGGAGTAGGG - Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985385579 4:189444174-189444196 AAGGAGAAAGAGAAGGAGAAAGG - Intergenic
985992195 5:3572595-3572617 AAGGGGAAAGAGACATAGAATGG - Intergenic
986234045 5:5891355-5891377 CAGATAAAAAAGACGGAGAAAGG + Intergenic
986750743 5:10785412-10785434 CAGGGGAAACAGATAGAACAGGG + Intergenic
987239634 5:15981903-15981925 AAGGGGGAAGAGAGGGAGAAAGG + Intergenic
987240366 5:15992105-15992127 GAGGAGAAACAGAGAGAGAAAGG - Intergenic
987680569 5:21130931-21130953 TAAGGGAAACTGATGGAGAAAGG - Intergenic
987754969 5:22088600-22088622 CAGGGGAAACAGAGGCCAAAAGG + Intronic
989214277 5:38888062-38888084 CATGCGAGACAGACGGAGGAGGG + Intronic
990136177 5:52646032-52646054 CAGGAGAAAGAAAGGGAGAAGGG - Intergenic
991603659 5:68378868-68378890 CTGGGGAAGCAGACAGGGAAAGG + Intergenic
993560595 5:89402590-89402612 CAGGGGCAACAAAGGGAGACAGG + Intergenic
994782925 5:104116177-104116199 AAGGGGAAACAAAAGGAAAATGG + Intergenic
997147220 5:131448933-131448955 CATGGGAAACACACAGAGAAGGG + Intronic
998510952 5:142713518-142713540 CCTGGGAAACAGGAGGAGAACGG - Intergenic
998556492 5:143129880-143129902 CAAGGGAAACAGACTCAGAAGGG + Intronic
999296533 5:150462947-150462969 GAGGAGAACCAGAGGGAGAAGGG + Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1001106717 5:168860786-168860808 CAGGGGAAACAGCTTAAGAATGG - Intronic
1001737797 5:174021047-174021069 AAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1001948202 5:175797399-175797421 GAGGGGAAACAGGCACAGAACGG + Intronic
1003400300 6:5785150-5785172 CAGAGGATACAGCAGGAGAAGGG + Intergenic
1003408991 6:5846799-5846821 CTGGGGAAACAGCCTGAGACAGG + Intergenic
1004061710 6:12204381-12204403 CGGGGGAAAGGGAGGGAGAAAGG - Intergenic
1004991022 6:21138898-21138920 AAGGGCACACAGAAGGAGAAAGG - Intronic
1005676926 6:28164385-28164407 CTGGGGAAACTGAGGAAGAAGGG - Intergenic
1006200644 6:32286893-32286915 CAGGGCAAAGAGATAGAGAATGG + Intergenic
1006761335 6:36464591-36464613 GAGGGGAAACAGAGGGGGATGGG - Intronic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007899831 6:45400239-45400261 GAGGGGAGACAGAGGGAGGAAGG + Intronic
1008029744 6:46680951-46680973 TAGGGGAAGCAGTGGGAGAAAGG - Intergenic
1008263631 6:49397086-49397108 AATGGGAAACATAGGGAGAAAGG + Intergenic
1008793028 6:55262109-55262131 CAGGGGAAAGTGAGGGAGAGGGG + Intronic
1009714916 6:67378945-67378967 AAGGGGAAACAGAAGGAAAAGGG - Intergenic
1010535113 6:77017227-77017249 CAGAGGAAACAGCAAGAGAAGGG + Intergenic
1011603244 6:89079317-89079339 CTGGGGAAACAGGCTTAGAAAGG - Intergenic
1011967722 6:93180214-93180236 CAGCTGAAAGAGAAGGAGAAAGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1013153257 6:107467356-107467378 AAGGGGAAAGGGATGGAGAAAGG - Intergenic
1013210681 6:107983976-107983998 AAGGGGGAGCAGACCGAGAAAGG + Intergenic
1013680375 6:112518884-112518906 CAGGGAAAGCAGAGGAAGAAAGG + Intergenic
1013718317 6:112990661-112990683 CAGAGAAAACAAACGGAAAATGG - Intergenic
1013945504 6:115717628-115717650 CAGGGGAAAAAGAAGAACAATGG + Intergenic
1015255832 6:131178729-131178751 CAGGTCAAACAGAAGGAGATAGG - Intronic
1015437670 6:133208391-133208413 CAGGGGAAACAGGGAGAGAGGGG - Intergenic
1016161323 6:140884000-140884022 AAGGGGAAGGAGAAGGAGAACGG - Intergenic
1016505994 6:144779615-144779637 CAGGGGTAACAGAGGCAGAAAGG + Intronic
1017118896 6:151005459-151005481 CAAAGGAAATAGACGAAGAATGG - Intronic
1017348896 6:153416492-153416514 CAGGGAAAGCAGAGGAAGAAGGG + Intergenic
1018042098 6:159933830-159933852 CAGGGGAAGCTGATGGGGAATGG + Intergenic
1018557692 6:165065490-165065512 CGAGGGAAACAGCCGGAGATGGG - Intergenic
1019328506 7:451451-451473 GAGGGGAGAGAGACGGAGAGAGG - Intergenic
1019546586 7:1580238-1580260 CATGGGAGACAGAAGGAGACAGG - Intergenic
1020011352 7:4807534-4807556 GAGGGGAGACAGAGGGAGAGAGG - Intronic
1021059991 7:16099457-16099479 CAGGAAAAACATAAGGAGAAGGG + Intronic
1021562511 7:21982525-21982547 CAGTGGAAACAGAAAGAGATTGG - Intergenic
1022095337 7:27137246-27137268 CAGGGGAAAGAGCAGGAGAAAGG + Intronic
1023119984 7:36899407-36899429 CAGGTGAAGAAGAGGGAGAAGGG + Intronic
1023737625 7:43248766-43248788 GAGGGGAAACAGGAGGAGAACGG - Intronic
1023990301 7:45124646-45124668 CAGGGGAAGCTCAGGGAGAAAGG + Intergenic
1024011509 7:45270991-45271013 CAGGGGAAACAAATAGGGAAGGG + Intergenic
1024295989 7:47842721-47842743 CAGTGGAGACAGAAGGAGAAGGG + Intronic
1024919896 7:54545375-54545397 AAGGAGAAAGAGACGGAGAGAGG + Intronic
1025232092 7:57209408-57209430 CAGGTGAAATAGAAAGAGAAGGG + Intergenic
1026070291 7:67112796-67112818 CAGGGGAGCCAGATGCAGAACGG + Intronic
1026683591 7:72489209-72489231 CAGGGGAAACAGGCAGAACAAGG + Intergenic
1026706619 7:72699473-72699495 CAGGGGAGCCAGATGCAGAACGG - Intronic
1026905054 7:74058007-74058029 AAGGAGAAAGAGAAGGAGAAGGG - Intronic
1027457239 7:78407984-78408006 CAGGGGAACCTGACATAGAAGGG + Intronic
1028454009 7:91018718-91018740 CAGGAGGAAGAGACAGAGAAGGG - Intronic
1028638928 7:93021763-93021785 CAGGAAAAAGAGAAGGAGAAAGG + Intergenic
1029184727 7:98730397-98730419 CAGGAGAAAGAGACAGAGGAAGG + Intergenic
1029189466 7:98761487-98761509 CAGGGGAAACAGCCAGTGCAAGG + Intergenic
1029204655 7:98862337-98862359 AAGGGAAAACAGAGAGAGAAGGG + Intronic
1029403395 7:100358779-100358801 CAGGGGTAATAGAAGGAGAAGGG - Exonic
1029405973 7:100374133-100374155 CAGGGGTAATAGAAGGAGAAGGG - Exonic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1030002726 7:105082619-105082641 CAGGGGTGACAGAGGGAGAAGGG + Intronic
1030128520 7:106177821-106177843 CAAGGGAAAGAGACAGAGCAGGG - Intergenic
1030141754 7:106311190-106311212 AAGGGGAAAATGACGCAGAATGG - Intergenic
1031878651 7:127170836-127170858 CAGGGGAAAGGGTGGGAGAAGGG + Intronic
1032911800 7:136440855-136440877 CAGGGGAAATGGTGGGAGAAGGG - Intergenic
1033150893 7:138914073-138914095 CGGGGGAAACAGAGGCAGAATGG + Intronic
1034263825 7:149772306-149772328 CTGGGGAGACAGAGGGGGAAGGG - Intronic
1035690203 8:1554914-1554936 TAGGGGCAAAAGAGGGAGAAAGG + Intronic
1036035148 8:5010508-5010530 CAAAGGAAACAGACGGATAAAGG + Intergenic
1036684790 8:10902499-10902521 CAGAGGGACCAGACGGAGAAAGG - Intronic
1038145141 8:24888391-24888413 CAGGGGAAACAGCAGGTGATGGG + Intergenic
1038377130 8:27051967-27051989 CAGGGAAAAGAAACAGAGAAAGG + Intergenic
1039944118 8:42115590-42115612 CAGGGGCAGCGGATGGAGAAGGG - Intergenic
1039979273 8:42392395-42392417 CAGGAGACGCAGACGGGGAAAGG - Intronic
1040813859 8:51485610-51485632 CAGAGGAAACATTAGGAGAAAGG - Intronic
1041011445 8:53547598-53547620 GAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1041426029 8:57721634-57721656 CAGGAGTAAGAGATGGAGAAGGG + Intergenic
1042399826 8:68332012-68332034 CAGGAGAAAGGGACGGAGAAAGG + Intronic
1042819225 8:72911929-72911951 AAGGGGAAACAGAAAGACAATGG - Intronic
1043489697 8:80736690-80736712 CAGGGGAAATAGTGGGAGGAGGG + Intronic
1043659644 8:82722078-82722100 CAGGGGAAATAGATGCACAATGG - Intergenic
1043806797 8:84681833-84681855 CAGGGCAATCAGGCGGAAAAAGG - Intronic
1044295287 8:90519806-90519828 CAGGAGAGACAGAGGGTGAAGGG - Intergenic
1044402224 8:91786119-91786141 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1044402229 8:91786137-91786159 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1044403946 8:91805159-91805181 CAGAGACAACATACGGAGAAGGG + Intergenic
1045014966 8:97993221-97993243 CAGAGGAAACAAACTGAGTAAGG - Intronic
1045622377 8:103995461-103995483 CAGTGGAGACAGAGGGAGAATGG + Intronic
1046678249 8:117137108-117137130 CAGGAGATGTAGACGGAGAAGGG - Intronic
1047190692 8:122676540-122676562 CACAGGAAACAGACTGAGCAAGG - Intergenic
1048043007 8:130748960-130748982 CTGGGGCAAGAGAGGGAGAAGGG + Intergenic
1048518916 8:135136116-135136138 GAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1048773287 8:137918841-137918863 CAGGAGAGAGAGAAGGAGAAGGG - Intergenic
1048978102 8:139684558-139684580 CAGGGGAAAAAGAAGGCAAAAGG + Intronic
1049287479 8:141783660-141783682 AATGGGAAACAGCAGGAGAAGGG + Intergenic
1049997850 9:1048229-1048251 GAGGAGAAACAGGAGGAGAAAGG - Intergenic
1050952112 9:11610750-11610772 GAGGGGAAAGAGAAGGAGAGAGG - Intergenic
1051059971 9:13034464-13034486 GAGGGGAAACAGCAGAAGAATGG - Intergenic
1051811432 9:21054084-21054106 CAGGAGAAAGAGAGAGAGAAAGG - Intergenic
1051919444 9:22247688-22247710 GAGGGGGAACAGAGGGAGAGGGG - Intergenic
1052037701 9:23701634-23701656 AAGAGGGAACAGAAGGAGAAGGG + Intronic
1052200784 9:25777036-25777058 CAGAGGAGACAGACTGAGAGAGG + Intergenic
1052216813 9:25976050-25976072 AAGGGGAAGCAGAAGGTGAAGGG - Intergenic
1053180722 9:35966780-35966802 CAGGGGTTACAGATGGGGAAGGG - Intergenic
1054738742 9:68782991-68783013 CAGGGGCAACAGATAGAGAAGGG - Exonic
1054743088 9:68828200-68828222 CAGGAGAAACAGAAGAGGAAGGG - Intronic
1054862988 9:69972250-69972272 CAGGAGTAACAGAGGGGGAAGGG - Intergenic
1054945585 9:70792607-70792629 GAGGGGAAACAAAGGGAGACAGG + Intronic
1056063209 9:82906509-82906531 TAGGAGAAAAAGAAGGAGAAGGG + Intergenic
1056632345 9:88304296-88304318 CAGGAGATACATACAGAGAATGG - Intergenic
1057226944 9:93297424-93297446 CAGGGGAAACAGACAGTGGAAGG - Intronic
1057799037 9:98178596-98178618 AAGGGGAAACACTCTGAGAAAGG - Intronic
1057928068 9:99170573-99170595 ATGGGGAAACAGGCTGAGAAAGG + Intergenic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1058482515 9:105411344-105411366 CAGGGGAAGGGGAAGGAGAAGGG - Intronic
1058538975 9:105992454-105992476 CAGTGGAAACAGATGTACAATGG - Intergenic
1058711524 9:107683468-107683490 AAGGGGATGCAGAGGGAGAAGGG - Intergenic
1059467391 9:114477652-114477674 CAGGGGAAGGACACTGAGAACGG + Intronic
1059489107 9:114652537-114652559 CAGGGGATACAGTATGAGAATGG + Intergenic
1060171993 9:121469421-121469443 CAGGGCAAATAGACGATGAAAGG + Intergenic
1060522149 9:124300057-124300079 CTGAGGACACAGAGGGAGAAGGG + Intronic
1060889943 9:127181738-127181760 CAGGCCAAAGAGATGGAGAAAGG - Intronic
1062275158 9:135727052-135727074 AATGGGAAACAGAGGGAGAGAGG - Intronic
1062320981 9:135990413-135990435 CTGGGATAACAGACAGAGAAGGG - Intergenic
1203617349 Un_KI270749v1:79508-79530 CATGGGAGACAGATGTAGAATGG + Intergenic
1186437710 X:9557371-9557393 CAGGGGAAACAGGCGGTCAGAGG + Intronic
1186859365 X:13656150-13656172 TAGGGGAAACACACGCAGGATGG - Intronic
1187008445 X:15254851-15254873 GAGGGGAAACAGTCAGAGTAAGG + Intronic
1187245037 X:17546278-17546300 GAGGGGAATGAGACAGAGAATGG - Intronic
1187576224 X:20559173-20559195 CAAGGGAAGGAGAAGGAGAAGGG - Intergenic
1187733171 X:22277502-22277524 CAGGGGGAACGGAGAGAGAAGGG - Intergenic
1187843796 X:23515450-23515472 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1188079231 X:25815553-25815575 CAGGGGAGAGAGAGGGGGAAGGG - Intergenic
1188697637 X:33215464-33215486 CAAAGTAAACAGACGAAGAATGG - Intronic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1192546670 X:72019961-72019983 CAGAGGAAGCAGATGGAGAAGGG - Intergenic
1194014304 X:88600235-88600257 CAGGAGAGACAGAGAGAGAATGG + Intergenic
1194431396 X:93811289-93811311 AAGGGGAAATAGAAGGAGAAAGG - Intergenic
1195989894 X:110672064-110672086 CAGGAGGAACAGACAGAGGAGGG + Intergenic
1196310097 X:114153803-114153825 CAGAGAAAAGAGAGGGAGAATGG + Intergenic
1196404675 X:115348707-115348729 CAGGGAAAACAAACTGAAAAAGG - Intergenic
1197545774 X:127822189-127822211 CAGGGGAAAGGGAGGGAGTAGGG + Intergenic
1197622544 X:128766593-128766615 CAAGAAAAACAGAGGGAGAAAGG - Intergenic
1198276532 X:135099212-135099234 CAGGGGAGACCGTGGGAGAAGGG - Intergenic
1198309966 X:135421540-135421562 CAGGGGAGACCGTGGGAGAAGGG + Intergenic
1198466740 X:136910210-136910232 GAGGGGAAAGAGAAGGAGATGGG - Intergenic
1199783169 X:151081943-151081965 CAGGACACACAGAAGGAGAATGG + Intergenic
1200379716 X:155822221-155822243 AAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1200379724 X:155822245-155822267 AAGGGGAAGGAGAAGGAGAAGGG + Intergenic