ID: 948843389

View in Genome Browser
Species Human (GRCh38)
Location 2:240671124-240671146
Sequence GTGCAGACTTAAAGCTATAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948843388_948843389 12 Left 948843388 2:240671089-240671111 CCTGGCAGACTCTAGTTTTAGGA No data
Right 948843389 2:240671124-240671146 GTGCAGACTTAAAGCTATAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948843389 Original CRISPR GTGCAGACTTAAAGCTATAA CGG Intergenic
No off target data available for this crispr