ID: 948849978

View in Genome Browser
Species Human (GRCh38)
Location 2:240701142-240701164
Sequence GCCAGGCGGCCTCGCGCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948849978_948849985 7 Left 948849978 2:240701142-240701164 CCTGCCGCGCGAGGCCGCCTGGC No data
Right 948849985 2:240701172-240701194 TCTGCTCCCCAAGGGCGTCCCGG No data
948849978_948849982 -2 Left 948849978 2:240701142-240701164 CCTGCCGCGCGAGGCCGCCTGGC No data
Right 948849982 2:240701163-240701185 GCCTGCAGCTCTGCTCCCCAAGG No data
948849978_948849992 26 Left 948849978 2:240701142-240701164 CCTGCCGCGCGAGGCCGCCTGGC No data
Right 948849992 2:240701191-240701213 CCGGATCCCACACCCGCTCCGGG 0: 1
1: 1
2: 0
3: 12
4: 190
948849978_948849990 25 Left 948849978 2:240701142-240701164 CCTGCCGCGCGAGGCCGCCTGGC No data
Right 948849990 2:240701190-240701212 CCCGGATCCCACACCCGCTCCGG 0: 1
1: 1
2: 2
3: 27
4: 216
948849978_948849984 -1 Left 948849978 2:240701142-240701164 CCTGCCGCGCGAGGCCGCCTGGC No data
Right 948849984 2:240701164-240701186 CCTGCAGCTCTGCTCCCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948849978 Original CRISPR GCCAGGCGGCCTCGCGCGGC AGG (reversed) Intergenic