ID: 948850311

View in Genome Browser
Species Human (GRCh38)
Location 2:240702408-240702430
Sequence CACTTTGTGTGGAGGTCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948850311_948850321 17 Left 948850311 2:240702408-240702430 CCCTCTGACCTCCACACAAAGTG No data
Right 948850321 2:240702448-240702470 GGCACTCCTACCTGCCACCATGG No data
948850311_948850315 -4 Left 948850311 2:240702408-240702430 CCCTCTGACCTCCACACAAAGTG No data
Right 948850315 2:240702427-240702449 AGTGTTCTCACCCAACCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948850311 Original CRISPR CACTTTGTGTGGAGGTCAGA GGG (reversed) Intergenic
No off target data available for this crispr