ID: 948850685

View in Genome Browser
Species Human (GRCh38)
Location 2:240703937-240703959
Sequence AACCCTCAGCTCCCTGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948850676_948850685 0 Left 948850676 2:240703914-240703936 CCTCAGCTTTCTCTGCCCCACCC No data
Right 948850685 2:240703937-240703959 AACCCTCAGCTCCCTGGGATGGG No data
948850675_948850685 12 Left 948850675 2:240703902-240703924 CCAGATACAGCACCTCAGCTTTC No data
Right 948850685 2:240703937-240703959 AACCCTCAGCTCCCTGGGATGGG No data
948850672_948850685 15 Left 948850672 2:240703899-240703921 CCCCCAGATACAGCACCTCAGCT No data
Right 948850685 2:240703937-240703959 AACCCTCAGCTCCCTGGGATGGG No data
948850674_948850685 13 Left 948850674 2:240703901-240703923 CCCAGATACAGCACCTCAGCTTT No data
Right 948850685 2:240703937-240703959 AACCCTCAGCTCCCTGGGATGGG No data
948850670_948850685 28 Left 948850670 2:240703886-240703908 CCCTCTGCTGAAGCCCCCAGATA No data
Right 948850685 2:240703937-240703959 AACCCTCAGCTCCCTGGGATGGG No data
948850673_948850685 14 Left 948850673 2:240703900-240703922 CCCCAGATACAGCACCTCAGCTT No data
Right 948850685 2:240703937-240703959 AACCCTCAGCTCCCTGGGATGGG No data
948850671_948850685 27 Left 948850671 2:240703887-240703909 CCTCTGCTGAAGCCCCCAGATAC No data
Right 948850685 2:240703937-240703959 AACCCTCAGCTCCCTGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948850685 Original CRISPR AACCCTCAGCTCCCTGGGAT GGG Intergenic
No off target data available for this crispr