ID: 948851660

View in Genome Browser
Species Human (GRCh38)
Location 2:240711315-240711337
Sequence TCTCCTGGCTGGGGGCCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 592
Summary {0: 1, 1: 0, 2: 5, 3: 83, 4: 503}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948851651_948851660 0 Left 948851651 2:240711292-240711314 CCCACACACCTATAAAGTCAAGA 0: 1
1: 0
2: 1
3: 13
4: 177
Right 948851660 2:240711315-240711337 TCTCCTGGCTGGGGGCCTGGCGG 0: 1
1: 0
2: 5
3: 83
4: 503
948851652_948851660 -1 Left 948851652 2:240711293-240711315 CCACACACCTATAAAGTCAAGAT 0: 1
1: 0
2: 0
3: 10
4: 157
Right 948851660 2:240711315-240711337 TCTCCTGGCTGGGGGCCTGGCGG 0: 1
1: 0
2: 5
3: 83
4: 503
948851650_948851660 1 Left 948851650 2:240711291-240711313 CCCCACACACCTATAAAGTCAAG 0: 1
1: 0
2: 1
3: 14
4: 176
Right 948851660 2:240711315-240711337 TCTCCTGGCTGGGGGCCTGGCGG 0: 1
1: 0
2: 5
3: 83
4: 503
948851649_948851660 10 Left 948851649 2:240711282-240711304 CCTCTGACACCCCACACACCTAT 0: 1
1: 0
2: 3
3: 32
4: 349
Right 948851660 2:240711315-240711337 TCTCCTGGCTGGGGGCCTGGCGG 0: 1
1: 0
2: 5
3: 83
4: 503
948851653_948851660 -8 Left 948851653 2:240711300-240711322 CCTATAAAGTCAAGATCTCCTGG 0: 1
1: 0
2: 0
3: 9
4: 147
Right 948851660 2:240711315-240711337 TCTCCTGGCTGGGGGCCTGGCGG 0: 1
1: 0
2: 5
3: 83
4: 503

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948851660 Original CRISPR TCTCCTGGCTGGGGGCCTGG CGG Intergenic
900215807 1:1480950-1480972 TCTCCTGGCTGGGGCGGAGGTGG + Intronic
900222944 1:1519004-1519026 TCTCCTGGCTGGGGCGGAGGTGG + Intronic
900399099 1:2465749-2465771 TCTCCTGGCTGAGTGGCGGGCGG + Intronic
900526798 1:3133329-3133351 CCTCGGGGCTGTGGGCCTGGGGG + Intronic
900644425 1:3702565-3702587 CCTCCTGGGTGGGTGCGTGGGGG + Intronic
900977084 1:6024698-6024720 TCTCCGTGCTGGGGGCCAAGAGG + Intronic
901083640 1:6597644-6597666 CCTCCTGTCTGGGGGGATGGTGG + Intronic
901496559 1:9625838-9625860 TCACCTGGCTGGAGGTCTGATGG - Intergenic
901802473 1:11716472-11716494 TCTCCTGGATGGGGGAATTGGGG + Intronic
901871825 1:12142877-12142899 TCGCTGGGCTGTGGGCCTGGTGG - Exonic
902292676 1:15445549-15445571 TCCTCTGGGGGGGGGCCTGGTGG + Intronic
902512752 1:16975148-16975170 TGTCCTGGAAGTGGGCCTGGTGG + Intronic
902874738 1:19334031-19334053 GTCCCAGGCTGGGGGCCTGGAGG - Intergenic
903019105 1:20381170-20381192 TATGGTGGTTGGGGGCCTGGGGG - Intergenic
903019558 1:20384559-20384581 TCCTGTGGCTGGGGGACTGGGGG + Intergenic
903211576 1:21822111-21822133 TCACAGGGTTGGGGGCCTGGGGG + Intronic
903623218 1:24713191-24713213 TCTCATGGCAGAGGTCCTGGAGG + Intergenic
903625107 1:24724843-24724865 CCTGTTGGCTGGGGGCCTGGGGG + Intergenic
903949466 1:26987157-26987179 TCTTCTGGCTGCTGTCCTGGAGG + Intergenic
904079752 1:27864554-27864576 TTTCCTGGCTGGGGGACTTCGGG + Intergenic
904463163 1:30692496-30692518 TCACTGGACTGGGGGCCTGGAGG - Intergenic
904489766 1:30851310-30851332 GCTCATCGCTGGGGCCCTGGAGG - Intergenic
905033167 1:34900987-34901009 GCTGCTGGCTGAGGACCTGGGGG + Intronic
905268520 1:36771447-36771469 TCAGCAGGCTGGGGGCGTGGAGG - Intergenic
906125011 1:43422427-43422449 TCTCCAAGCCTGGGGCCTGGAGG + Intronic
906343947 1:45003733-45003755 TCTCGTAGCTGGGGGCATTGAGG + Exonic
906380904 1:45331736-45331758 TCTCCTCCCTGGGGGGCTTGCGG + Exonic
906396455 1:45470612-45470634 TGTCATGGCTTAGGGCCTGGTGG - Intronic
906448160 1:45921704-45921726 ACTCCTGCTTTGGGGCCTGGTGG - Intronic
907275444 1:53314357-53314379 TCCCCTAGCATGGGGCCTGGTGG - Intronic
909028954 1:70516418-70516440 ACTTGTGGCTGGGGGTCTGGTGG + Intergenic
910224943 1:84926996-84927018 TCCCCTCCCTGGGGGCATGGAGG - Intronic
910428449 1:87138640-87138662 TCTCCTGGGAGGGAGCCTGGTGG + Intronic
912796285 1:112695526-112695548 TGTCCCTGCTGGGGGCCAGGAGG - Exonic
912972168 1:114293768-114293790 TCTCCTGGCAGGGGGCTTAGGGG + Intergenic
913285823 1:117225419-117225441 TCCACTGGCCTGGGGCCTGGAGG + Intergenic
913532000 1:119740256-119740278 ACTCCTGCCTTGGTGCCTGGTGG - Intronic
913971591 1:143421585-143421607 CTCCCTGGCTAGGGGCCTGGGGG + Intergenic
914065968 1:144247198-144247220 CTCCCTGGCTAGGGGCCTGGGGG + Intergenic
914113183 1:144719156-144719178 CTCCCTGGCTAGGGGCCTGGGGG - Intergenic
914750936 1:150534511-150534533 TCTCCTGAGTGGGGGCTGGGGGG - Intergenic
914991814 1:152505258-152505280 AGGCCTGGCTCGGGGCCTGGAGG + Intergenic
917503663 1:175608888-175608910 ACTCCTGCCTGCAGGCCTGGGGG - Intronic
919796709 1:201325358-201325380 CTTCCTGGCTGGGGGACTCGGGG + Intronic
919841051 1:201609660-201609682 TCATCTGGCTGGCGGCTTGGGGG + Intergenic
919936079 1:202251754-202251776 TCTGCTAACTGGGGGCCTGAAGG + Intronic
920051179 1:203166001-203166023 GCTGTTGGCTGGGGGCATGGGGG + Exonic
920704517 1:208241955-208241977 TCTCCTTGGTGGTGGCCTGGAGG - Intronic
921383970 1:214551494-214551516 TCTCCTGGCTCAGGTCCTCGGGG - Intronic
922484710 1:225964395-225964417 ACTCCAAGCTGGGGCCCTGGGGG - Intergenic
922570452 1:226631648-226631670 TCTCAGGGCTGGGGGCCAGAAGG + Intergenic
922572427 1:226642019-226642041 CCTCCTCGGTGGGGGCCTCGGGG + Exonic
922700345 1:227755804-227755826 TCTGCTGGTTGGTGGCCTGCAGG - Intronic
922807308 1:228397106-228397128 TCTCCTGGAGGGGGGGCAGGAGG - Intronic
922881686 1:228985885-228985907 TCTCCAGGCTCTGGGTCTGGCGG - Intergenic
924816677 1:247448097-247448119 ACTCCAGGCTGGGGTCCTGGGGG + Intronic
1063486563 10:6425916-6425938 TCTCCTGGTAGGGGTCCTGTTGG + Intergenic
1063665106 10:8056110-8056132 TCTCCCGGCTGGTGGCCCTGGGG + Intronic
1065390387 10:25175993-25176015 TCTCCTCGCGCGTGGCCTGGAGG - Exonic
1065857512 10:29842295-29842317 TCCCCAGGCTGGTGGCCAGGGGG + Intergenic
1065863446 10:29891853-29891875 TCTCCTGGCTGGAGGCTAGCTGG - Intergenic
1065930268 10:30472911-30472933 CCCCCTGGGTGGAGGCCTGGGGG + Intergenic
1066080655 10:31928325-31928347 TCTCCTCCCTGGGGGCGGGGCGG + Intronic
1067372753 10:45700162-45700184 ACTCCTGGCTGGAGGCCTGCCGG - Intergenic
1067387024 10:45825962-45825984 ACTCCTGGCTGGAGGCCTGCCGG + Exonic
1067419104 10:46131289-46131311 ACTCCTGGCTGGAGGCCTGCCGG - Intergenic
1067447247 10:46358645-46358667 ACTCCTGGCTGGAGGCCTGCCGG - Intergenic
1067504455 10:46837878-46837900 ACTCCTGGCTGGAGGCCTGCCGG - Intergenic
1067590132 10:47502122-47502144 ACTCCTGGCTGGAGGCCTGCCGG + Exonic
1067637253 10:48010217-48010239 ACTCCTGGCTGGAGGCCTGCCGG + Intergenic
1067876237 10:50010117-50010139 ACTCCTGGCTGGAGGCCTGCCGG - Exonic
1068171780 10:53403861-53403883 TCTCCTGGCTGGAGGCCAACTGG + Intergenic
1069851700 10:71409537-71409559 TTTCCTGACTGCTGGCCTGGGGG + Intronic
1069871737 10:71537118-71537140 GCCCATGGCTGAGGGCCTGGGGG + Intronic
1070133847 10:73674646-73674668 ACTCCTGGCTGGAGGCCTGCCGG + Exonic
1070318977 10:75340127-75340149 TCACCTGAATGGGGGCCTGGTGG + Intergenic
1070439778 10:76432209-76432231 TGTCGTGGGTGTGGGCCTGGGGG + Intronic
1070593526 10:77817161-77817183 TATCCTGACTGGTAGCCTGGTGG - Intronic
1070746657 10:78937848-78937870 CCTCCTGGCGGGAGCCCTGGAGG - Intergenic
1070811164 10:79298762-79298784 ACTGCTGCCTGGGCGCCTGGAGG + Intronic
1071256886 10:83879116-83879138 ATTCCTGGCTGGGGTCCTGATGG - Intergenic
1071607867 10:87009836-87009858 ACTCCTGGCTGGAGGCCTGCCGG - Intergenic
1072206814 10:93212157-93212179 TGCCCTGGCTGGCTGCCTGGTGG + Intergenic
1073076310 10:100827436-100827458 TCCCCTGGCTGGGGTCCAGCGGG - Intronic
1073176690 10:101561245-101561267 TCTCCTGGCTGTGGGCCACAAGG + Intergenic
1073618554 10:105023382-105023404 TCTTCTGGCTGGGAGCTTAGAGG - Intronic
1073762820 10:106648951-106648973 TCTCCTGGTCGGTGGCCTGCTGG - Intronic
1074165286 10:110869692-110869714 TCTCCTGGGCGGGGGCCTCCTGG - Intergenic
1075302824 10:121340658-121340680 TCTCCTGGGCGGCAGCCTGGAGG + Intergenic
1075316144 10:121455171-121455193 TCTCCTTCCTGGTGGCCTTGTGG + Intergenic
1075728257 10:124621539-124621561 TCTCAGGGCTGTGGGGCTGGGGG + Exonic
1075782400 10:125026040-125026062 TGCCCTGCCTGGGGACCTGGGGG - Intronic
1076242939 10:128923569-128923591 GCTCCTGGTTGGGGGTATGGGGG - Intergenic
1076286844 10:129307783-129307805 TTTCCTGGCTGCGTGCATGGTGG - Intergenic
1076727221 10:132419470-132419492 TCTCCTGGTGGGGGGCCTGGAGG + Intergenic
1076727278 10:132419585-132419607 TCTCCTGGGGGGGGGCCTGGAGG + Intergenic
1076734489 10:132452624-132452646 TGTCCTGGCTGGGGACCTCTGGG + Intergenic
1077155969 11:1090922-1090944 CCACGTGGCAGGGGGCCTGGGGG + Intergenic
1077298845 11:1838110-1838132 TCTGCAGGGCGGGGGCCTGGGGG + Intergenic
1077308283 11:1877442-1877464 CTCCCTGGCTAGGGGCCTGGGGG - Intronic
1077322607 11:1949029-1949051 TCTCCAGGCTTGGGGCCTGAAGG - Intronic
1077455122 11:2673819-2673841 TCTCCTGGCTGTGGTGCTTGTGG - Intronic
1077501922 11:2913187-2913209 TCACCTGGCTGGGGGGGCGGCGG - Intronic
1077933672 11:6760125-6760147 TGTCATGGGTGGGGGACTGGGGG - Intergenic
1079935342 11:26609160-26609182 TCCCTTGGCTGGGGGCATGGAGG + Intronic
1081588727 11:44406012-44406034 TCTCATGACTGGGGGACTGGAGG + Intergenic
1081715843 11:45249744-45249766 TGTCAGGGGTGGGGGCCTGGGGG + Intronic
1081861546 11:46335882-46335904 CCTCCTGGCAGGGGGACTGGGGG + Intronic
1082813646 11:57494056-57494078 CCTCCAGGCTGGGGGCCTTCTGG + Exonic
1083147088 11:60767753-60767775 TCTCCTAGGTGGGGGCCTGGAGG + Intronic
1083284765 11:61651313-61651335 TCTCTGGGCTGGGGGCGGGGAGG - Intergenic
1083633858 11:64109647-64109669 CCTCCAGGCTGGGGGCAGGGTGG - Intronic
1083776966 11:64898776-64898798 GCTCCTGGCTGGGGGCCGCAGGG + Exonic
1084084193 11:66847417-66847439 TCTCCGGGGTGGGGGGCAGGGGG + Intergenic
1084207560 11:67604824-67604846 CCTCTTGGCTTGTGGCCTGGAGG + Exonic
1084363838 11:68685133-68685155 TGTCCTGGCTGCGGGCGTCGCGG + Intronic
1085026531 11:73239778-73239800 CCTCAGAGCTGGGGGCCTGGAGG - Intergenic
1085409149 11:76281398-76281420 TGTCCTGGCTGGGCTCCAGGCGG + Intergenic
1085784404 11:79438144-79438166 TCTCCTGACTGCGGGCTGGGGGG + Intronic
1086181460 11:83956443-83956465 TCTCCTGGAGGGGAGCGTGGTGG - Intronic
1086349872 11:85934814-85934836 GATCCTGGCAGGCGGCCTGGCGG + Intergenic
1088896683 11:114083713-114083735 TCTCCTGGCTGCGGGGGTGGAGG - Intronic
1089466505 11:118689617-118689639 TCACCTGCATGTGGGCCTGGAGG - Intergenic
1089767631 11:120779403-120779425 TACCCTGGTTGGGGGCATGGTGG + Intronic
1090207109 11:124891456-124891478 TGGCCTGGCTGGGGTACTGGAGG + Exonic
1090248705 11:125236312-125236334 TCTCCAGGCTGGGGTGTTGGGGG + Intronic
1090317521 11:125807048-125807070 TCCCCTGACTGAGGGCCAGGAGG + Intergenic
1090438019 11:126702956-126702978 TCTTCTGGCTGGGCCCCTGAGGG + Intronic
1091150436 11:133323649-133323671 TCTCCTGCCTGGTGGCCTAGTGG - Intronic
1202805624 11_KI270721v1_random:4342-4364 TCTCCAGGCTTGGGGCCTGAAGG - Intergenic
1091399708 12:174636-174658 ACTCCGGGCTGGGGGCCGAGAGG + Exonic
1091680439 12:2523024-2523046 TGTTCCGGCTGGGGGACTGGAGG - Intronic
1092257179 12:6933577-6933599 TCTCCTGGATTGGGGCTTGTAGG + Intronic
1094134864 12:27114373-27114395 TGTCGGGGGTGGGGGCCTGGGGG - Intergenic
1094286796 12:28803202-28803224 TCTGCTGGCTGGTGGCCAGGTGG + Intergenic
1096154007 12:49331843-49331865 GCTTCTGGATGGGAGCCTGGGGG - Intergenic
1096389511 12:51217831-51217853 AGCCCAGGCTGGGGGCCTGGGGG - Intergenic
1096630229 12:52921674-52921696 GCTCCAGGCTGGAGGGCTGGAGG - Intronic
1102111249 12:110366958-110366980 TCTCCTGGCTGTGGGATTTGGGG - Intergenic
1102183738 12:110932100-110932122 TCTCCTGGCTGGGGACTTTGGGG + Intergenic
1102438980 12:112947008-112947030 TCTCCTGTCCCGGGGCCAGGGGG + Intronic
1103127747 12:118438796-118438818 TCCCCTGGGTTGGGGCATGGGGG + Intergenic
1103329516 12:120144485-120144507 TTTTTGGGCTGGGGGCCTGGGGG - Intronic
1103446692 12:120999551-120999573 GGTCCTGGCTGGGGACGTGGAGG - Exonic
1103736219 12:123062400-123062422 GCTGCTGGCTGTGGGGCTGGGGG + Intronic
1103907469 12:124335024-124335046 TGTCCTGGCGGGGTGGCTGGGGG - Intronic
1104221087 12:126785781-126785803 TCTCCTGGCTTGGAGACTGAGGG + Intergenic
1104842093 12:131830212-131830234 TCTCCGGGCAGGGGGGCAGGTGG - Intronic
1105209182 13:18247811-18247833 TGTCCTGGATGAGGGCGTGGTGG - Intergenic
1107086294 13:36431428-36431450 TCTCCGGGCTGGGGGCCGGGCGG - Intergenic
1107156171 13:37169436-37169458 TCTTCTTGGTGGAGGCCTGGAGG - Intergenic
1109308012 13:60661939-60661961 TCTCTTGGCTTGGGGGGTGGGGG + Intergenic
1112427515 13:99316612-99316634 TCTCATGGCTGGGCTCCTTGAGG - Intronic
1113578278 13:111410009-111410031 GCTGTTGGCTGGGGGCCTTGAGG + Intergenic
1113936914 13:113999707-113999729 TGTCCCGGCTGGGGTCCGGGTGG + Intronic
1117071693 14:52063293-52063315 TCTCCTCTCTGGGATCCTGGGGG - Intronic
1117548025 14:56809049-56809071 TGTCGTGGCTCGGGGCCGGGCGG - Intronic
1118495089 14:66300453-66300475 TGTCAGGGGTGGGGGCCTGGGGG + Intergenic
1119223759 14:72928862-72928884 TCTCCAGTTTGGGGGCCTCGGGG - Intronic
1119480336 14:74954632-74954654 TCTCCTGGGTGGGTGGCCGGAGG - Intronic
1119483218 14:74972947-74972969 TCTTCTGGCTGTGTGCCTGCTGG + Intergenic
1119930019 14:78536752-78536774 TGTCATGGGTGGGGGGCTGGGGG - Intronic
1121013624 14:90535477-90535499 TGCCTTGGCTGGGGGCCTGGTGG - Exonic
1121306281 14:92909685-92909707 TCTCTTGGCTAGGGCCTTGGAGG - Intergenic
1121751697 14:96363184-96363206 TCCCCTGGCCTGGGGCCAGGAGG - Exonic
1122603439 14:102932497-102932519 TCTGCTGGATGGGCACCTGGGGG - Exonic
1122975990 14:105170985-105171007 CCTCCAGGCTGGGGGACGGGTGG - Intergenic
1122985653 14:105210506-105210528 TGTCCTGGCAGGGGGCCTCGCGG - Exonic
1124635196 15:31360619-31360641 GCTCCTCCCTGGGGGTCTGGAGG + Intronic
1126038708 15:44570536-44570558 ACTCCTCACTGGGGGCCAGGTGG + Exonic
1126175632 15:45732896-45732918 TGTCCTGGCTGGTGGACTGAGGG + Intergenic
1126284501 15:46996120-46996142 TCCCATGCCTGGGTGCCTGGAGG + Intergenic
1127260406 15:57323082-57323104 TCTCCTGGCTGGACCCCTGCAGG - Intergenic
1127805538 15:62516634-62516656 TCCCATGGCTGAAGGCCTGGTGG + Intronic
1128068582 15:64779434-64779456 GCTCCTTGCTGGAGGCCAGGGGG - Intergenic
1128277272 15:66364054-66364076 AGTGCTGGATGGGGGCCTGGTGG - Intronic
1128278008 15:66370459-66370481 TGTCCTTGGTGGGGGGCTGGAGG + Intronic
1128371050 15:67039631-67039653 GCCCTGGGCTGGGGGCCTGGAGG + Intergenic
1128605704 15:69035376-69035398 TCACCTGGCTGCGGGCCACGTGG + Exonic
1130374138 15:83312993-83313015 TATCCTGGCAGGGGGAGTGGGGG - Intergenic
1131092226 15:89631695-89631717 TGTCCTCGTTGAGGGCCTGGGGG + Exonic
1131121246 15:89824484-89824506 TCCCCTGGGAGGGGGACTGGCGG + Intergenic
1131154740 15:90067821-90067843 ACTCCATGCTGGGGGCCTCGGGG - Exonic
1131268619 15:90933360-90933382 TCTGCTGGCTGGTGGCCTTCTGG + Intronic
1131454285 15:92571151-92571173 TCCTATGGCTGAGGGCCTGGGGG - Intergenic
1131516703 15:93083090-93083112 TCTCCTGACTTCAGGCCTGGTGG - Intronic
1132676561 16:1123590-1123612 TCTCCCTCCTGGGGTCCTGGAGG - Intergenic
1132929301 16:2450826-2450848 TTTCCTGACTGGGGGCCACGTGG - Intronic
1133271232 16:4611765-4611787 TGTCCTGGCTGAGGCCCTGCAGG + Intronic
1133293856 16:4740461-4740483 TCTCCTGTCGGAGGGCCCGGCGG - Exonic
1133981470 16:10635966-10635988 TCCTCTGACTGGGGGCCTGGGGG + Intronic
1134568377 16:15270557-15270579 TCTCCTGCCTGTGGGTCTGGTGG - Intergenic
1134734051 16:16485803-16485825 TCTCCTGCCTGTGGGTCTGGTGG + Intergenic
1134933447 16:18226478-18226500 TCTCCTGCCTGTGGGTCTGGTGG - Intergenic
1135526314 16:23216006-23216028 TCTGCTGCCTGAGGGCATGGAGG - Exonic
1135540329 16:23324935-23324957 GCTCCTGGCATGGGGCCTGGTGG + Intronic
1136246482 16:28979169-28979191 CCTCCTGACCCGGGGCCTGGTGG + Exonic
1136299128 16:29321352-29321374 TCTTCTGGATGGGGGCAAGGAGG + Intergenic
1137406799 16:48195451-48195473 TCTCCTGTCTGCATGCCTGGGGG - Intronic
1137726751 16:50661919-50661941 TCTTCATGCTGGGGCCCTGGGGG + Intergenic
1138027894 16:53537115-53537137 CCTCCTGGCAGAGGGCTTGGCGG + Intergenic
1138083564 16:54114514-54114536 TGTCCTGGGTGGGGCCCAGGTGG + Exonic
1138413178 16:56855487-56855509 ACTCCAGGCTGGGGCCATGGTGG - Intergenic
1138595352 16:58026537-58026559 GCTGCGGGCTGGGGGCTTGGAGG + Intronic
1140476022 16:75239622-75239644 GCTCCTGGATTGGGACCTGGGGG - Intronic
1141142428 16:81505385-81505407 TCTCCAGGCGTGGGGTCTGGAGG - Intronic
1141238430 16:82242293-82242315 TCTCCTGCCTGAGGGGTTGGAGG + Intergenic
1141631475 16:85290314-85290336 ACTCCAGGTTGGGGGCCTGGGGG - Intergenic
1141668684 16:85480174-85480196 ACTCCTGGCTGGGGCCCTTGAGG - Intergenic
1141765140 16:86053164-86053186 TCTGCTGGCTGGGAGCCAGGAGG - Intergenic
1141796302 16:86277680-86277702 TCTCCAGGCTGGGGACGTAGAGG - Intergenic
1141887083 16:86899500-86899522 TCTCCTGGCTGTGTGGCTTGGGG - Intergenic
1141903347 16:87006949-87006971 TCTCCTGTGTGGGGAGCTGGGGG + Intergenic
1141984285 16:87570137-87570159 TCTTCTTGCTGGGGGGCGGGAGG + Intergenic
1142060820 16:88027907-88027929 TCTTCTGGATGGGGGCAAGGAGG + Intronic
1142129993 16:88428075-88428097 CCCCGGGGCTGGGGGCCTGGGGG - Exonic
1142131000 16:88431425-88431447 TCTCCAGGCTGGCGGGCAGGGGG - Exonic
1142132272 16:88436521-88436543 TCTCCAGGCTGGGGGGCTCGGGG - Exonic
1142198651 16:88750729-88750751 TCTCCTCGCAGGGGACCTGAGGG + Intronic
1142285747 16:89170864-89170886 GCTCCAGGCAGGGGGCCTCGGGG + Intergenic
1142304226 16:89276583-89276605 TCTCCTGGCTGGGAGCTTCTGGG - Intronic
1142742573 17:1939825-1939847 CCTCCAGGGTGGGGGCCTGGAGG - Intronic
1143112109 17:4558647-4558669 TCTACTGGCGGGAGACCTGGGGG - Exonic
1143623498 17:8094919-8094941 TCACGTGGCTGGGGGCTTTGCGG - Intergenic
1143719253 17:8798689-8798711 CCTCTTGGCTGGGTGGCTGGAGG + Exonic
1144783034 17:17817329-17817351 CCTCCTTGCTGGGGGCCCGGGGG - Exonic
1144809164 17:17987686-17987708 CCTCCTGGCTGGGGACATGTGGG - Intronic
1145414392 17:22703222-22703244 TTGACTGGCTGGGGGCCTGTTGG + Intergenic
1145819844 17:27823873-27823895 GCTCCTGGCTGGGGGCCTCCTGG + Intronic
1146176192 17:30667824-30667846 TCTCCAGGCTGGGCGCGGGGAGG + Intergenic
1146349650 17:32083935-32083957 TCTCCAGGCTGGGCGCGGGGAGG + Intergenic
1146456768 17:33014958-33014980 CTTCCTGGCTGTGTGCCTGGGGG - Intronic
1146724702 17:35147791-35147813 TCTCTTGGGTGGGGGCTGGGAGG + Intergenic
1146970052 17:37065266-37065288 TCTCCTGTGGGGAGGCCTGGGGG + Intergenic
1147017788 17:37506367-37506389 TTTCCTGGCTTGGGGGATGGGGG - Intronic
1147156487 17:38546797-38546819 TGGCCTGGCTGGAGGCCTGTTGG - Intronic
1147212576 17:38880475-38880497 TCTTTTGGCTGGAGGCCAGGAGG - Intronic
1147217877 17:38911537-38911559 TCCCCTGGCTGGGGTGGTGGGGG - Intronic
1147627476 17:41909402-41909424 TCTCCTCTCTGGGAGCCAGGTGG - Intronic
1147792921 17:43024764-43024786 TGTCCTGGCAGGGGGTCTTGGGG - Intronic
1147793037 17:43025174-43025196 CCGCCTGGCTGGGGGCGGGGCGG + Intergenic
1148127252 17:45243207-45243229 TCGCCTTGCTGGGGGCCTTCTGG - Exonic
1151453661 17:74213897-74213919 CCTCCTGTCTGGGAACCTGGGGG + Intronic
1151534235 17:74729701-74729723 TCTCCTGGCTGCCTCCCTGGGGG - Intronic
1151758821 17:76089367-76089389 ACTCCTGGCTGGGGGCGGCGTGG + Intronic
1151820326 17:76493488-76493510 AAGGCTGGCTGGGGGCCTGGGGG + Intronic
1151822834 17:76506422-76506444 TCTCCCTGCTGGAGGCCTGGGGG - Intergenic
1151882978 17:76905938-76905960 TCTCCTGGCCGGTGCCCCGGGGG + Intronic
1152134159 17:78494223-78494245 TCTTCTCGCTGGGAGGCTGGGGG + Intronic
1152360778 17:79832198-79832220 CCGCGGGGCTGGGGGCCTGGCGG - Intergenic
1152534780 17:80944143-80944165 GCTCGTGTTTGGGGGCCTGGTGG + Intronic
1152615503 17:81336086-81336108 TCTCATGGGTGGGGGCATGTGGG - Intergenic
1152626494 17:81390161-81390183 TCGACAGGCTGGGGGGCTGGGGG + Intergenic
1152748722 17:82052740-82052762 TCTCCCAGCTGGGGGCCATGAGG + Intronic
1153623233 18:6999500-6999522 TTTGCAGGCTGGGGGCCTCGGGG - Exonic
1154969065 18:21388984-21389006 TCACCTGGCTGAGGGGCTGAAGG + Intronic
1155182194 18:23357557-23357579 TCTCAGTTCTGGGGGCCTGGGGG + Intronic
1156078811 18:33311512-33311534 TCTCCTGGTTAGGGGACTGAGGG - Intronic
1157161163 18:45315634-45315656 ACTCCTGACTGGGGGCTTGAGGG + Intronic
1157548634 18:48565417-48565439 TCTCCTGCCTTGGGGCATGTGGG + Intronic
1159616676 18:70588059-70588081 TCTCCAGCCTGGCAGCCTGGGGG + Intergenic
1159770392 18:72541764-72541786 TCCCCGGGCTGGGGGCGGGGTGG + Intronic
1160227646 18:77023738-77023760 TCCCCAGGGTGGGGACCTGGAGG - Intronic
1160269230 18:77368998-77369020 TCTCCTGGCTGTGGTCAGGGAGG - Intergenic
1160897834 19:1411029-1411051 GCTCCTGGCTGGGCCCCTAGAGG + Intronic
1161285770 19:3467529-3467551 TCTGCTGCCTGGGGACCTGCAGG - Intronic
1161318794 19:3631640-3631662 TGTCCTCGCTGGGGACCTCGGGG + Exonic
1161322178 19:3646388-3646410 TGGCCTGGCTGGGGCCCTGCTGG + Intronic
1161800611 19:6415247-6415269 TAGTCTGGCTGGGAGCCTGGGGG + Exonic
1162003926 19:7765231-7765253 GCTCTTGGCTGGGGTCCTGGTGG + Exonic
1162532835 19:11245754-11245776 TCTCCTTGTTGGGGGGCTGTGGG - Intronic
1162552254 19:11364395-11364417 ACACATGGCTGGGGCCCTGGAGG - Exonic
1162738573 19:12760623-12760645 TGGCCAGGCTGGGGTCCTGGAGG - Intergenic
1162794521 19:13079612-13079634 CCTCCTGGCTGGGAGCCCAGAGG + Intronic
1163034439 19:14562967-14562989 TAGCCGGGCTGGGGGCCTGCTGG + Intronic
1163076312 19:14895001-14895023 TCTGCTGGCGGGGGGGGTGGTGG + Intergenic
1163218538 19:15897927-15897949 GCTCCTGGGTGCTGGCCTGGAGG - Intronic
1163664990 19:18598979-18599001 ACTCCAAGGTGGGGGCCTGGTGG - Intronic
1163815190 19:19460795-19460817 TCACCTGGCTGGAGGACTGCAGG - Intronic
1163826756 19:19528422-19528444 TCTCCAGGCTGGGGGCCCCTGGG + Intronic
1164635941 19:29791579-29791601 CGTCCTGGCTGGTGGCCTTGAGG + Intergenic
1165090894 19:33387952-33387974 CCTCCTGGATGAGGCCCTGGCGG - Exonic
1165139184 19:33688868-33688890 GTTACTGACTGGGGGCCTGGAGG + Intronic
1165145518 19:33727650-33727672 CCTCCTTCCGGGGGGCCTGGAGG - Intronic
1165751840 19:38264952-38264974 GCTCCTCTCTGGGGTCCTGGCGG + Exonic
1166565923 19:43765487-43765509 GCTTCCGGCTGGGGGCCTGAGGG + Intergenic
1166781474 19:45345667-45345689 TGGCCTGGCTGGGCACCTGGCGG + Exonic
1167074999 19:47243243-47243265 GCTCCGGGCTGGGGGCTGGGAGG + Intergenic
1167169211 19:47820021-47820043 TCTCCTAGCAGGGGGTTTGGGGG + Intronic
1167211321 19:48135892-48135914 TCTCCTGGGTGGGGGGGAGGGGG - Intronic
1167301140 19:48678446-48678468 TCTGCAGGCTGGTGACCTGGAGG - Intergenic
1167384079 19:49153911-49153933 GCCTGTGGCTGGGGGCCTGGTGG + Exonic
1167385007 19:49157938-49157960 CCTCCTCTCTGGGAGCCTGGAGG - Intronic
1167583443 19:50359704-50359726 TCTCCTGGCTCTGGAGCTGGAGG - Intronic
1168094481 19:54106863-54106885 ACTCCAGGCTGGGGCCCTGAGGG - Exonic
1168242997 19:55096554-55096576 TCTCATGGGTGGGGGCCGTGAGG - Intronic
1168642399 19:58038910-58038932 CCTCCTTGCTGGGGCCCTGCTGG - Intronic
1168643519 19:58045371-58045393 TCTCCTGGATGGTGTCCTGGAGG - Intronic
925731610 2:6922963-6922985 TCACCTGGCTGGTGATCTGGTGG + Intronic
926434930 2:12827931-12827953 TCTGCTGGTTGGTGGCCTGCCGG + Intergenic
926569206 2:14510931-14510953 TTTCATGGCAGGGGGCATGGGGG + Intergenic
927089623 2:19700647-19700669 TCTGCTGGGTGGTGGCCTGGTGG - Intergenic
927855351 2:26524125-26524147 TCTCTTGGATGGGGGCAGGGAGG + Intronic
928242969 2:29602460-29602482 TCTCCAAGCAGGTGGCCTGGTGG - Intronic
929761068 2:44806551-44806573 TTTCCTCCCTGGGGGACTGGAGG - Intergenic
930089351 2:47520625-47520647 TGCCCTGGGTGTGGGCCTGGGGG + Exonic
930090329 2:47527187-47527209 TCCCCTGGCTGTGGTCCTGGAGG - Intronic
931694986 2:64864986-64865008 TCTCCGGGGTGGGGTCCTGGGGG - Intergenic
932655921 2:73611106-73611128 GCCCATGGCTGGTGGCCTGGGGG - Intergenic
932769127 2:74490664-74490686 TCGCCTGGCTGAGGAGCTGGTGG + Exonic
933129401 2:78654742-78654764 TCTCTTGGCTGGGGGATGGGGGG - Intergenic
934176287 2:89582518-89582540 CTCCCTGGCTAGGGGCCTGGGGG + Intergenic
934286597 2:91656879-91656901 CTCCCTGGCTAGGGGCCTGGGGG + Intergenic
934719567 2:96564197-96564219 TCTCCTGCCTGGTTCCCTGGAGG + Intergenic
935500795 2:103835883-103835905 ACTCCAGCCTGGGGGCCTGGGGG + Intergenic
935918078 2:107979463-107979485 TGTGGTGGCTGGGGGGCTGGGGG + Intergenic
937078701 2:119125368-119125390 TCTCCTGGCTGGAGGCAGGAAGG + Intergenic
937195893 2:120156227-120156249 TGGCCAGGCTGGGGTCCTGGGGG - Intronic
937330112 2:121021358-121021380 TCTCCCGGCTGGGGGCATTTTGG - Intergenic
938030224 2:127985942-127985964 TCTGCTGGTCGGGGGCCTGCTGG - Intronic
938038192 2:128053800-128053822 GCTGCTGGCTGAGGGGCTGGGGG + Intergenic
942156350 2:173132541-173132563 TCTCCTGGGTGGAGGCAAGGAGG - Intronic
944118846 2:196218524-196218546 TCTCCTGGGTCCGGGCGTGGTGG + Intronic
944713781 2:202359366-202359388 ACTCCAGCCTGGGGGCCTGGGGG - Intergenic
946412048 2:219520315-219520337 TGTCCTGGCTGGCGGCTGGGTGG - Intronic
947764763 2:232630469-232630491 TGTCTAGGCTGGGTGCCTGGTGG + Intronic
947769862 2:232662143-232662165 TTTCCTGGCTGGGGGCTGGGGGG + Intronic
947932499 2:233975358-233975380 GCTCCTGGCTGTGGGGCTGTGGG - Intronic
948135772 2:235635093-235635115 TCTCCTGCCTCAGGACCTGGTGG + Intronic
948200154 2:236123975-236123997 ACTCCTGGCTGGAGGCCTGCCGG - Exonic
948209255 2:236179836-236179858 TCTCCTGGCTGAGGGCCTCTGGG + Intergenic
948376707 2:237525639-237525661 TCACAAGGCTGAGGGCCTGGAGG + Exonic
948851660 2:240711315-240711337 TCTCCTGGCTGGGGGCCTGGCGG + Intergenic
949003771 2:241633661-241633683 GCTCCTGGCTGGCGGCCTCCTGG + Exonic
1170270995 20:14527134-14527156 TCTGCTGGTTGGTGGCCTGCTGG + Intronic
1170293116 20:14793440-14793462 TATGCTGGCGGGGGGCATGGTGG - Intronic
1171190615 20:23156641-23156663 TCACCTGGCTGGGGGTCAGGGGG + Intergenic
1171393791 20:24817944-24817966 TCTCCTGGGTGAGGGAGTGGTGG - Intergenic
1171448414 20:25220444-25220466 ACTCCCTGCTGGGGTCCTGGGGG + Intronic
1172216299 20:33238068-33238090 CCTGCTGTCTGGGGGCCTGTTGG + Exonic
1172248544 20:33462973-33462995 TCTCCAGGCTGGTGGCCTCAGGG + Intergenic
1172883596 20:38217193-38217215 TCCCCTGGCTGGGGCTATGGTGG - Intronic
1173968505 20:47132233-47132255 ACACCTCGCTGGGGGCATGGTGG - Intronic
1174113511 20:48212177-48212199 CCTCCTGTCAGGAGGCCTGGTGG - Intergenic
1174844562 20:53930619-53930641 TCTCCTGGCAGGAGGGCAGGAGG + Intergenic
1175333507 20:58180069-58180091 TCTCCTGGCTGTGGCGGTGGGGG - Intergenic
1175677318 20:60957951-60957973 TTTCCTGACTTGGGGCCTTGGGG - Intergenic
1175892138 20:62320633-62320655 TCTCATGGCGGGGGCCCAGGGGG + Exonic
1175908359 20:62392853-62392875 TGTCCTGGCTCGGGGCGTGTGGG - Intronic
1176075273 20:63245441-63245463 CCTCCTGCCTGGGGACCTGCAGG + Intronic
1177143627 21:17383990-17384012 TGTCGTGGGTGGGGGACTGGGGG + Intergenic
1177893400 21:26833632-26833654 CCTCCTGGCTGGAGGCCAAGTGG + Intergenic
1178248655 21:30979224-30979246 TCTACTGCTTGGGGGCCTGCTGG + Intergenic
1179841616 21:44079455-44079477 TGTCCTGGCATGGGGTCTGGAGG + Intronic
1180149578 21:45940798-45940820 GTGCCTGGCTGGGGGGCTGGTGG - Intronic
1180156013 21:45977714-45977736 TGGCCTGGATGGGGGCTTGGGGG + Intergenic
1180705040 22:17804270-17804292 GCCCCAGGCTGAGGGCCTGGAGG + Intronic
1180767073 22:18351486-18351508 TGTCCTGGATGAGGGCGTGGTGG + Intergenic
1180779238 22:18510893-18510915 TGTCCTGGATGAGGGCGTGGTGG - Intergenic
1180811957 22:18768213-18768235 TGTCCTGGATGAGGGCGTGGTGG - Intergenic
1180963484 22:19773526-19773548 CCTTCTGGCTGGCCGCCTGGAGG - Intronic
1180970146 22:19810951-19810973 AGTGCTGGCTGGCGGCCTGGGGG + Intronic
1181037070 22:20174809-20174831 GCTCCTGGCTGGGGTCCAGGTGG + Intergenic
1181198112 22:21202457-21202479 TGTCCTGGATGAGGGCGTGGTGG - Intergenic
1181401632 22:22653347-22653369 TGTCCTGGATGAGGGCGTGGTGG + Intergenic
1181647920 22:24243770-24243792 TGTCCTGGATGAGGGCGTGGTGG - Intronic
1181804378 22:25366210-25366232 CCTCCTGGTTGGGGGCCTTTGGG - Intronic
1181956218 22:26589723-26589745 TCTGTTGGCGGGGGGACTGGGGG - Intronic
1183019073 22:35012767-35012789 TCTACTGGCTGGGTGGCTGCAGG + Intergenic
1183186587 22:36294994-36295016 TCTCCTGGATCTGGGCCTCGTGG + Exonic
1183779472 22:39989524-39989546 TCTCCTCCCAGTGGGCCTGGGGG + Intergenic
1183930823 22:41235181-41235203 TCTCCTGGCACTGGGCCTGGAGG + Exonic
1183948999 22:41342362-41342384 TCCCCTGGCTGGGAGGGTGGAGG + Intronic
1183974065 22:41500185-41500207 TCTCCAGGCACTGGGCCTGGTGG - Intronic
1183989473 22:41588709-41588731 TGCCCTGGCTTGGGCCCTGGAGG - Intronic
1184156275 22:42669586-42669608 TCTCCTGCCTGGGAGACTGCGGG + Intergenic
1184258346 22:43300123-43300145 TCTCCTGGGTGGATACCTGGGGG + Intronic
1184469966 22:44690834-44690856 TCTCCTGGTTCGGGGGGTGGCGG + Intronic
1184523991 22:45010674-45010696 CCTCCTGGCTGCGCGGCTGGGGG - Intergenic
1184867402 22:47209355-47209377 GCCCCTGGCTGGTGGCCAGGAGG - Intergenic
1185005927 22:48277019-48277041 AGTCCTGGATGGGGCCCTGGAGG - Intergenic
1203228695 22_KI270731v1_random:92380-92402 TGTCCTGGATGAGGGCGTGGTGG + Intergenic
949095259 3:78044-78066 TCCTCTGGCTGGGGGCCTGGTGG + Intergenic
950417871 3:12878651-12878673 TCTGCTGGCTTTGGGCCTTGAGG + Intergenic
950430400 3:12947642-12947664 TGTCCTGGATGGGCCCCTGGTGG + Intronic
950678943 3:14571646-14571668 TCACCTGGCAGGGGAGCTGGAGG + Intergenic
950684552 3:14607154-14607176 AGCGCTGGCTGGGGGCCTGGAGG - Intergenic
950815747 3:15700292-15700314 TGTCCGGGGTGGGGGCCTGGGGG + Intronic
950860596 3:16144631-16144653 TCTTCTGGAAGGGTGCCTGGAGG + Intergenic
952503879 3:33989674-33989696 TCCCTTGGCTGGGGGGGTGGGGG + Intergenic
953470577 3:43162775-43162797 TCTCCTGCCTAGGGGTCTGTAGG + Intergenic
953674861 3:44993074-44993096 GTTCCTGGCTGAGGGGCTGGGGG + Intronic
953788599 3:45929496-45929518 ATTCAGGGCTGGGGGCCTGGTGG + Intronic
953891071 3:46751960-46751982 CCTCCAGCCTGGGGGACTGGAGG - Intronic
954107265 3:48416068-48416090 GCTCCTGACTGGGCGGCTGGAGG - Exonic
954392411 3:50274604-50274626 GGGCCTGGCTGGGAGCCTGGGGG - Intronic
954615414 3:51966810-51966832 CTTCTTGGCTGGGGTCCTGGGGG - Intronic
954882591 3:53846019-53846041 TCTCCGGGCTAGCGGCCGGGCGG + Intronic
959862297 3:111229877-111229899 TCTACTGTCCTGGGGCCTGGAGG - Intronic
960854903 3:122092761-122092783 ACTCATGGCTGGTGGCCTGTGGG - Intronic
960993661 3:123327594-123327616 TCTGTGGGCTGGGGGCCGGGGGG - Intronic
961359926 3:126360652-126360674 GCTCAGGGCTGGGGGGCTGGGGG - Intergenic
961378692 3:126483263-126483285 TCTCCTGGGTGTGGGGATGGGGG - Intronic
961493413 3:127273519-127273541 GCTGCTGGCTGGGGGCCAGTGGG + Intergenic
961604475 3:128083499-128083521 TCTCCAGGCTGGGACCCTGCGGG + Intronic
962006237 3:131352629-131352651 ATTCCTGGCTGGGAGGCTGGGGG + Intergenic
962751740 3:138438769-138438791 TCCCATGGCTGGGGACCTGGAGG - Intronic
966851566 3:184168095-184168117 TCTCCTGGCTGGGAGTGGGGAGG + Intronic
966940081 3:184740771-184740793 TCGCATGGCAGGGGGCTTGGTGG + Intergenic
967089620 3:186124526-186124548 TCTCATGTCTGGGGTCCTGATGG + Intronic
967955886 3:194876903-194876925 CCACCTGGCTGGGGGCTTGGGGG + Intergenic
968090347 3:195895254-195895276 GCGCCTGGCTGGGGGCGAGGAGG - Exonic
968565765 4:1311908-1311930 TGTCCTGGGTGTGGGGCTGGTGG + Intronic
968584883 4:1411675-1411697 CCTCCTGAGTGGGGGTCTGGGGG + Intergenic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
968684924 4:1951637-1951659 TGGCCTGGCTGGGGTCCTGTGGG - Intronic
968902956 4:3439781-3439803 CCTCCTGGCTGGGCTCCTGAGGG - Exonic
968937664 4:3620921-3620943 TCTCCTGGGCAGGAGCCTGGGGG + Intergenic
969359871 4:6656761-6656783 CCTGCTGGCTGGGGGACTGAGGG - Intergenic
969582044 4:8071312-8071334 GCTCCTTGCTGGGGTCCTGTGGG - Intronic
971531548 4:27695035-27695057 TCTCCTTTCTGGAGGCCTTGTGG + Intergenic
979255353 4:118602468-118602490 TCTGCGGGTTGGGTGCCTGGAGG - Intergenic
979303450 4:119114342-119114364 TCTTCTAGCTAGGGTCCTGGAGG + Intergenic
979468693 4:121071219-121071241 TCTCCTGGCTGGGGCCGTAGGGG + Intronic
980184565 4:129446021-129446043 TCCCTTGGCCGGGGGCATGGGGG - Intergenic
981920418 4:150079210-150079232 TCTCCGAGCTGAGGGCCTGCAGG - Exonic
982068590 4:151675460-151675482 ACTCCTGGCTGGAGTCCAGGAGG + Intronic
982585276 4:157229006-157229028 TATCCTGGTTGGGGGCAGGGAGG - Intronic
983943218 4:173558179-173558201 TGTCCTGGCTCCCGGCCTGGGGG + Intergenic
984409028 4:179371489-179371511 TCTCCTTAATGGGGGGCTGGTGG - Intergenic
985260041 4:188106593-188106615 TCTCCTGGCCGGTCACCTGGAGG - Intronic
985538178 5:475890-475912 TCCCCTGCCTGGGTGGCTGGAGG + Intronic
985861105 5:2471332-2471354 ACTACTGGCTGGGGGGTTGGGGG + Intergenic
986771387 5:10977146-10977168 CTTCCTGGCTGGGGGACTGAAGG + Intronic
988038122 5:25853566-25853588 TCTGCTGGTTGGTGGCCTGCTGG + Intergenic
988513912 5:31888928-31888950 TCTCCTGGCTCTGGGCATGAGGG - Intronic
989322998 5:40158926-40158948 TGTCCAGGGTGGAGGCCTGGAGG + Intergenic
989456180 5:41646962-41646984 TGTCCTGTCTGAGGGCATGGTGG - Intergenic
992104096 5:73436367-73436389 TGGCCTCGCTGGGGGCCGGGCGG - Intergenic
995458094 5:112373179-112373201 TCTCCTGGCTGTGGCTCTGCTGG + Intronic
995666099 5:114544462-114544484 TCCCTTGGCTGGGGGCCGTGGGG - Intergenic
996532867 5:124544498-124544520 TTTCCTGGCTGAGGGGCTGAGGG - Intergenic
997120109 5:131164944-131164966 TCCGCTGGCTGGGGGCCCGCTGG + Intronic
997284450 5:132668182-132668204 TCTCCTGGGTGCTGGCCTGCAGG + Intergenic
997319076 5:132963290-132963312 TCTCCTGGCTGCGGCAGTGGCGG + Exonic
997461300 5:134054327-134054349 TCTCCTGGCTGGAGAAATGGAGG + Intergenic
998193009 5:140042830-140042852 TCTCCGGGCTGCGGGGCTGCGGG + Exonic
999007333 5:147997054-147997076 TGCCCAGGATGGGGGCCTGGTGG + Intergenic
999171554 5:149599360-149599382 TCCCCTGCCTGAGGGCCTGCAGG - Intronic
999266302 5:150269159-150269181 CCTCCTGCCTGGGGACCTGGGGG + Intronic
999277544 5:150341388-150341410 TCTGCTTGATGGGTGCCTGGAGG + Intergenic
1000041377 5:157487524-157487546 TTTCCTGGGTGGCGGCCGGGTGG - Intronic
1001109432 5:168883584-168883606 CCTCTTGGCTCGTGGCCTGGAGG - Intronic
1001159347 5:169300350-169300372 TCTCCGAGCTGGGGGTCTGTAGG - Intronic
1001722061 5:173864902-173864924 TCTCCAGGCTGAGAACCTGGAGG - Intergenic
1002200374 5:177524504-177524526 TAGGCTGGCTGGGGGCCGGGGGG + Exonic
1002419801 5:179139605-179139627 TCTCCTGGCCACGGGCATGGAGG - Intronic
1002779417 6:354756-354778 TCTCCGGGCTGGGGTGCTGCTGG + Intergenic
1002991806 6:2245519-2245541 TCTCCAGGCTGCGGGCAGGGAGG + Exonic
1003128667 6:3376816-3376838 CCTCCTGGCTGGGAGGGTGGGGG + Intronic
1003271157 6:4609022-4609044 ACCCCTGGCTGCGGGCCTGAGGG + Intergenic
1003621853 6:7707686-7707708 TTTCCTGGCTCGGTACCTGGAGG + Intergenic
1003728387 6:8792218-8792240 TCTTCGGGCTGGGGGCTGGGTGG - Intergenic
1003927242 6:10887663-10887685 TCTTCTGCCTGGGTTCCTGGTGG + Intronic
1004515822 6:16321506-16321528 GCACCTAGGTGGGGGCCTGGGGG + Intronic
1005342585 6:24857227-24857249 GCTCTTGTCTGGGGGCCTGCTGG + Intronic
1005986399 6:30878436-30878458 TGTCCTGGCTGGAGGCTTAGGGG + Intronic
1006154987 6:32009096-32009118 TCTCCTACCGAGGGGCCTGGTGG - Intergenic
1006161298 6:32041831-32041853 TCTCCTACCGAGGGGCCTGGTGG - Exonic
1006176950 6:32128213-32128235 TCTCCTGGTTGGGGGGTGGGGGG - Exonic
1006259053 6:32853415-32853437 TGCTCTGGCTGGGGGCCTGCGGG - Exonic
1006368910 6:33632647-33632669 GGTCCTGGCTGGAGGCCTGTGGG - Intronic
1006471980 6:34234906-34234928 GCACCGGGCTGGCGGCCTGGCGG - Intergenic
1006793916 6:36720443-36720465 TGACCTGGCTGGGCGGCTGGAGG + Exonic
1006860857 6:37170707-37170729 TCTCCTGGGTGGGGAGCTGGCGG + Intronic
1007417621 6:41701238-41701260 TCTCCTGGGTTGGGGAGTGGTGG + Intronic
1007424675 6:41739326-41739348 TGTGCAGGATGGGGGCCTGGAGG - Intronic
1007742597 6:44021885-44021907 TCTCCAGGCCTGAGGCCTGGTGG - Intergenic
1007743173 6:44025104-44025126 TCTCCAGGCCTGAGGCCTGGTGG - Intergenic
1011253068 6:85393474-85393496 TTTCCTGCCTGGGAACCTGGGGG - Intergenic
1012714427 6:102650042-102650064 TCTCCTGGATTGGTCCCTGGTGG - Intergenic
1015126594 6:129762109-129762131 GCCCCTGTCTGGGGGCCTGGAGG + Intergenic
1015297919 6:131619840-131619862 TATCCTTGCTGTGGGCCTGAAGG + Exonic
1016879230 6:148894545-148894567 GCTCCTGCCTGGGGGTTTGGAGG - Intronic
1017041678 6:150313327-150313349 TCTGGTGGCTGGGGGCAGGGAGG - Intergenic
1017823308 6:158064267-158064289 TCTCCTGGCTGGGGGGTCGGGGG + Intronic
1018088093 6:160322099-160322121 TGTAGTGGCTGGGGGCCTGCAGG - Intergenic
1018189624 6:161298978-161299000 TCTCCTGACAGGGGGCATAGTGG - Intergenic
1018369085 6:163150527-163150549 TCCCATGGCTGGGGGACAGGAGG - Intronic
1018743618 6:166748299-166748321 TCTCCTGCCTGGGGAGGTGGTGG - Intronic
1018840695 6:167514327-167514349 TGGCAGGGCTGGGGGCCTGGGGG + Intergenic
1018940751 6:168307843-168307865 TCTCCTGGCCACGGGCCTGGGGG + Exonic
1019558749 7:1645504-1645526 GCCCCTGGCTGTGGGCCCGGAGG - Intergenic
1019568573 7:1697187-1697209 TCTCCTGCCTGGAGGGGTGGGGG - Intronic
1020014391 7:4822343-4822365 TCCCCTGCCTGGGGTGCTGGCGG + Intronic
1020688282 7:11322909-11322931 TCTCCTGGATGGAGGCCTAGAGG + Intergenic
1020899996 7:13991572-13991594 TCACGTGGTTGGGGGCGTGGAGG + Intergenic
1021969464 7:25951673-25951695 TCTCCTGGCTGGGGAGGAGGCGG + Intergenic
1022466956 7:30658420-30658442 TGGCCTAGCTGGGGGCCTGGAGG + Intronic
1022526972 7:31044416-31044438 TCTCTGTGCTGGGGGGCTGGAGG + Intergenic
1023035244 7:36125984-36126006 TGTTGTGGGTGGGGGCCTGGGGG + Intergenic
1023828360 7:44024718-44024740 TCTCCTGGCTGTGGCCTTGGTGG - Intergenic
1023873423 7:44274710-44274732 TCTGCTGGCGGGTGGCCTGGAGG + Intronic
1023966765 7:44966919-44966941 TCTCCTGGCCTGGGACCTTGAGG - Intronic
1024018863 7:45347069-45347091 TCTGTTGGCTGCAGGCCTGGGGG - Intergenic
1024524972 7:50340304-50340326 TCTCCTGGCAGCAGGCCTTGCGG - Intronic
1024633170 7:51265597-51265619 TCTCCTGGTTGGGGTTCTGTGGG - Intronic
1025032047 7:55565731-55565753 TCTCCTGGCTGCAGGGGTGGAGG + Intronic
1026146052 7:67747675-67747697 ACTCCTGGCTGGGAGCTGGGAGG + Intergenic
1026575892 7:71571278-71571300 TATCATGGCTGGGGTCCTGAGGG - Exonic
1026829254 7:73601060-73601082 TCTCCTGGCAGGGGGGTGGGAGG - Intronic
1026977769 7:74508809-74508831 TCTCCTAGCAGGTGACCTGGGGG + Intronic
1027269834 7:76513249-76513271 CCACAGGGCTGGGGGCCTGGAGG + Intronic
1029157740 7:98529180-98529202 CCACATGGCTGGGGGCCTGGGGG - Intergenic
1029756660 7:102578165-102578187 TCTCCTGGCTGTGGCCTTGGTGG - Intronic
1029774600 7:102677234-102677256 TCTTCTGGCTGTGGCCTTGGTGG - Intergenic
1031992604 7:128207832-128207854 TCCCATGGCAGGGGGGCTGGAGG - Intergenic
1032119449 7:129145422-129145444 TTTCAGGCCTGGGGGCCTGGAGG + Intronic
1033780899 7:144667806-144667828 ACTGGTGGCTGGGGGCCTCGAGG + Intronic
1034447742 7:151122143-151122165 TCTTCTGTCTGGGGACCCGGTGG + Intronic
1034464543 7:151218810-151218832 TCTCCTTGCTCTGGGCCTGCCGG + Exonic
1034970926 7:155418638-155418660 TTTCCAGGCAGTGGGCCTGGGGG + Intergenic
1035727221 8:1832048-1832070 CCTCCTGACTGTGGGGCTGGAGG + Intronic
1035734729 8:1879917-1879939 TGTCCTGGCTGGGGGCTTCTGGG - Intronic
1036579663 8:10062100-10062122 GGTCCTTGCTGAGGGCCTGGCGG - Intronic
1036660484 8:10705189-10705211 CATCCTGGCTGGGGGTGTGGTGG - Intronic
1037513875 8:19610585-19610607 TCTGCTGGTTGGTGGCCTGCTGG - Intronic
1037674339 8:21041197-21041219 TCTCCAGGCTGAAGGGCTGGAGG - Intergenic
1037677798 8:21066865-21066887 TGTGCTGGCTAAGGGCCTGGGGG - Intergenic
1037805274 8:22055236-22055258 TCTCCTGGGGTGGGGCCTGGTGG + Intronic
1037855979 8:22370869-22370891 CCTCCAGGCTGGTGGGCTGGTGG + Intronic
1039433811 8:37545970-37545992 TCTCCAGGCATGGGGCTTGGGGG - Intergenic
1040470672 8:47733660-47733682 TCTCCAGGCTGCTGGACTGGAGG - Intronic
1040798019 8:51308386-51308408 TGTCCTGGGGAGGGGCCTGGTGG + Intergenic
1044127316 8:88474388-88474410 TGACCAGGCTGGGGTCCTGGGGG - Intergenic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1047029510 8:120861620-120861642 CCTCCTGGCTGGAGGCCAGCTGG - Intergenic
1047334405 8:123922105-123922127 GCTCCTTGCAAGGGGCCTGGAGG - Intronic
1048998037 8:139806271-139806293 TCCCATGGGTGGGGGCCCGGCGG + Intronic
1049257053 8:141619788-141619810 TCTCTTGGGAGGGGTCCTGGAGG - Intergenic
1049592340 8:143468350-143468372 TGCCCTCGCTGTGGGCCTGGGGG - Intronic
1049658918 8:143811065-143811087 TCTGCAGGCTGCGGGCCGGGCGG + Exonic
1049671759 8:143873128-143873150 GCTCCTGGCCTGGGGCCTGGGGG + Exonic
1049717320 8:144099106-144099128 GCAGCTGGCTGGGGGCCTGGGGG + Exonic
1049841720 8:144777547-144777569 ACTCCAGGCTTGGGGCCTGCAGG + Exonic
1049961550 9:742425-742447 CCTCCTGGCCAGGGGTCTGGGGG + Intronic
1050820384 9:9871812-9871834 TCTTCTGGAAAGGGGCCTGGGGG + Intronic
1051008074 9:12373622-12373644 TCTCCTTGATGGGAGCCTGAGGG - Intergenic
1051263991 9:15293613-15293635 TCACCTGGCTGGGGTACAGGTGG - Intronic
1052812829 9:33076536-33076558 GCGCCTTGCCGGGGGCCTGGAGG - Intronic
1052989249 9:34509158-34509180 TGTCCTGGGTGGGGACCAGGGGG + Intronic
1053284133 9:36839537-36839559 TCCACTTGCTGGGGTCCTGGAGG + Exonic
1053391723 9:37740866-37740888 TCACCTGACGGGGGGCCTGGGGG - Exonic
1054453492 9:65416770-65416792 TCTCCTGGGCAGGAGCCTGGGGG - Intergenic
1056243381 9:84670267-84670289 TCTCCGGGCTGGGGTCGGGGTGG + Intronic
1056643158 9:88388248-88388270 TCACCTGGCTGGCGGCAGGGCGG - Intergenic
1057496116 9:95562724-95562746 TGCCCAGGGTGGGGGCCTGGGGG + Intergenic
1057716840 9:97502121-97502143 GCCCCGGGCTGGGGTCCTGGCGG + Intronic
1057879941 9:98785647-98785669 TCTGCTTGCTGGGGGGCTGAAGG + Intronic
1060509819 9:124223647-124223669 TCCCCTGCCTGGGGAACTGGTGG + Intergenic
1060944019 9:127559434-127559456 TCCCCAGGATGGGTGCCTGGAGG - Intronic
1061012502 9:127963875-127963897 TCTCCTTCCTGGGAGACTGGCGG - Intronic
1061201714 9:129141931-129141953 TGTCCTGTGGGGGGGCCTGGGGG + Intronic
1061265302 9:129501361-129501383 TCTCCTGGCTGGGTGACTTTGGG - Intergenic
1061753051 9:132793976-132793998 TCACCTGGCTGTCAGCCTGGGGG - Intronic
1061798519 9:133102117-133102139 GCTCAGTGCTGGGGGCCTGGCGG + Exonic
1061813972 9:133182169-133182191 GCTCCATGCTGGGGGCCTGGTGG + Intergenic
1061814856 9:133188574-133188596 GCTCCCTGCTGGGGGCCTGGCGG + Intergenic
1061818063 9:133207974-133207996 TCTCCTTCCTGGGGGGCTGGTGG - Intronic
1061859343 9:133460159-133460181 TCGCCTGTCTGGGGTGCTGGGGG + Exonic
1061938197 9:133870286-133870308 TCAGCTGTCTTGGGGCCTGGGGG - Intronic
1062013023 9:134276966-134276988 TGCCGTGGCTGGGGGCCTGTAGG + Intergenic
1062086221 9:134650328-134650350 TCTGCTGGCGGGTGGCCTGGGGG + Intronic
1062087296 9:134655353-134655375 CCTCCCGGCTGGGGGCCTCCCGG - Intronic
1062093576 9:134691123-134691145 GCTCCTGGCTGGAGGCCAGAGGG - Intronic
1062242391 9:135547380-135547402 TCTCCTTCCTGGGGGGCTGGTGG + Intronic
1062319200 9:135982183-135982205 TCTCCTGGCTGGGGGCTATGTGG - Intergenic
1062320212 9:135986942-135986964 TCCCCTGGCTGGAGACATGGGGG + Intergenic
1062576966 9:137213432-137213454 CATCTTGGCTGGGGGCCTGGAGG + Intronic
1186213269 X:7272763-7272785 CCTCCTGCCTGGTGGTCTGGTGG + Intronic
1186473940 X:9842741-9842763 TGTCCTGGCTTGGGGCGAGGCGG + Intronic
1190635295 X:52426952-52426974 TCTCCAGGCTGGGGCACAGGAGG + Intergenic
1193494696 X:82196914-82196936 TCTCCTGGCTGGGGAGCAGGGGG + Intergenic
1193811162 X:86053681-86053703 TGTCGTGGGTGGGGGCCTGGGGG - Intergenic
1195322402 X:103730274-103730296 GCTCCTTGCTGGGGGTCTGGCGG + Intergenic
1196196338 X:112841373-112841395 TGACCTGGGTGGGGGCCTGCTGG - Intergenic
1196243747 X:113373784-113373806 TGTCAGGGGTGGGGGCCTGGGGG + Intergenic
1196883370 X:120220704-120220726 GCTCCTGGATGGGAACCTGGAGG + Intergenic
1197302870 X:124802523-124802545 TCCCTTGGCTGGGGGGCTGGGGG + Intronic
1199981561 X:152923396-152923418 TCTGCTGCCTGGGGCCATGGAGG - Intronic
1200059275 X:153477063-153477085 TCCCCTGGTCGGGAGCCTGGTGG - Intronic
1200120512 X:153788040-153788062 TGTGCGGGCTGGGGGCTTGGTGG - Intronic