ID: 948853061

View in Genome Browser
Species Human (GRCh38)
Location 2:240717809-240717831
Sequence GCGGCCAGTGGAAGGCAGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 219}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948853061_948853067 3 Left 948853061 2:240717809-240717831 CCGCGCTGCCTTCCACTGGCCGC 0: 1
1: 0
2: 0
3: 19
4: 219
Right 948853067 2:240717835-240717857 GCTTCCCCAGGCAGCCTTGCGGG 0: 1
1: 0
2: 1
3: 24
4: 281
948853061_948853066 2 Left 948853061 2:240717809-240717831 CCGCGCTGCCTTCCACTGGCCGC 0: 1
1: 0
2: 0
3: 19
4: 219
Right 948853066 2:240717834-240717856 TGCTTCCCCAGGCAGCCTTGCGG 0: 1
1: 0
2: 6
3: 32
4: 307
948853061_948853064 -9 Left 948853061 2:240717809-240717831 CCGCGCTGCCTTCCACTGGCCGC 0: 1
1: 0
2: 0
3: 19
4: 219
Right 948853064 2:240717823-240717845 ACTGGCCGCACTGCTTCCCCAGG 0: 1
1: 0
2: 2
3: 12
4: 144
948853061_948853072 15 Left 948853061 2:240717809-240717831 CCGCGCTGCCTTCCACTGGCCGC 0: 1
1: 0
2: 0
3: 19
4: 219
Right 948853072 2:240717847-240717869 AGCCTTGCGGGCAGGACCCCTGG 0: 1
1: 0
2: 0
3: 18
4: 189
948853061_948853069 7 Left 948853061 2:240717809-240717831 CCGCGCTGCCTTCCACTGGCCGC 0: 1
1: 0
2: 0
3: 19
4: 219
Right 948853069 2:240717839-240717861 CCCCAGGCAGCCTTGCGGGCAGG 0: 1
1: 0
2: 0
3: 23
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948853061 Original CRISPR GCGGCCAGTGGAAGGCAGCG CGG (reversed) Intronic
900335059 1:2158576-2158598 ACGCCCAGGGGAAGGCAGCCCGG + Intronic
900613266 1:3553324-3553346 ACGCCCAGGGGTAGGCAGCGGGG - Intronic
902350033 1:15847659-15847681 GCGGCGAGGGGGAGGCAGTGCGG + Intergenic
902662827 1:17917279-17917301 GTGGCCAGAGGGTGGCAGCGGGG - Intergenic
902870678 1:19312073-19312095 GCGCGCAGTGGACGGCGGCGCGG + Exonic
903263309 1:22142767-22142789 GCGGCCGGTGCCAGGCGGCGCGG - Intronic
903541657 1:24099789-24099811 GCGGTCTGTGGCAGGCAGGGTGG + Intronic
904868001 1:33597228-33597250 GTGGACAGTGGAAGGGAGTGGGG - Intronic
904961666 1:34338181-34338203 GTGACCAGAGGAAGGCAGAGAGG - Intergenic
905905036 1:41612262-41612284 CCGGCCAGGGGAAGGCAGAATGG - Intronic
907242277 1:53087483-53087505 GTGGCCTGGGGAAGGCAGCGGGG + Exonic
907261351 1:53220754-53220776 GGGGCCAGTGGAGGTCAGCCAGG + Intergenic
910288925 1:85581379-85581401 GGGGGCAGTGGCAGGCAGCGGGG - Exonic
911864136 1:102994463-102994485 GCTTCCAGTGGAAGGCAAAGAGG - Intronic
911986535 1:104632670-104632692 GCTTCCAGTGGAAGGCAAAGGGG + Intergenic
912687020 1:111775829-111775851 GGGGCCAGAGGAAGGGAGGGAGG - Exonic
920071355 1:203305418-203305440 GCGGCCAGAGGATGGGGGCGGGG - Intergenic
920618358 1:207518618-207518640 GCAGCCACTGGAAGGAAGCCTGG - Intronic
922729009 1:227940420-227940442 GTGGCCACTGGAAGGTTGCGTGG - Intronic
923276975 1:232405015-232405037 GCAGCCAGAGGGAGGCAGAGTGG - Intronic
923620558 1:235575821-235575843 ATGGCACGTGGAAGGCAGCGTGG + Intronic
923679016 1:236104119-236104141 GGGGCCAGTGGGAGGAAGAGAGG - Intergenic
1063829711 10:9938302-9938324 GGGGCCAGAGGAAGGAAGCCTGG - Intergenic
1065871979 10:29963518-29963540 GCAGCCATTGGCAGGCAGCAGGG + Intergenic
1066094117 10:32056361-32056383 CCGGCCAGCGGACGGCAGAGCGG - Exonic
1067533144 10:47088883-47088905 GGGGCCAGTGGAAGGCTGGAGGG + Intergenic
1070570514 10:77637137-77637159 GCGGCGAGGGGAAGGCAGGCGGG + Intronic
1073289997 10:102408821-102408843 GCGGCTTGTGGGAGGCACCGAGG - Intronic
1073646236 10:105307224-105307246 TCAGCCAGTGGAAGGCATTGTGG + Intergenic
1074203285 10:111258617-111258639 GGGGACACTGGCAGGCAGCGGGG - Intergenic
1075529689 10:123218782-123218804 GAGGACAGTGGAAGCCAGAGTGG + Intergenic
1075738529 10:124679134-124679156 GAGCCCAGCGGAAGGAAGCGTGG + Intronic
1075811547 10:125228095-125228117 GCGGGCAGTGGGAAGCAGTGGGG + Intergenic
1075811560 10:125228161-125228183 GCGGGCAGTGGGAAGCAGTGGGG + Intergenic
1075811588 10:125228293-125228315 GCGGGCAGTGGGAAGCAGTGGGG + Intergenic
1075811601 10:125228359-125228381 GCGGGCAGTGGGAAGCAGTGGGG + Intergenic
1075811645 10:125228576-125228598 GCGGGCAGTGGGAAGCAGTGGGG + Intergenic
1075811654 10:125228623-125228645 GCGGGCAGTGGGAAGCAGTGGGG + Intergenic
1075811671 10:125228708-125228730 GCGGGCAGTGGGAAGCAGTGGGG + Intergenic
1075811680 10:125228755-125228777 GCGGGCAGTGGGAAGCAGTGGGG + Intergenic
1076064741 10:127440296-127440318 GCGGCCAGTGGGAGGCATCTGGG - Intronic
1076215844 10:128692922-128692944 GAGGGCAGTGGAAGGTTGCGAGG + Intergenic
1076226479 10:128780501-128780523 GCAGCCAGTGGAAATCAGCCCGG + Intergenic
1076243089 10:128925124-128925146 GGAACCAGTGGAAGGCAGCTGGG - Intergenic
1077331105 11:1984135-1984157 GTGGCGAGGGGAAGGGAGCGTGG - Intronic
1077365627 11:2160392-2160414 TCGCCCAGAGGCAGGCAGCGTGG + Intronic
1078025788 11:7694362-7694384 GTGGACAGTGGAAGGCAAGGTGG - Intronic
1078159703 11:8830075-8830097 GAGGCCAGAGAAAGGCAGTGAGG - Intronic
1078673337 11:13385099-13385121 TCAGCCAGGGGAAGGCAGCTGGG + Intronic
1080908918 11:36575449-36575471 GCGGGAAGTGGAAGGCCTCGAGG + Exonic
1082189911 11:49230636-49230658 GAGGCTAGAGGAAGGCAGCCAGG + Intergenic
1083151369 11:60793820-60793842 GGGGCCAGTGACAGGCAGAGGGG + Intronic
1087673233 11:101129542-101129564 GGGGGCAGTGGAACTCAGCGAGG - Exonic
1089048788 11:115527844-115527866 GCAGCCTGTGGGAGGCAGAGGGG - Intergenic
1089602422 11:119623998-119624020 GGGGACAGAGGAAGGCAGGGAGG + Intronic
1089614571 11:119687892-119687914 GGGGTGAGTGGAAGGCAGTGGGG + Intronic
1091238581 11:134037431-134037453 GGGGCCGGCGGAAGGCGGCGGGG + Intergenic
1202814086 11_KI270721v1_random:39311-39333 GTGGCGAGGGGAAGGGAGCGTGG - Intergenic
1095349069 12:41188381-41188403 GTGGCCCGGGGAAGGCAGGGGGG + Intergenic
1096513243 12:52143467-52143489 GTGGCCAGAGGCAGGCAGCGTGG - Intergenic
1096717368 12:53499529-53499551 GGGTCCGGTGGAGGGCAGCGGGG - Intronic
1101820734 12:108182315-108182337 CTGGTCACTGGAAGGCAGCGAGG + Intronic
1102122168 12:110450154-110450176 GCGGGCGGCGGAAGGCAGAGAGG - Intronic
1102526026 12:113512796-113512818 GTGACCAGGGGAAGGCAGCAGGG + Intergenic
1102889541 12:116547649-116547671 GAGGCCAGGGGAAGGCCACGTGG - Intergenic
1102959881 12:117085511-117085533 GGGGCCAGTGGGAGGCAGGGTGG - Intronic
1105866164 13:24461622-24461644 GGGCCCAGTGGAAGGCTGTGGGG - Intronic
1106578729 13:30999779-30999801 GAGGCAGGTGGAAGGCAGTGGGG + Intergenic
1108433356 13:50377104-50377126 GAGGCCACTGGGAGGCAGCAGGG + Intronic
1108530074 13:51320399-51320421 ATGGCCAGTGCAGGGCAGCGTGG + Intergenic
1110555312 13:76853036-76853058 GCGTCCTGTGGAATGCAGCCAGG + Intergenic
1111672292 13:91347491-91347513 GCGGCCCGGGGAAGGCTGCGCGG + Intergenic
1113633005 13:111900593-111900615 GCAGCCAGCGGCAGGCAGCCCGG - Intergenic
1117729039 14:58703275-58703297 GCAGCCTATGGAAGGCAGCCTGG + Intergenic
1122028360 14:98894381-98894403 ACGGCCACAGGAAGGCAGAGAGG - Intergenic
1122338577 14:101009609-101009631 GGGGCAACTGGAAGGAAGCGAGG - Intergenic
1122677894 14:103432433-103432455 AAGGCCAGTGGAAGGAAGGGAGG - Intronic
1123106067 14:105841616-105841638 GTGGCCAGTGGAGGGCACTGGGG + Intergenic
1124439249 15:29674955-29674977 GCGGAGAGGGGAAGCCAGCGGGG - Intergenic
1124515101 15:30361174-30361196 CTGGCCAGTGGCAGGCAGCAGGG - Intergenic
1124727821 15:32169553-32169575 CTGGCCAGTGGCAGGCAGCAGGG + Intronic
1127399332 15:58570722-58570744 GGGGCCAGCGTGAGGCAGCGAGG + Intergenic
1128075713 15:64824118-64824140 GCGCGCAGAGGAAAGCAGCGCGG + Exonic
1129337732 15:74863552-74863574 GCAGCCGGTGGCAGGAAGCGAGG - Intronic
1129466133 15:75725338-75725360 GGGTCCAGAGGAAGCCAGCGGGG + Intronic
1130093148 15:80837906-80837928 GTGGCCAGTGGAGGGCACAGAGG - Intronic
1131111278 15:89766686-89766708 GGTGCCTGTGGAAGGCAGGGAGG - Intronic
1132473057 16:117674-117696 GCGGGCACGGGAAGGCAGTGGGG - Intronic
1132695960 16:1202120-1202142 GCGGCCTGGGGAAGGTGGCGAGG - Exonic
1132763781 16:1524377-1524399 GCGGCCAGGGGTGGGCAGAGGGG + Intronic
1133030781 16:3010033-3010055 GAGGCCCCTGGAAGGCTGCGAGG + Intergenic
1134386848 16:13781308-13781330 GGGGGCAGAGGAAGGTAGCGTGG + Intergenic
1136784236 16:32925309-32925331 GCGGCTCCTGGTAGGCAGCGTGG + Intergenic
1136885548 16:33928497-33928519 GCGGCTCCTGGTAGGCAGCGTGG - Intergenic
1136912371 16:34154573-34154595 GAGGCCTGAGGAAGGAAGCGGGG - Intergenic
1137560241 16:49497637-49497659 GTGGCCAGTGGTGGGCAGTGGGG - Intronic
1138901295 16:61274372-61274394 GCGGACATGGGAAGGCAGTGGGG - Intergenic
1141981138 16:87551085-87551107 GCGGCCATGGGCAGGCTGCGTGG + Intergenic
1142257257 16:89020010-89020032 GCTGCCAGTGGGAGGAAGAGGGG - Intergenic
1143166636 17:4900266-4900288 GCGGCGACTAGACGGCAGCGCGG + Exonic
1143631911 17:8144545-8144567 GCAGCCAGAGGAGGGCAGCCTGG - Intronic
1144856249 17:18269821-18269843 GCGGCCTCTGGCAGGCAGGGAGG + Intergenic
1145107404 17:20130323-20130345 GAGGCCAGAGGATGGCAGCCTGG + Intronic
1145270498 17:21402158-21402180 GAGGCCAGGGGAGGGCAGCGGGG - Intronic
1145308707 17:21689555-21689577 GAGGCCAGGGGAGGGCAGCGGGG - Intergenic
1146957200 17:36942646-36942668 GCGGGCTGAGGAAGGCCGCGCGG - Intronic
1147402712 17:40190720-40190742 GCTCCCAGTGGAAGGCAGTTAGG - Exonic
1148745377 17:49915149-49915171 GAGGCCAGAGGCAGGCAGAGAGG - Intergenic
1149993330 17:61394713-61394735 GAGGCCGGTGGGAGCCAGCGTGG + Intergenic
1151349912 17:73525570-73525592 GCAGCCTGTGGGAGGCGGCGAGG + Intronic
1152026876 17:77815675-77815697 GGGGCCAGTGGGAGGCAGGCTGG - Intergenic
1152716549 17:81903209-81903231 GGGGCAAGAGGAAGGCAGCCAGG - Intronic
1153861032 18:9206543-9206565 GCAGCCGGTGTAAGGCAGCTAGG - Intronic
1154000148 18:10475802-10475824 GGGGTCAGTGGAAGGCCGAGTGG + Intronic
1160097422 18:75887846-75887868 GAAGCCAGTGGAAGGCAGAGAGG - Intergenic
1160452358 18:78974189-78974211 GCGGCGGGTGGAACGCAGGGAGG - Intergenic
1161302803 19:3551190-3551212 GGTGCCTGTGGAAGGCAGAGTGG + Exonic
1161359369 19:3838673-3838695 GCAGCCACTTGCAGGCAGCGGGG - Intronic
1161382000 19:3970584-3970606 GAGGACAGTGGAGGTCAGCGGGG - Intronic
1161531935 19:4794922-4794944 GAGGCCACTGCAAGGCAGAGTGG - Exonic
1162386194 19:10361886-10361908 CCTGCGAGTGGAGGGCAGCGGGG - Exonic
1163678604 19:18668078-18668100 GCAGCCAGCGGACGGCCGCGCGG - Exonic
1165771987 19:38385509-38385531 GCAGCCAGTGGCGCGCAGCGCGG + Exonic
1167007237 19:46784072-46784094 GAGAGCAGTGGGAGGCAGCGGGG - Intronic
925912846 2:8584340-8584362 GAGGCCTGTGGAAGTCACCGAGG - Intergenic
926136903 2:10342889-10342911 GGGGCCGGGGGAAGGCAGCGGGG - Intronic
926681794 2:15669665-15669687 GTGGCAAGTGGAAGGAAGCAGGG + Intergenic
929033636 2:37671600-37671622 GCGGCCGGGGGACCGCAGCGCGG - Exonic
936938552 2:117860121-117860143 GCGGCAGGTGGAAGGCGCCGCGG - Intergenic
938062027 2:128261867-128261889 GAGGCCAGTGAAAGGCAGCAGGG + Intronic
938383313 2:130848568-130848590 GGGACCAGTGGACGGCAGGGAGG + Intronic
940362696 2:152813301-152813323 GCAGCCATTGGCAGGCAGCTGGG + Intergenic
945699527 2:213152211-213152233 GAGGCCGGGGGAAGGGAGCGGGG + Intronic
946329490 2:219001476-219001498 GCGGGCAGGGCAAGGCAGGGCGG + Intergenic
946434470 2:219642612-219642634 GCGGCCACCGGAGGGCAACGGGG - Intergenic
947229641 2:227871809-227871831 GCAGCCACTGAAAGGCGGCGGGG + Intronic
947890729 2:233616952-233616974 GCGGCCACAGAAAGGCAGCCCGG + Intergenic
948479496 2:238240795-238240817 GGGGGCAGTGGAAGGGAGGGAGG - Intergenic
948853061 2:240717809-240717831 GCGGCCAGTGGAAGGCAGCGCGG - Intronic
948943755 2:241209267-241209289 CCGGCCTGTGGCAGGGAGCGGGG - Exonic
1169220026 20:3816817-3816839 GTGCCAAGTGGAAGGCACCGGGG - Intergenic
1172054150 20:32142525-32142547 ATGGCCAGTGAAAGGCAGCTGGG - Intronic
1172117686 20:32582343-32582365 GCTGCCAGGGGCAGGCAGAGCGG + Intronic
1172783995 20:37454062-37454084 GCAGCCTGAGGCAGGCAGCGGGG - Intergenic
1173313175 20:41918472-41918494 GCGGCCAGCAGAAGTCAGAGTGG - Intergenic
1173843595 20:46174552-46174574 GCGGCCAGGGGCCGGAAGCGCGG + Exonic
1175165841 20:57043979-57044001 GTGGACAGGGGAAGGCAGTGGGG - Intergenic
1175282447 20:57813195-57813217 GTGGCCAGGGGAAGTCAGGGAGG + Intergenic
1175433734 20:58927760-58927782 GCAGGGAGTGGAAGGCAGCCTGG - Intergenic
1175917717 20:62434682-62434704 AGGGGCAGTGGAAGGCACCGTGG + Intergenic
1175944236 20:62551323-62551345 GCGGGCAGTGGATGGCATGGGGG + Intronic
1177196192 21:17905859-17905881 ACAGACGGTGGAAGGCAGCGAGG + Intronic
1178900800 21:36596981-36597003 GAGGGCGGTGGCAGGCAGCGGGG + Intergenic
1179552414 21:42151435-42151457 GGAGCCAGTGCAGGGCAGCGGGG - Intergenic
1180092699 21:45541276-45541298 GCGGCCAGTGAGATGCAGCCTGG + Intronic
1180842471 22:18965773-18965795 GTGGGGAGTGGAAGGCAGGGTGG - Intergenic
1181462602 22:23094447-23094469 GAGGCCAGGGCAAGGCAGGGTGG - Intronic
1181747501 22:24966054-24966076 GCAGCTAGTGGCAGGCAGGGAGG + Intronic
1182903932 22:33920674-33920696 GCGGCGAGTGGATCGCGGCGCGG + Intronic
1183185002 22:36286657-36286679 GCGGCCAGCAGGTGGCAGCGTGG - Intronic
1183285988 22:36964323-36964345 TTGGCCAGTAGAAGGCAGTGGGG + Intergenic
1183700744 22:39449609-39449631 GCTGCCTGGGGAAGGCAGAGGGG + Intergenic
1185035579 22:48475045-48475067 CCGGCCTGTGGGAGGCAGAGGGG - Intergenic
951182567 3:19676063-19676085 TCGGCCAGTGAAATGCAGCTGGG - Intergenic
951543822 3:23806604-23806626 GCGGCCAGAGGCAGGCAGGCCGG + Intronic
952540942 3:34367075-34367097 GGGGCCAGTTGCAGGCAGCTTGG - Intergenic
954793865 3:53151610-53151632 GCAGCGAGTGGAAGCCAGAGAGG + Intergenic
954870352 3:53763178-53763200 CCAGCCAGTGGAAGGCTGCTTGG + Intronic
955497664 3:59552016-59552038 TTGGCCAGTGGAAGGCACTGGGG - Intergenic
958898790 3:99861308-99861330 GCAGCCAGGGGAAGGCATCATGG - Intronic
960372866 3:116862570-116862592 GCAGCCAGGGGAAGGCCGGGTGG - Intronic
968756009 4:2417093-2417115 GCGGCCAGTGGAGGGAGGAGGGG + Intronic
969532366 4:7736991-7737013 GCGGCCAGCGGAAGGCTCCAGGG + Intronic
969584049 4:8081724-8081746 GCGGGGAGTGGGAGGCAGAGCGG + Intronic
972543233 4:40057037-40057059 GCGGCGGGTGGGAGGCAGGGAGG + Intronic
976509424 4:85891066-85891088 GCAGGCAGTGGAAGTCAGCATGG + Intronic
982284986 4:153725026-153725048 GCGGGCAGGGGTAGGCTGCGTGG + Intronic
985665192 5:1178466-1178488 GCGGTCACTGGAAGGCAGAGGGG + Intergenic
985702571 5:1382428-1382450 GCTGCCCGTGCAAGGCAGGGAGG + Intergenic
989368675 5:40682131-40682153 TCGGCCAGTGTCAGGCAGCAAGG - Intronic
992460158 5:76953397-76953419 GCGGCCAGAGGAAGGCAGGCAGG - Intronic
999087907 5:148909912-148909934 GCTGCCAGTGGATAGCAGGGAGG + Intergenic
999245646 5:150153158-150153180 GCAGGCAGTGGAAAGCACCGTGG - Intronic
1000083765 5:157871024-157871046 ACGGGCAGTGGTAGACAGCGTGG + Intergenic
1000937337 5:167318618-167318640 GCTGCCATTGGAAGGCAGTAAGG - Intronic
1001946654 5:175784407-175784429 GCGACAAGTGGGAGGCAGAGTGG - Intergenic
1002521729 5:179796163-179796185 GCGGCCAGAGGAAGTCCCCGTGG + Intronic
1003065793 6:2902941-2902963 TCGGCCAGGGAAGGGCAGCGAGG + Intronic
1003086378 6:3064298-3064320 TCGGCCAGGGAAGGGCAGCGAGG - Intronic
1003357380 6:5386485-5386507 GTGGCCAGTGGAATGGAGCAGGG + Intronic
1007421236 6:41720960-41720982 GCCGTCAGTGGAAGGCTGCAGGG - Intronic
1007599838 6:43074994-43075016 GCGGCCAGGGCAAGGCAGCTTGG - Exonic
1011119141 6:83931371-83931393 GAAGCCAGTTGAAGGCAGTGTGG + Intronic
1013159482 6:107527955-107527977 GCAGCCAAAGGAAGGCAGTGTGG - Intronic
1014671530 6:124310839-124310861 GCAGCAAAAGGAAGGCAGCGTGG + Intronic
1015593321 6:134843222-134843244 GGGGCCAGTGGAAGGAAGACAGG - Intergenic
1017086797 6:150720581-150720603 ACAGCCAGTGGAAGGCAGTTTGG - Intronic
1017949981 6:159128287-159128309 GCAGCCACCGGAAGGAAGCGAGG + Intergenic
1017991657 6:159494526-159494548 GTGGCAAGTGGAAGGCAACGTGG - Intergenic
1019143529 6:169962658-169962680 GAGGCCAGTGGAGAGGAGCGCGG + Intergenic
1019404550 7:876839-876861 GCGGCCAATGGGAGGCGGCGGGG - Intronic
1019571280 7:1713648-1713670 GAGGCCTGTTGAAGGCAGCAGGG + Intronic
1020201184 7:6081403-6081425 GCGCAAAGTGGAAGGCGGCGGGG - Intergenic
1022099561 7:27161131-27161153 GCGGCCAGCAGATGGCAGTGTGG - Intergenic
1025020841 7:55477906-55477928 CCGGCCAGGTGGAGGCAGCGCGG + Intronic
1025928988 7:65980195-65980217 GCGGCCAGGAGCAGGCAGGGCGG - Intronic
1026237950 7:68545259-68545281 GTGGCGAGTGGAGGGGAGCGGGG + Intergenic
1029528219 7:101108500-101108522 GCAGCAGGTGGAAGGCAGCAGGG - Intergenic
1030102974 7:105962449-105962471 GGGCACAGTGGAAGGCAGCTGGG - Intronic
1031596495 7:123655890-123655912 GCGGCCAGAAGCAGGCAGGGAGG - Exonic
1032085180 7:128880027-128880049 GCGGGCCGAGGCAGGCAGCGGGG + Exonic
1035214568 7:157355601-157355623 GCCTCCAGTGGCAGGCAGTGGGG + Intronic
1037674371 8:21041294-21041316 CCAGCCAGTGACAGGCAGCGGGG + Intergenic
1038447548 8:27614578-27614600 GCGGGCAGGGGATGGCAGCCAGG - Intronic
1040548792 8:48422650-48422672 GTGGGCAGTGGGAGGCTGCGAGG + Intergenic
1044409555 8:91868236-91868258 GCGGCCATTGGAAGGCCCAGGGG - Intergenic
1044609866 8:94080715-94080737 CCGGCCAGTGGCAGGCAGAGGGG - Intergenic
1044749089 8:95399342-95399364 GCAGCCAGTGGAGTGCAGTGGGG + Intergenic
1049022202 8:139965124-139965146 GAAGCCTGTGGAAGGCAGCTGGG - Intronic
1049349473 8:142156620-142156642 CAGGGCAGTGGAAGGCAGCGCGG - Intergenic
1049741994 8:144245327-144245349 GCGGCCAGAGGAAGCCAGGAAGG - Intronic
1049803983 8:144530659-144530681 GCGGGGAGGGGAAAGCAGCGGGG + Intronic
1050355636 9:4780533-4780555 GCTGCCAGGGGATGGCAGAGAGG - Intergenic
1052824970 9:33167627-33167649 GCGGCCTGTCGAGGGCAGCGTGG - Intergenic
1053334771 9:37257312-37257334 TAGGCAAGTGGAAGGCAGAGAGG + Intronic
1054774299 9:69111948-69111970 GCTGCCAGTGGCAGGGAGGGAGG + Intergenic
1054902799 9:70387750-70387772 GCTGCCCGTGGAAGCCAGGGAGG - Exonic
1056332160 9:85529830-85529852 GCATCCTGTGGAAGGCAGCTGGG - Intergenic
1058642431 9:107100516-107100538 GCAGCCAGTGGAAGGAACCCTGG - Intergenic
1060991534 9:127852409-127852431 GAGGCCCATGGAAGGCAGAGGGG - Intronic
1061003784 9:127917025-127917047 GCGGCCAGAGGCAGGGGGCGGGG + Exonic
1062459976 9:136658961-136658983 GCGGCCAGGGGAAGGGCGAGGGG + Exonic
1189333205 X:40155384-40155406 GCGGCCAGGGTCAGGCGGCGTGG + Intronic
1190748488 X:53341130-53341152 GCTTGCAGTGGATGGCAGCGTGG + Intergenic
1191249530 X:58253822-58253844 GGGGCCAGTGCAGGGCAGCTGGG + Intergenic
1195625253 X:107000035-107000057 GCTGCGAGTGGAAGTGAGCGAGG - Exonic
1199907846 X:152252852-152252874 GTGGCCAGGGGAAGGCAACATGG + Intronic
1201762727 Y:17557673-17557695 GAGGCCAGAGGAAGGCACAGAGG + Intergenic
1201838825 Y:18348316-18348338 GAGGCCAGAGGAAGGCACAGAGG - Intergenic