ID: 948854384

View in Genome Browser
Species Human (GRCh38)
Location 2:240723366-240723388
Sequence CCCGCACGGTGGTGTCCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 73}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948854384_948854392 14 Left 948854384 2:240723366-240723388 CCACATGGACACCACCGTGCGGG 0: 1
1: 0
2: 0
3: 2
4: 73
Right 948854392 2:240723403-240723425 GCTGCCTCACCTCCTGCAGGAGG 0: 1
1: 0
2: 5
3: 37
4: 425
948854384_948854391 11 Left 948854384 2:240723366-240723388 CCACATGGACACCACCGTGCGGG 0: 1
1: 0
2: 0
3: 2
4: 73
Right 948854391 2:240723400-240723422 GAGGCTGCCTCACCTCCTGCAGG 0: 1
1: 0
2: 2
3: 36
4: 329
948854384_948854388 -8 Left 948854384 2:240723366-240723388 CCACATGGACACCACCGTGCGGG 0: 1
1: 0
2: 0
3: 2
4: 73
Right 948854388 2:240723381-240723403 CGTGCGGGCCTCATCCTCTGAGG 0: 1
1: 0
2: 1
3: 4
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948854384 Original CRISPR CCCGCACGGTGGTGTCCATG TGG (reversed) Intronic