ID: 948856079

View in Genome Browser
Species Human (GRCh38)
Location 2:240731287-240731309
Sequence CAGACTAAACAGAGGCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 271}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948856073_948856079 0 Left 948856073 2:240731264-240731286 CCAGGTATGCCAGATGCCAGGCA 0: 1
1: 0
2: 0
3: 12
4: 160
Right 948856079 2:240731287-240731309 CAGACTAAACAGAGGCAGGGAGG 0: 1
1: 0
2: 1
3: 25
4: 271
948856071_948856079 7 Left 948856071 2:240731257-240731279 CCAGATGCCAGGTATGCCAGATG 0: 1
1: 0
2: 1
3: 7
4: 123
Right 948856079 2:240731287-240731309 CAGACTAAACAGAGGCAGGGAGG 0: 1
1: 0
2: 1
3: 25
4: 271
948856074_948856079 -9 Left 948856074 2:240731273-240731295 CCAGATGCCAGGCACAGACTAAA 0: 1
1: 0
2: 0
3: 24
4: 209
Right 948856079 2:240731287-240731309 CAGACTAAACAGAGGCAGGGAGG 0: 1
1: 0
2: 1
3: 25
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948856079 Original CRISPR CAGACTAAACAGAGGCAGGG AGG Intronic
900179701 1:1305779-1305801 CACACTGAACAGAGGCCAGGCGG + Intronic
901042545 1:6374211-6374233 CAGCCCAAACAGAGGCGGGAGGG + Intronic
901590405 1:10336600-10336622 GAGACTACACAGGGGGAGGGAGG - Intronic
901692963 1:10985732-10985754 CACACCAAACAGAAGCAGGCAGG + Intergenic
902367816 1:15989125-15989147 AAGCCTGAACAGTGGCAGGGAGG - Intergenic
903302287 1:22387903-22387925 CAGCCTAAACAGAGGCTTGGAGG + Intergenic
903849320 1:26296738-26296760 CAGACTTTAAAGAGCCAGGGAGG - Intronic
903918544 1:26782645-26782667 CAGGCAAAGCAGAAGCAGGGAGG - Intergenic
904891909 1:33785641-33785663 GAGAAGAAACAGAGGCAGGGTGG + Intronic
905110275 1:35589729-35589751 CAGCCAAGACAGAGGCAGGGGGG - Intronic
905341979 1:37284677-37284699 CAGACTAAGAAGATGCAGGATGG - Intergenic
912508657 1:110173843-110173865 CAGCCTCAAGAGAGGCAAGGAGG - Intronic
913218395 1:116639514-116639536 CAGTCTACACAGAGGCAAGAAGG + Intronic
913321319 1:117590606-117590628 CAGACAAAACATAGGATGGGAGG + Intergenic
913530167 1:119728293-119728315 CAGACAAAACAAAAGCAGGAAGG - Intronic
915271442 1:154756485-154756507 GAGAGTAAACAGATGAAGGGGGG - Intronic
915869087 1:159538741-159538763 CAGAGTCTACAGAGGCAGGCAGG - Intergenic
915907353 1:159888504-159888526 AAGAATAAACAGAGTTAGGGAGG + Intronic
917843739 1:179003265-179003287 CAGCCTAAGCAGGGGCAGGCAGG + Intergenic
918015802 1:180631858-180631880 CAGACTGAAGAGATCCAGGGAGG + Intergenic
919836138 1:201574781-201574803 GAGGATAAACAGAGGCAGGGAGG - Intergenic
920077570 1:203348318-203348340 GAGACTCCACAGAGGCAGTGAGG + Intronic
921399085 1:214700614-214700636 CAGAGGAAACAGTCGCAGGGTGG - Intergenic
923198776 1:231692213-231692235 CAGAGTAAAGAAAGGAAGGGAGG - Intronic
1062961984 10:1579071-1579093 CAGGGTAAACTGAGGCAGTGTGG - Intronic
1063300555 10:4845760-4845782 CAGACCTAACAGAGGAATGGGGG - Intronic
1065516902 10:26532808-26532830 CAGCCTAAACAAAGACAGGGAGG - Intronic
1066465189 10:35643696-35643718 AAGACAGAAGAGAGGCAGGGAGG - Intergenic
1066550710 10:36553263-36553285 CAGTGTGATCAGAGGCAGGGTGG + Intergenic
1069193631 10:65521002-65521024 CTGACTTCACAGAGACAGGGAGG + Intergenic
1071099172 10:82014830-82014852 CAGGCTAGAAAGAGGAAGGGAGG + Intronic
1072375767 10:94814079-94814101 GAGGCTAAACTGAAGCAGGGAGG - Intronic
1072389643 10:94969730-94969752 GAGGCTAAACTGAAGCAGGGAGG - Intronic
1072538992 10:96384237-96384259 CAGGCTAGGAAGAGGCAGGGAGG + Intronic
1072548847 10:96461600-96461622 GAGGCTAAACAAAGGCATGGAGG - Intronic
1073688481 10:105781826-105781848 CTGACTAGATAGAGACAGGGAGG - Intergenic
1075587317 10:123667161-123667183 CAGAAGAAACAGAGGCTCGGTGG - Intronic
1075786307 10:125052511-125052533 CAGACAACACAAAGGCAGGACGG - Intronic
1076266007 10:129110447-129110469 CAGCTTGCACAGAGGCAGGGAGG - Intergenic
1078066178 11:8080984-8081006 AAGACGAAACTGAGGCTGGGAGG + Intronic
1078966412 11:16349651-16349673 CAGAAGAAAGAGAGGGAGGGAGG + Intronic
1080663990 11:34319616-34319638 CTGATAAAACAGAGGCTGGGAGG - Intronic
1082008953 11:47437797-47437819 CAAAGTACAAAGAGGCAGGGAGG + Exonic
1082011510 11:47452864-47452886 CAGGCTCAACAGAGGCAGAGTGG + Intergenic
1082906735 11:58315879-58315901 CAGATTAAACAAAGGCAGAAAGG + Intergenic
1083323600 11:61862407-61862429 CAGTCCAGCCAGAGGCAGGGAGG + Intronic
1083346999 11:62000855-62000877 AAGTCTCAACAGAGGCAGAGTGG - Intergenic
1083962433 11:66021727-66021749 CAGACTAAACACACGCAGCCTGG + Intronic
1084343698 11:68528055-68528077 CAGAGAAAACAGAGACAGGCAGG - Intronic
1085320515 11:75571242-75571264 CAGAATAATCAGATGCAGGGGGG - Intronic
1085370242 11:75996601-75996623 CAGTTTATACAGAGGCATGGAGG + Intronic
1085698227 11:78723655-78723677 CAGACTAAAAAGAAACAGGATGG - Intronic
1086851084 11:91809794-91809816 CAGAAAATACAGAGGCTGGGAGG - Intergenic
1087570322 11:99919066-99919088 CACACCAAACAAAGGCAGGAAGG - Intronic
1088853170 11:113722074-113722096 CAGCCTAAGCAAAGGCATGGAGG - Intergenic
1088984482 11:114893512-114893534 CAGAGCCAACAGTGGCAGGGTGG - Intergenic
1090401464 11:126452301-126452323 CAGACTTAAAAGAGTCAGGCCGG + Intronic
1091442000 12:518180-518202 CAAGCTAAAAAGTGGCAGGGTGG + Intronic
1091631134 12:2161758-2161780 CAGACTAAAGAAAGCCAGGCTGG + Intronic
1092740495 12:11624065-11624087 CAGACTAAACAAAGGGAAAGGGG - Intergenic
1094050127 12:26210664-26210686 CTGTCTCAACAGATGCAGGGGGG - Intronic
1094268601 12:28586636-28586658 GAGAATAAACAGAGACAGGTAGG - Intergenic
1094725256 12:33107908-33107930 CAGACCCTACAGAGGCAGGCAGG + Intergenic
1095351559 12:41220099-41220121 AAGACTTTACAGAGGCAGGTGGG - Intronic
1095803889 12:46297025-46297047 CACACTAAAAAGAGGAAGGAGGG + Intergenic
1096262264 12:50100222-50100244 CAGACTCAACACAGCAAGGGTGG + Exonic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1100222883 12:92524959-92524981 CAGACTAGACAGTGGAGGGGTGG + Intergenic
1100855415 12:98753291-98753313 CTGACCCAAAAGAGGCAGGGTGG + Intronic
1104416964 12:128603512-128603534 CAGACTAAACACAGGCATGGAGG - Intronic
1105051027 12:133051072-133051094 CAAACAAAACACAGGCATGGTGG - Intronic
1109752259 13:66709827-66709849 TATACTTAACAGAGTCAGGGAGG + Intronic
1110332515 13:74288838-74288860 CTGACAGAACAGAGGCAGGAAGG - Intergenic
1113668990 13:112162984-112163006 CAGACTCAAAAGATGCAGGATGG + Intergenic
1115342553 14:32307949-32307971 CATAGGAAACAGATGCAGGGAGG + Intergenic
1119984137 14:79116503-79116525 AAGACTACTCTGAGGCAGGGAGG + Intronic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1122034919 14:98940974-98940996 CACACTAAACAGAGCCAAGGTGG - Intergenic
1122119350 14:99543650-99543672 CAGCCTGAGCAAAGGCAGGGAGG + Intronic
1122917935 14:104867354-104867376 CAGGGAACACAGAGGCAGGGCGG - Intronic
1123006405 14:105325886-105325908 GAGAGTAAACAAAGGCATGGAGG - Intronic
1124579672 15:30942398-30942420 CAAACTGAACAGAGGCAGTCAGG + Exonic
1124688384 15:31801173-31801195 CACACTCAACACAGGCAGGATGG + Intronic
1124711446 15:32016075-32016097 CACATTATGCAGAGGCAGGGAGG - Intergenic
1124824159 15:33076794-33076816 CCTACTAAACATAGGAAGGGAGG + Intronic
1125145995 15:36469003-36469025 CAGACCAGACAGAGGGAAGGAGG + Intergenic
1125750255 15:42023036-42023058 CAGCATGAACACAGGCAGGGAGG + Intronic
1127907569 15:63387631-63387653 CAGACAAGACAGAGGCAGAGAGG + Intergenic
1128076569 15:64830174-64830196 CAGACTAAACCAAGGAAGGCAGG + Intergenic
1128608975 15:69058765-69058787 CAGACTCAACAGAGGGAAAGAGG - Intronic
1130622156 15:85475031-85475053 AAGACTAAATATAGGCAGGTAGG - Intronic
1131507063 15:93028521-93028543 CAGCCCAGACAGAGGAAGGGTGG + Intergenic
1131565469 15:93481558-93481580 CAGAATAAACTGGGGAAGGGCGG - Intergenic
1131715561 15:95106944-95106966 ATGAGTAAACAGAGGCATGGAGG - Intergenic
1133205677 16:4232083-4232105 CTGTCTACACAGAGGCAGAGCGG - Intronic
1133362451 16:5185322-5185344 CAGGCAAAAGAGAGGCCGGGTGG + Intergenic
1133777298 16:8907028-8907050 CAAAATTAACAGAGGCAGGAAGG + Intronic
1134140125 16:11711212-11711234 CAGAGAAAACAGAGTAAGGGTGG + Intronic
1134230514 16:12425565-12425587 AATAGAAAACAGAGGCAGGGTGG + Intronic
1134354971 16:13473571-13473593 CAGAAGAAACTGAGGAAGGGTGG - Intergenic
1134638343 16:15809571-15809593 CAGACTGCCCAGAGGCTGGGAGG + Intronic
1138574629 16:57899789-57899811 CAAACTAAACAGAAACATGGAGG - Intronic
1140555539 16:75916841-75916863 CAGATTCTACAGATGCAGGGTGG + Intergenic
1141346195 16:83248276-83248298 AAGGAGAAACAGAGGCAGGGGGG + Intronic
1141619940 16:85231985-85232007 CTCCCTAAACAGCGGCAGGGGGG - Intergenic
1143895793 17:10135314-10135336 TAGCTAAAACAGAGGCAGGGTGG - Intronic
1145284539 17:21495557-21495579 CATCCTAAGCAGAGGCAAGGAGG + Intergenic
1145800170 17:27677441-27677463 GAGCCTGAACAGTGGCAGGGAGG + Intergenic
1146470468 17:33120481-33120503 CAGATGACACAGAGGCAGAGGGG + Intronic
1146917849 17:36689561-36689583 CTGACCCCACAGAGGCAGGGTGG + Intergenic
1148133001 17:45273663-45273685 CAGGCCAAACCGAGCCAGGGTGG - Intronic
1151468040 17:74300355-74300377 CAGACATAAGAGAGGGAGGGAGG - Intronic
1156570717 18:38249891-38249913 CAGTATACAGAGAGGCAGGGAGG + Intergenic
1156995067 18:43455625-43455647 AAGACTAAATAGAGGAAGGCTGG + Intergenic
1157501607 18:48194553-48194575 CAGAGTAAACAGAGGCTTGCAGG + Intronic
1160301457 18:77684544-77684566 CAGACTAGACAGAGGGAGCAAGG + Intergenic
1161566640 19:5006232-5006254 CACACTACCCAGAGGCAGGGTGG - Intronic
1161827152 19:6575681-6575703 CAGATTGAATAGAAGCAGGGAGG - Intergenic
1164805199 19:31110919-31110941 CAGACTAGAGAGAGGCAATGGGG + Intergenic
1166750361 19:45161595-45161617 CAGGGCACACAGAGGCAGGGCGG + Intronic
1167173550 19:47849750-47849772 CAGACAAAACAGACGCCAGGAGG + Intergenic
925204709 2:1996251-1996273 CAGTCCACACTGAGGCAGGGCGG - Intronic
925204758 2:1996527-1996549 CAGCCCACACTGAGGCAGGGCGG - Intronic
925204771 2:1996596-1996618 CAGCCCACACTGAGGCAGGGCGG - Intronic
925204812 2:1996799-1996821 CAGCCCACACTGAGGCAGGGCGG - Intronic
925204863 2:1997071-1997093 CAGCCCACACTGAGGCAGGGCGG - Intronic
929253178 2:39780931-39780953 CCGACAAAAAGGAGGCAGGGAGG + Intergenic
931530693 2:63210997-63211019 CAGAGTCTACAGAGGCAGGCAGG - Intronic
933395119 2:81721548-81721570 CAGAATAGACAGAAGCAGTGAGG + Intergenic
933766167 2:85711117-85711139 AAAACTCAACAGAGGCAGAGTGG - Intergenic
934164351 2:89280731-89280753 CACACTAAAAAGAGGCACCGAGG + Intergenic
934202923 2:89901793-89901815 CACACTAAAAAGAGGCACCGAGG - Intergenic
936815259 2:116452760-116452782 CAGACCAAAAACAAGCAGGGAGG - Intergenic
937628974 2:124077667-124077689 CAGCCTAAACACAGGCATGATGG - Intronic
939460365 2:142490686-142490708 CAGACTATATAGAGGCGGGAAGG + Intergenic
939971546 2:148667632-148667654 CAGACAAAAGAAAGGCAGTGGGG - Intronic
940995069 2:160140399-160140421 CAGAGCAAGCAGAGGCATGGCGG + Intronic
941189111 2:162354520-162354542 CCAACTGAACCGAGGCAGGGAGG + Intronic
942243430 2:173985180-173985202 CAGACAGAACAGAGGCTGGTAGG + Intergenic
944146697 2:196514289-196514311 CAGACTATACAGAGGCGGCAGGG - Intronic
945234001 2:207617716-207617738 AAGACGAAACAGAGGCAGACAGG + Intronic
945668355 2:212770439-212770461 CAGAAGCAAGAGAGGCAGGGTGG - Intergenic
945810121 2:214539129-214539151 CAAACAAATCAGAGGCAGTGTGG - Intronic
946060065 2:216934117-216934139 CAGACAGAACAGGGGCCGGGAGG - Intergenic
946508367 2:220326137-220326159 AGGAAGAAACAGAGGCAGGGAGG - Intergenic
947870646 2:233436004-233436026 CAAATGAAACAGTGGCAGGGAGG - Intronic
948856079 2:240731287-240731309 CAGACTAAACAGAGGCAGGGAGG + Intronic
1171062891 20:21983471-21983493 CAGACTTAAGAGAGGCATGGAGG - Intergenic
1171089604 20:22271498-22271520 CAGACTAAAGAGAGAGAGAGAGG + Intergenic
1171257486 20:23701161-23701183 CAGTCTATACATAGGAAGGGTGG - Intergenic
1171264900 20:23763320-23763342 CAGTCTATACATAGGAAGGGTGG - Intergenic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1172647639 20:36481159-36481181 CAGGCTAGACACAGGCAGGATGG - Intronic
1174881331 20:54282450-54282472 CAGAGTAAACAGAGGTAAAGAGG - Intergenic
1175248169 20:57593636-57593658 CTGACTGAACGGAGGCCGGGAGG + Intergenic
1175839071 20:62015167-62015189 CAGACCCAACAGAGGGAGGGTGG + Intronic
1177040110 21:16097707-16097729 GAGAGAAAACAGAGGCAGAGAGG - Intergenic
1177460284 21:21400006-21400028 AAGAAAAAAAAGAGGCAGGGAGG + Intronic
1178590328 21:33904278-33904300 CACACAGAGCAGAGGCAGGGAGG - Intronic
1179786570 21:43733673-43733695 CACACTGAACAGAGGCTGGGAGG - Intronic
1179876475 21:44271522-44271544 CAGATTAAACAGTGGCACGCTGG + Intergenic
1182473712 22:30564373-30564395 CAGAAGACAAAGAGGCAGGGAGG + Intronic
1182651373 22:31853981-31854003 CAGCCTACACAGAAGCAGGAAGG - Intronic
1182752082 22:32649786-32649808 CAGTCTAAATAGGGACAGGGCGG + Intronic
1182836117 22:33342724-33342746 CAAACTAGACAGATGCAGAGCGG - Intronic
1184001164 22:41674670-41674692 CAGAGCAGACAGAAGCAGGGTGG - Exonic
1184301748 22:43564970-43564992 CAGGGTGAACAGAAGCAGGGGGG - Intronic
1184810570 22:46828734-46828756 CAGTCCAAACAGAGACAGGAGGG - Intronic
950184178 3:10934928-10934950 CAGACTAGCCAGAGGCTGGCAGG - Intronic
950464832 3:13147317-13147339 CAGACTCAGAAGAGGGAGGGTGG - Intergenic
953787284 3:45920713-45920735 CAGAGTAAACAGAGGCATGATGG - Exonic
954294857 3:49668605-49668627 CACAGTAAACAGAGGCGGGCTGG - Exonic
954622277 3:52003000-52003022 CAGACTAAAGAGAGACTTGGCGG + Intergenic
954847470 3:53572344-53572366 CAAACAAACCAGAGGCAGAGAGG - Intronic
955135497 3:56213557-56213579 CAGAGTCTACAGAGGCAGGCAGG - Intronic
955203731 3:56876331-56876353 CAGACTACAAAGAGGTAGGGAGG + Intronic
955672650 3:61418151-61418173 ATGAGAAAACAGAGGCAGGGAGG + Intergenic
955920026 3:63945948-63945970 CAGAGTAACCAGATGCAGAGAGG + Intronic
956521966 3:70114598-70114620 TGGACTAAACAGAGGCACGAAGG - Intergenic
957314438 3:78559372-78559394 CAGACTTAGCTGAGGAAGGGAGG + Intergenic
959566073 3:107834487-107834509 AAGACTAAGAAGAAGCAGGGGGG + Intergenic
961041229 3:123679876-123679898 CACACTTAACAGAGGCAGCAGGG + Intronic
965640984 3:170828813-170828835 GAGAAGAAACAGAGGGAGGGAGG + Intronic
968863782 4:3194595-3194617 CAGACTATACCCAGTCAGGGTGG + Intronic
968942923 4:3648476-3648498 CAGAGGAAAGAGAGGCAGGGTGG - Intergenic
969157125 4:5220769-5220791 CAGAAAGAACAGAGGCAGGGAGG + Intronic
969325472 4:6441520-6441542 CAGCCTGAACAGAGGCGAGGTGG - Intronic
969351398 4:6600026-6600048 CAGCCCAGGCAGAGGCAGGGAGG + Intronic
969680326 4:8639747-8639769 CAGAGAAAACAGAGGCCAGGAGG - Intergenic
970225013 4:13848897-13848919 CAGGAGAAAGAGAGGCAGGGAGG - Intergenic
970399617 4:15704676-15704698 CAGACTAAACATCTGCTGGGTGG - Intronic
973824480 4:54691548-54691570 CAGCCTAAGGAGAGGCAGGTTGG + Intronic
974935059 4:68401767-68401789 CAGACTTAAGAGAGGCTGTGTGG + Intergenic
974937032 4:68420720-68420742 TAGAGTATACAGAGGCAGGCAGG - Intergenic
977247596 4:94651609-94651631 CAGTCTAACCAGAGGCAAGTGGG - Intronic
979084210 4:116385826-116385848 CAGACGAAACAGGGCCAGGAAGG - Intergenic
979670977 4:123359928-123359950 CAGACTGCAGAGAGGCAGGTAGG - Intergenic
979987585 4:127333983-127334005 CAGTGCAAACAGAGGAAGGGAGG - Intergenic
980481154 4:133389284-133389306 CAGACTGAACAGAGGTAGCCTGG + Intergenic
980713662 4:136603681-136603703 ATGCCTAAACAGAGACAGGGTGG + Intergenic
980895528 4:138856166-138856188 CAGACAAAATAGAGACAGGGAGG - Intergenic
985965168 5:3333932-3333954 CAGTCAAGGCAGAGGCAGGGTGG + Intergenic
986512017 5:8517428-8517450 CAGAGCAAGCAGAAGCAGGGTGG - Intergenic
986591026 5:9370574-9370596 TTGACTAAAGAGAGGCTGGGAGG - Intronic
986645180 5:9910324-9910346 TAGAGTAGACAGAGGCAGAGAGG + Intergenic
989627980 5:43450561-43450583 CAGAGGAAACTGAGGCAGTGAGG + Intronic
992005508 5:72473563-72473585 CAGTCTAAACAAAGGCAACGAGG - Intronic
992052969 5:72957424-72957446 CAGACTAGACAAATGCAGAGAGG - Intronic
993082019 5:83313186-83313208 CAGAAGATTCAGAGGCAGGGTGG - Intronic
993349871 5:86836495-86836517 GACACTACACATAGGCAGGGTGG - Intergenic
993733944 5:91453394-91453416 CAGGCCACACAGAGACAGGGAGG - Intergenic
996149607 5:120019452-120019474 TAGAATAATCACAGGCAGGGAGG - Intergenic
996592189 5:125160540-125160562 GAGAGTGAACAGAAGCAGGGTGG + Intergenic
997156490 5:131565788-131565810 CAGAAGAAACAAAGGCAGTGGGG + Intronic
997340906 5:133143858-133143880 CAGTCTACAGAGAGGTAGGGAGG - Intergenic
997532719 5:134592144-134592166 CTGACTGACCAGAGGCAAGGAGG + Intergenic
998382193 5:141733712-141733734 CAGATTACACAAAGGCAAGGGGG + Intergenic
999035419 5:148343500-148343522 CAGCCAAAACAGAAGTAGGGTGG - Intergenic
999432125 5:151533453-151533475 CAGTCAACACAAAGGCAGGGTGG - Intronic
1001996810 5:176168189-176168211 CAGATTAAACATGGGCAGCGTGG - Intergenic
1002709539 5:181186368-181186390 CAGCCTCATCTGAGGCAGGGGGG - Intergenic
1006756337 6:36418888-36418910 CAGAGTAAAGAGTGGCAGGGGGG + Intronic
1010987211 6:82438557-82438579 AAGACTGAACAGAGGAAGTGAGG + Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1018003857 6:159602571-159602593 GAGACTAAACAAGAGCAGGGAGG + Intergenic
1019271236 7:150224-150246 CAGTCCAGACACAGGCAGGGCGG + Intergenic
1019328421 7:451018-451040 CAGACTCAGCAGAGGCAGGAAGG - Intergenic
1019800781 7:3086865-3086887 CAGACTAAACTCAGCCAGCGAGG - Intergenic
1021984054 7:26081938-26081960 CATACTGAACAGAGCCTGGGAGG - Intergenic
1024951073 7:54860846-54860868 CAGAGAGAACAGAGGAAGGGAGG + Intergenic
1027167779 7:75847811-75847833 CAGACTAGAGAGAGCCAGAGGGG + Intronic
1027470362 7:78565937-78565959 ATGACTAAACCGAGGCAGGGAGG - Intronic
1028159087 7:87465442-87465464 CAGAGTCTACAGAGGCAGGCAGG - Intronic
1028519311 7:91712250-91712272 CAGACAAAAAAGAGGGAGGCTGG + Intronic
1029663187 7:101977349-101977371 AAGACTGAACAGAGACAAGGAGG - Intronic
1032626375 7:133595886-133595908 CAGAGAAGACAGAGGCAAGGTGG - Intronic
1033470175 7:141640082-141640104 CAAACTAAAAAGAGGAAGAGAGG - Intronic
1034441815 7:151089489-151089511 AAGTCTAAACAGAGTGAGGGAGG - Intronic
1036590700 8:10165486-10165508 GAGACTAAAGACAGGCAAGGGGG + Intronic
1037208832 8:16360313-16360335 GAGACTAAAGAGAGGGAGGAGGG + Intronic
1037316695 8:17605958-17605980 CAGACAACACAAAGGGAGGGTGG + Intronic
1037687959 8:21159533-21159555 CAGAATAAAGAGAGGGAGCGGGG + Intergenic
1037700619 8:21270989-21271011 CAGAATAAACAAAGGGAGAGAGG + Intergenic
1037765986 8:21772584-21772606 CAGAGTCAACAGAGGCAATGAGG + Intronic
1038680326 8:29661193-29661215 CAGCCTAAAGCTAGGCAGGGAGG + Intergenic
1039297653 8:36174267-36174289 CAGAGAAAACAGAGGCAATGTGG - Intergenic
1041535802 8:58924339-58924361 CATACTAAGCAGAAGTAGGGAGG + Intronic
1041562693 8:59238051-59238073 CAGACTATACAGAGGAAGTTAGG + Intergenic
1041648229 8:60275365-60275387 CAGAGTAAACAGAGACAGGTAGG + Intronic
1041734906 8:61099629-61099651 AAGACTACATAGAGGGAGGGAGG + Intronic
1041945881 8:63442390-63442412 AAAAGTAAACAGAGGCATGGAGG - Intergenic
1043009385 8:74862747-74862769 TAGACTGTAAAGAGGCAGGGAGG + Intergenic
1043299266 8:78706065-78706087 CAAACCAACCAGAGGCAGAGAGG - Intronic
1043919837 8:85968715-85968737 CAGGCTAGATAGAGGTAGGGAGG + Intergenic
1045390006 8:101705750-101705772 GAGACTACACAGAGGCACAGAGG + Intronic
1045487836 8:102646289-102646311 AAGACAGGACAGAGGCAGGGAGG + Intergenic
1046818255 8:118608834-118608856 CAGCCTAAACAAAGACAGGAGGG + Intronic
1046939848 8:119920546-119920568 CATTCTAAGCAGAGGCATGGAGG + Intronic
1047022249 8:120786796-120786818 CAGACTTGACAGAGGTAGGTGGG - Intronic
1047779902 8:128102574-128102596 CAGACTATGAAGAGGCTGGGTGG + Intergenic
1048612190 8:136034979-136035001 CTTACTAAAGTGAGGCAGGGAGG + Intergenic
1049495101 8:142926366-142926388 CAGACTCAGCAGGGGCAGGAAGG - Intergenic
1050690396 9:8221166-8221188 AAGACTAAGGAGAAGCAGGGTGG + Intergenic
1050723169 9:8614423-8614445 CAAACTGAATACAGGCAGGGAGG - Intronic
1050944734 9:11501855-11501877 AAGACAAAACAGAGGCAAAGGGG + Intergenic
1054853296 9:69871236-69871258 AATAATAAACAAAGGCAGGGAGG + Intronic
1056189508 9:84171023-84171045 CAGACCAACAGGAGGCAGGGAGG + Intergenic
1057179670 9:93022983-93023005 CAGATTAAACGGAGGGAGGCAGG - Intronic
1057565018 9:96159950-96159972 CTTACTAAAGAGAGGCAGGGAGG + Intergenic
1060192968 9:121604509-121604531 CAGAGAAAGAAGAGGCAGGGAGG - Intronic
1061499537 9:130993977-130993999 TAGCCTAAACAGGAGCAGGGAGG - Intergenic
1061920190 9:133778424-133778446 GAGACACAACAGAGGCAGGAAGG + Intronic
1062447275 9:136600225-136600247 CAGAGCAGACAGAGGCTGGGAGG - Intergenic
1185595760 X:1305743-1305765 CAGGAGAAACTGAGGCAGGGTGG + Intronic
1185610954 X:1393259-1393281 AAGAAAAAACAGAGGAAGGGCGG - Intergenic
1186157888 X:6744626-6744648 CTGACAAAACTGGGGCAGGGAGG + Intergenic
1187269765 X:17769128-17769150 AAGATTCAACAGATGCAGGGAGG - Intergenic
1188092393 X:25978988-25979010 CAGACAAAACAAAGGGATGGAGG + Intergenic
1189239183 X:39512514-39512536 CAGACCTACCAGGGGCAGGGAGG - Intergenic
1189821892 X:44876631-44876653 CAGACTAAATTGGGGCCGGGGGG - Intronic
1189976022 X:46461916-46461938 TAGATGAAACAGAGGCAGGGAGG - Intronic
1189983049 X:46529750-46529772 TAGAAGAAACAGAGGCAGCGAGG + Intronic
1190092707 X:47453448-47453470 CAGAATAAACAGATTCAGGGAGG + Intronic
1193780119 X:85691112-85691134 CAGACTGAACACAAGCATGGAGG - Intergenic
1197718935 X:129731565-129731587 CAGAGTAAAGAGAGGAAGGAAGG + Intergenic
1198581844 X:138073937-138073959 CAGAGTCTACAGAGGCAGGCAGG - Intergenic
1200136805 X:153879205-153879227 CAGAGTGAGAAGAGGCAGGGGGG + Intronic
1200914246 Y:8557370-8557392 CAGGATAAAAAGAGGCAGTGAGG + Intergenic
1200940373 Y:8774252-8774274 CAGGGTAAAGAGAGGCAGTGAGG - Intergenic
1201061312 Y:10049257-10049279 CAGACTATACAGAGGTGGGAAGG + Intergenic
1202182049 Y:22147982-22148004 CAGAATGAAGAGAGGCAGTGAGG - Intergenic
1202209311 Y:22438420-22438442 CAGAATGAAGAGAGGCAGTGAGG + Intergenic
1202361489 Y:24115187-24115209 CAGAGTCTACAGAGGCAGGCAGG + Intergenic
1202363584 Y:24137913-24137935 CAGAGTCTACAGAGGCAGGCAGG - Intergenic
1202507196 Y:25532204-25532226 CAGAGTCTACAGAGGCAGGCAGG + Intergenic
1202509289 Y:25554932-25554954 CAGAGTCTACAGAGGCAGGCAGG - Intergenic