ID: 948860041

View in Genome Browser
Species Human (GRCh38)
Location 2:240748425-240748447
Sequence TGCACCAGAGGCCGTGGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 316}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948860041_948860056 12 Left 948860041 2:240748425-240748447 CCGGCCCCACGGCCTCTGGTGCA 0: 1
1: 0
2: 3
3: 29
4: 316
Right 948860056 2:240748460-240748482 GGAAGTGGCTGTCAGGGTGGGGG 0: 1
1: 0
2: 2
3: 74
4: 640
948860041_948860052 6 Left 948860041 2:240748425-240748447 CCGGCCCCACGGCCTCTGGTGCA 0: 1
1: 0
2: 3
3: 29
4: 316
Right 948860052 2:240748454-240748476 CTCTCAGGAAGTGGCTGTCAGGG 0: 1
1: 0
2: 2
3: 26
4: 259
948860041_948860059 23 Left 948860041 2:240748425-240748447 CCGGCCCCACGGCCTCTGGTGCA 0: 1
1: 0
2: 3
3: 29
4: 316
Right 948860059 2:240748471-240748493 TCAGGGTGGGGGCCAGTGGGAGG 0: 1
1: 1
2: 18
3: 108
4: 1022
948860041_948860051 5 Left 948860041 2:240748425-240748447 CCGGCCCCACGGCCTCTGGTGCA 0: 1
1: 0
2: 3
3: 29
4: 316
Right 948860051 2:240748453-240748475 ACTCTCAGGAAGTGGCTGTCAGG 0: 1
1: 0
2: 1
3: 8
4: 183
948860041_948860047 -3 Left 948860041 2:240748425-240748447 CCGGCCCCACGGCCTCTGGTGCA 0: 1
1: 0
2: 3
3: 29
4: 316
Right 948860047 2:240748445-240748467 GCAGCCCCACTCTCAGGAAGTGG 0: 1
1: 0
2: 0
3: 18
4: 218
948860041_948860046 -9 Left 948860041 2:240748425-240748447 CCGGCCCCACGGCCTCTGGTGCA 0: 1
1: 0
2: 3
3: 29
4: 316
Right 948860046 2:240748439-240748461 TCTGGTGCAGCCCCACTCTCAGG 0: 1
1: 0
2: 5
3: 33
4: 344
948860041_948860057 19 Left 948860041 2:240748425-240748447 CCGGCCCCACGGCCTCTGGTGCA 0: 1
1: 0
2: 3
3: 29
4: 316
Right 948860057 2:240748467-240748489 GCTGTCAGGGTGGGGGCCAGTGG 0: 1
1: 0
2: 2
3: 68
4: 568
948860041_948860058 20 Left 948860041 2:240748425-240748447 CCGGCCCCACGGCCTCTGGTGCA 0: 1
1: 0
2: 3
3: 29
4: 316
Right 948860058 2:240748468-240748490 CTGTCAGGGTGGGGGCCAGTGGG 0: 1
1: 1
2: 0
3: 33
4: 343
948860041_948860054 10 Left 948860041 2:240748425-240748447 CCGGCCCCACGGCCTCTGGTGCA 0: 1
1: 0
2: 3
3: 29
4: 316
Right 948860054 2:240748458-240748480 CAGGAAGTGGCTGTCAGGGTGGG 0: 1
1: 0
2: 1
3: 23
4: 345
948860041_948860053 9 Left 948860041 2:240748425-240748447 CCGGCCCCACGGCCTCTGGTGCA 0: 1
1: 0
2: 3
3: 29
4: 316
Right 948860053 2:240748457-240748479 TCAGGAAGTGGCTGTCAGGGTGG 0: 1
1: 0
2: 3
3: 35
4: 306
948860041_948860055 11 Left 948860041 2:240748425-240748447 CCGGCCCCACGGCCTCTGGTGCA 0: 1
1: 0
2: 3
3: 29
4: 316
Right 948860055 2:240748459-240748481 AGGAAGTGGCTGTCAGGGTGGGG 0: 1
1: 0
2: 3
3: 50
4: 477

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948860041 Original CRISPR TGCACCAGAGGCCGTGGGGC CGG (reversed) Intronic