ID: 948860785

View in Genome Browser
Species Human (GRCh38)
Location 2:240751730-240751752
Sequence TCCATGCCCCATGTGGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 210}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948860773_948860785 18 Left 948860773 2:240751689-240751711 CCCCCATGCCCTTGGTGACACTC 0: 1
1: 0
2: 0
3: 15
4: 243
Right 948860785 2:240751730-240751752 TCCATGCCCCATGTGGCCCTGGG 0: 1
1: 0
2: 1
3: 30
4: 210
948860775_948860785 16 Left 948860775 2:240751691-240751713 CCCATGCCCTTGGTGACACTCAA 0: 1
1: 0
2: 1
3: 12
4: 108
Right 948860785 2:240751730-240751752 TCCATGCCCCATGTGGCCCTGGG 0: 1
1: 0
2: 1
3: 30
4: 210
948860782_948860785 -10 Left 948860782 2:240751717-240751739 CCTTGCAGGGGTGTCCATGCCCC 0: 1
1: 0
2: 2
3: 20
4: 199
Right 948860785 2:240751730-240751752 TCCATGCCCCATGTGGCCCTGGG 0: 1
1: 0
2: 1
3: 30
4: 210
948860777_948860785 10 Left 948860777 2:240751697-240751719 CCCTTGGTGACACTCAAGCTCCT 0: 1
1: 0
2: 0
3: 15
4: 134
Right 948860785 2:240751730-240751752 TCCATGCCCCATGTGGCCCTGGG 0: 1
1: 0
2: 1
3: 30
4: 210
948860772_948860785 19 Left 948860772 2:240751688-240751710 CCCCCCATGCCCTTGGTGACACT 0: 1
1: 0
2: 1
3: 19
4: 169
Right 948860785 2:240751730-240751752 TCCATGCCCCATGTGGCCCTGGG 0: 1
1: 0
2: 1
3: 30
4: 210
948860776_948860785 15 Left 948860776 2:240751692-240751714 CCATGCCCTTGGTGACACTCAAG 0: 1
1: 0
2: 1
3: 10
4: 172
Right 948860785 2:240751730-240751752 TCCATGCCCCATGTGGCCCTGGG 0: 1
1: 0
2: 1
3: 30
4: 210
948860774_948860785 17 Left 948860774 2:240751690-240751712 CCCCATGCCCTTGGTGACACTCA 0: 1
1: 0
2: 3
3: 22
4: 186
Right 948860785 2:240751730-240751752 TCCATGCCCCATGTGGCCCTGGG 0: 1
1: 0
2: 1
3: 30
4: 210
948860778_948860785 9 Left 948860778 2:240751698-240751720 CCTTGGTGACACTCAAGCTCCTT 0: 1
1: 0
2: 1
3: 12
4: 160
Right 948860785 2:240751730-240751752 TCCATGCCCCATGTGGCCCTGGG 0: 1
1: 0
2: 1
3: 30
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948860785 Original CRISPR TCCATGCCCCATGTGGCCCT GGG Intronic
900298734 1:1965949-1965971 AACATGCCCCATCTGGCGCTGGG - Intronic
900458840 1:2790477-2790499 TCCAGTCTCCAGGTGGCCCTGGG + Intronic
900462961 1:2810163-2810185 CCCCTGCTCCATGTGCCCCTCGG + Intergenic
900791335 1:4682989-4683011 TCCAGGCCCCAGTTGGCCCTTGG + Intronic
902565658 1:17309745-17309767 TGCCTCCACCATGTGGCCCTGGG - Intronic
902609251 1:17587672-17587694 TCCATGCTCCCTGTAGCCCCAGG - Intronic
902984284 1:20146229-20146251 TCCCTGCTCCATGTAGCCCTGGG + Intronic
903579364 1:24359291-24359313 TCCATGCCGTATGTGGTGCTAGG - Intronic
904813077 1:33176475-33176497 TCCAGGCCTCATGTGACCATTGG - Intronic
905456861 1:38094376-38094398 TCCAAGTCCCACGTGGCTCTGGG + Intergenic
906954190 1:50358893-50358915 CCCCTGCCCCGTGTGGCTCTCGG - Intergenic
914400529 1:147316238-147316260 CCCCTGCTCCATGTGGCTCTTGG - Intergenic
914430995 1:147620149-147620171 CCCAGGCTCCATGTGGCGCTGGG - Exonic
916570280 1:166019540-166019562 TCCATGGCCGACGTGGTCCTAGG + Intergenic
917449320 1:175133903-175133925 GCCATGCACCATGGGGCCATGGG - Intronic
922660376 1:227424746-227424768 ACCATGCTGCATGTGGCTCTGGG + Intergenic
923085719 1:230702271-230702293 CCCATACCCCATGTGGCACCTGG - Intergenic
1066302287 10:34107731-34107753 CCCAGGCCACATGTGGCCCTTGG + Intergenic
1067282090 10:44880513-44880535 TCCCCGCTCCACGTGGCCCTGGG - Intergenic
1067307598 10:45079541-45079563 GCCTTCCCCCATGTGGCCCTGGG - Intergenic
1068039211 10:51801419-51801441 TCCATGCCAAATCTGGCCCATGG - Intronic
1071278087 10:84075090-84075112 CCTCTGCCCCATTTGGCCCTGGG + Intergenic
1073465539 10:103692835-103692857 TCCATGGCCCCTGAGACCCTTGG - Intronic
1074449702 10:113549222-113549244 TCTATGCCCACTGTGGCACTAGG + Intergenic
1076157299 10:128213635-128213657 TCCATGCTCCATGAGGACCAAGG + Intergenic
1077081427 11:726205-726227 TTCCTCCCCCAGGTGGCCCTGGG - Intronic
1077323277 11:1952006-1952028 TCCCTGCCCCCTGTGGGTCTTGG + Intronic
1080075192 11:28140002-28140024 TTCCTGCCCCATGTGGCTGTTGG + Intronic
1082042373 11:47696551-47696573 ACCAGGCCCCAGGTGGGCCTGGG + Intronic
1082739820 11:56898367-56898389 TACATGCCCCCTGAGTCCCTTGG - Intergenic
1083935404 11:65867338-65867360 TCAAGGCCACATGTGGCTCTTGG + Intronic
1085178779 11:74514307-74514329 TCTGGGCCACATGTGGCCCTCGG + Intronic
1085272475 11:75278471-75278493 TCCCTGACCCCTGTGGTCCTTGG + Intronic
1085313243 11:75528464-75528486 TCCATGACCCCTGAGGCGCTGGG + Intergenic
1085678574 11:78549121-78549143 TCCATCCCCCAAGTGGGACTGGG - Intronic
1087889706 11:103523244-103523266 TCCTTGTCCCATGTAGTCCTAGG + Intergenic
1087889722 11:103523470-103523492 TCCTTGTCCCATGTAGTCCTAGG + Intergenic
1088456387 11:110036859-110036881 TCTAAGCCCCCTGTGGCCCAGGG - Intergenic
1089977228 11:122742989-122743011 TCCATGGCCCACCTGGCCCTGGG + Intronic
1091173140 11:133536236-133536258 CCCATTCCCCATCTGGCCCTAGG - Intergenic
1202806265 11_KI270721v1_random:7201-7223 TCCCTGCCCCCTGTGGGTCTTGG + Intergenic
1091408187 12:221743-221765 TCCAGGGCCCCTGTGCCCCTGGG + Intronic
1092514756 12:9198580-9198602 TACATGCCTCATGTGTTCCTAGG - Intronic
1096615542 12:52831297-52831319 TGCATCCCCCAGGTGGGCCTGGG + Intronic
1100904717 12:99284663-99284685 TCCATTCTCCATGTAGCACTTGG + Intronic
1101588180 12:106103157-106103179 ACCATGCCCTGTGTGGCCTTGGG - Intronic
1102212257 12:111136106-111136128 CCTATTCCCCATGTGGCCGTCGG - Intronic
1103320610 12:120090772-120090794 TGCCAGCCCCATGGGGCCCTGGG - Intronic
1104908711 12:132229266-132229288 CCCACGCCCCATCTCGCCCTGGG + Intronic
1104979841 12:132568926-132568948 TCCCTGCCCCATGTGACCATGGG - Intronic
1112422584 13:99266440-99266462 TCCTGGGCCCATGTGGCCCATGG + Intronic
1113957463 13:114106999-114107021 TCCTTGCCAGATGTGGCTCTGGG - Intronic
1114083353 14:19219911-19219933 TCCCTGCCCCATGGAACCCTGGG + Intergenic
1117329959 14:54702662-54702684 TCCATGCACCCTGTGACCCTGGG + Intronic
1120600507 14:86499745-86499767 TGCATGCCCTATGTATCCCTAGG - Intergenic
1121008172 14:90503718-90503740 TCCATACCGAATGTGACCCTGGG + Intergenic
1121683628 14:95815302-95815324 TACATTCCCCATGTAGCCCTTGG + Intergenic
1122599657 14:102914963-102914985 TCCCTGGCCCCTGTGGCACTTGG + Intergenic
1123922307 15:25078941-25078963 CCCATGCCACATGTGTCCATGGG - Intergenic
1124652950 15:31486328-31486350 TCCCTGCCTCATGGAGCCCTGGG + Intronic
1125812092 15:42550156-42550178 TCCAGGACCCATGTGGTCCGCGG - Intronic
1128450812 15:67804999-67805021 TCCATGGCCCCTGTGCCCTTAGG + Intronic
1129371433 15:75098377-75098399 ACCATGCTCTCTGTGGCCCTGGG - Intronic
1129677344 15:77639064-77639086 TCAACCCCCCATGAGGCCCTGGG + Intronic
1132104123 15:99050597-99050619 CCCATGCCCTGTGTGGCTCTGGG + Intergenic
1132598170 16:762584-762606 TCCTGGGCCCATGTGGCCCCAGG + Intronic
1133173979 16:3999740-3999762 TCCTTCCCCCATGTGGACGTGGG + Intronic
1136412100 16:30083577-30083599 TCCCTGTCCCATGGAGCCCTGGG - Intronic
1138093389 16:54194338-54194360 GCCATGGCCCGTGTGGCCCGGGG - Intergenic
1139545227 16:67646848-67646870 TCCCTGCCCCTTGTGGCCCCAGG + Intronic
1139671828 16:68497433-68497455 TCCCTGCCCCAGGCTGCCCTGGG - Intergenic
1140046502 16:71443223-71443245 CCAATGTCCCATGTGACCCTGGG - Intergenic
1141556990 16:84842821-84842843 TCCCTGCCCCATGAGGACCAAGG - Intronic
1142146600 16:88495413-88495435 TCGGTGCCCCAGGTAGCCCTGGG - Intronic
1142388086 16:89779683-89779705 AACCTGCCCCATGTGGCTCTGGG + Intronic
1143152628 17:4816870-4816892 TCCCTGCCCCAAGTGTCCCAAGG + Intronic
1143770623 17:9166229-9166251 TCCTTGAACCATCTGGCCCTGGG - Intronic
1144270825 17:13613972-13613994 TACATGGGCCATCTGGCCCTTGG - Intergenic
1144535987 17:16092584-16092606 GCCAAGTCCCTTGTGGCCCTAGG + Intronic
1144689063 17:17247676-17247698 TCCAAAACCCATGTGGCCCCAGG - Intronic
1145256117 17:21323427-21323449 TCCTTGCCCCAGGACGCCCTGGG - Intergenic
1145320496 17:21764523-21764545 TCCTTGCCCCAGGACGCCCTGGG + Intergenic
1145941688 17:28746100-28746122 TCCATGCCCCAACTGCCCCAAGG - Intronic
1146467477 17:33097546-33097568 GCCACGTGCCATGTGGCCCTTGG - Intronic
1146945348 17:36869714-36869736 TCCAGCCACCATGTGGTCCTGGG - Intergenic
1147048523 17:37772930-37772952 CCCAGGCCACATGTGGCCCATGG + Intergenic
1147187960 17:38722784-38722806 TCCCTGCCTCAGGTGCCCCTTGG + Intronic
1149647239 17:58249487-58249509 TCCTTCCCCCATGGGGTCCTGGG + Intronic
1150250861 17:63703798-63703820 TCCTTGCCCCATGGTGTCCTGGG - Intronic
1150380283 17:64714712-64714734 TACATGCACAATGAGGCCCTGGG - Intergenic
1152845495 17:82597183-82597205 TCCTGGCACCATGTGGTCCTCGG + Intronic
1153522678 18:5967220-5967242 ACCATGCTCATTGTGGCCCTGGG - Intronic
1154500038 18:14991574-14991596 TCCCTGCCCCATGGGACCCTGGG + Intergenic
1155858343 18:30864099-30864121 TACATGCCTCATGTGGACCCAGG - Intergenic
1156355244 18:36335008-36335030 TCCCTACCCCTTGTGGCCTTGGG + Intronic
1157896250 18:51471028-51471050 CCCATGACCCCTCTGGCCCTGGG + Intergenic
1160022318 18:75190309-75190331 AGCATGCCCCGTGTGGCCCTTGG + Intergenic
1160245380 18:77154851-77154873 TCAAAGCCCCTCGTGGCCCTGGG - Intergenic
1160462812 18:79052241-79052263 TGCATGCCCCGTGTGGCCCCTGG - Intergenic
1160521476 18:79510762-79510784 TCCCTGCCCTGTGTGGCCCTGGG + Intronic
1161626644 19:5330792-5330814 TCTTGGCCCCATCTGGCCCTGGG - Intronic
1166066563 19:40363142-40363164 TCCATGCCCCACCTTGCCTTCGG + Intronic
1166276123 19:41755476-41755498 CCCATGACCCACGTGACCCTGGG + Exonic
1166392036 19:42413774-42413796 GTCATCCCCCAGGTGGCCCTGGG + Intronic
1166995775 19:46719120-46719142 TCCCTGCTCCTTGTGGGCCTGGG + Intergenic
925268464 2:2583918-2583940 CCCTTGCCCCATATGGCCTTAGG - Intergenic
925388026 2:3476414-3476436 TGCAGGCCTCATGAGGCCCTCGG - Intronic
926750865 2:16197554-16197576 TCCAGGCCGCATCTGGCTCTGGG + Intergenic
930766397 2:55089857-55089879 TCCATGCCCCAGGTGTCCCAGGG - Intronic
932746418 2:74337322-74337344 TCCTTGTCCCATCTGGTCCTGGG - Intronic
935632450 2:105223386-105223408 TCCCTGCCCCATGCAGCCCATGG + Intergenic
935675175 2:105589174-105589196 TCCCTGCCCCTTGTGCCCCAGGG + Intergenic
936350565 2:111709519-111709541 TCCCTGCCCCATTTTGCTCTTGG - Intergenic
937363087 2:121242551-121242573 TCCCTGCGCCCTGGGGCCCTGGG - Intronic
937868593 2:126771779-126771801 TCTGTGCTCCCTGTGGCCCTCGG - Intergenic
938493231 2:131776720-131776742 TCCCTGCCCCATGGGACCCCGGG - Intergenic
938499251 2:131821933-131821955 TCCCTGCCCCATGGGACCCCGGG + Intergenic
938604416 2:132877547-132877569 TGCATTCCCAATGAGGCCCTAGG + Intronic
939776658 2:146396062-146396084 TACATGCAACATGCGGCCCTTGG + Intergenic
945991613 2:216400120-216400142 TCAAAGCCCCATGTGGCCTTGGG + Intergenic
947043446 2:225949922-225949944 TACATGCCACTTGTGGGCCTGGG + Intergenic
947238696 2:227971031-227971053 GCCATGACCCATGTGGCCCTTGG + Intergenic
948505557 2:238425102-238425124 TCCCTGCCACGTGTTGCCCTTGG - Intergenic
948860785 2:240751730-240751752 TCCATGCCCCATGTGGCCCTGGG + Intronic
948869038 2:240789173-240789195 TGCATAGGCCATGTGGCCCTCGG - Intronic
948942604 2:241203780-241203802 TCACTGGCCCATGAGGCCCTGGG + Intronic
1169910009 20:10640336-10640358 TCCATGCCCAATCTCTCCCTTGG + Intronic
1171078838 20:22156831-22156853 TCCATTGTCCATGTGCCCCTAGG + Intergenic
1173755456 20:45511758-45511780 TCCTCTCCCCATGTAGCCCTTGG + Intergenic
1174878024 20:54248615-54248637 TCCAGGTCCCATGTGGGCCCTGG - Intergenic
1175142842 20:56873539-56873561 TCCCTGCCCTCTGGGGCCCTAGG + Intergenic
1175168838 20:57065616-57065638 ACCATGCCCCAGATGGCCCCTGG + Intergenic
1175721065 20:61287662-61287684 TGCTTACCCCATGTGGCCCTGGG + Intronic
1176710543 21:10146204-10146226 TCCCTGCCCCATGAGACCCTGGG - Intergenic
1179233736 21:39527338-39527360 TCCTAGCCCCTTGTGGCCATGGG + Intergenic
1179923720 21:44521396-44521418 TCCAGGCCTCAAGTGTCCCTTGG - Intronic
1180294622 22:10873356-10873378 TCCCTGCCCCATGGAACCCTGGG - Intergenic
1180497428 22:15902770-15902792 TCCCTGCCCCATGGAACCCTGGG - Intergenic
1180622062 22:17168899-17168921 TCAATGCCCCGTTTGCCCCTAGG - Intergenic
1182898636 22:33879371-33879393 TCCATGCCTCATGGGGCTGTTGG - Intronic
1183327197 22:37200711-37200733 CCCAGGCCCCATGGGGACCTTGG - Intergenic
1183746303 22:39694004-39694026 TCCAGACCACAAGTGGCCCTGGG - Intergenic
1184245093 22:43231720-43231742 GCCATGCCCCGGGTGGCTCTCGG - Intronic
1184469677 22:44689373-44689395 TCCAAGCCACATCTGGCCCTGGG - Intronic
1184738341 22:46412154-46412176 TCGGTGGCCCAGGTGGCCCTTGG - Intronic
1184847551 22:47098566-47098588 TCCATGTACCAGGTTGCCCTGGG + Intronic
1184847567 22:47098617-47098639 TCCATGCACCAGGCTGCCCTGGG + Intronic
1185370763 22:50459878-50459900 TCCCTGCCCGCTGTGGGCCTGGG - Intronic
949598483 3:5573342-5573364 TCCACACCCCATGGGGCCTTCGG - Intergenic
950276326 3:11664411-11664433 TCTAGCTCCCATGTGGCCCTGGG + Intronic
950387814 3:12673780-12673802 TTCATGCTCCGGGTGGCCCTTGG - Intergenic
950714163 3:14836099-14836121 TCCATGCCACATGTTGCACAAGG + Intronic
950761839 3:15237297-15237319 TCCTGCCCCCATGTGGGCCTAGG - Intronic
954793272 3:53148214-53148236 TCCCTGCAGCCTGTGGCCCTGGG + Intergenic
958419486 3:93914433-93914455 TCCATGGCTCAAGTGGGCCTAGG - Intronic
960017005 3:112902614-112902636 TCCCTCCCCCATGTGGCTCTCGG + Intergenic
961749209 3:129085736-129085758 TCCACGGTCCTTGTGGCCCTCGG - Intergenic
964861498 3:161207344-161207366 TCTATTCCCCAGATGGCCCTGGG + Intronic
968702156 4:2062305-2062327 CCCCAGCACCATGTGGCCCTGGG - Intronic
969259915 4:6026781-6026803 CACAGGCCCCATGTGGCCCACGG + Intronic
970164902 4:13226399-13226421 CCCTTGCCCCATGTGGCTCCTGG - Intergenic
970479070 4:16454623-16454645 TCTCTGCACCATGTGGTCCTAGG - Intergenic
972559740 4:40216006-40216028 TCCTTGCCCCATGAAGCCATCGG + Intronic
974708279 4:65552396-65552418 TTCATGGCCCAGGTTGCCCTGGG - Intronic
975182708 4:71365370-71365392 CCCAAGCCCCATGTTGCTCTGGG + Intronic
979914631 4:126414754-126414776 TCCATTCCTCATTTGGGCCTAGG - Intergenic
980206468 4:129725222-129725244 TCCATGTCTCAGGTGGCCCCAGG - Intergenic
981223107 4:142259844-142259866 TCCTGACCCCATGTGGGCCTAGG - Intronic
982528127 4:156505505-156505527 TTCCTGCCCCGTGTGGCTCTCGG - Intergenic
986140492 5:5025618-5025640 TCCATGCCCTGTGTGGCTCTCGG - Intergenic
986227349 5:5828272-5828294 CCCATGCCTCAGCTGGCCCTGGG - Intergenic
989425735 5:41293458-41293480 ACTATGTCCCATGGGGCCCTTGG - Intergenic
1000020233 5:157311818-157311840 TCCTTACCCCTTCTGGCCCTGGG - Intronic
1001673107 5:173490853-173490875 TCCATGCCCCAGCTGTCTCTGGG - Intergenic
1002662910 5:180803228-180803250 TCCCTGCCCCACGCGACCCTGGG - Intronic
1003468190 6:6401618-6401640 CCCATGCCCCAGCTGTCCCTTGG - Intergenic
1005894182 6:30163889-30163911 CCCATGGCCCCTGTGCCCCTGGG + Exonic
1008566166 6:52770688-52770710 TTCATGTCACATGTGGCCTTTGG + Intergenic
1008734022 6:54520241-54520263 TCCTTGCTCCATATGGCCTTGGG - Intergenic
1008906480 6:56682779-56682801 ACCATGCTCCATGAGGCACTTGG - Intronic
1009651067 6:66479078-66479100 TCCAAGCCCTATGTCTCCCTTGG - Intergenic
1011704505 6:89987429-89987451 TCCATGCCCCAGGTGGCATGTGG + Intronic
1016543432 6:145193488-145193510 TCCTTGCCCCGTGTAGGCCTAGG + Intergenic
1018458184 6:163971522-163971544 CGCCTTCCCCATGTGGCCCTCGG - Intergenic
1018903811 6:168063919-168063941 TCAGTGCCCACTGTGGCCCTGGG + Intronic
1019547022 7:1583109-1583131 TCCATCCCCCCTGTGACCCCCGG + Intergenic
1021092480 7:16499825-16499847 TCCATGCCCCAAAGGCCCCTTGG + Intronic
1021776439 7:24059457-24059479 CCCTTGCCCCATGTGGCTCCCGG - Intergenic
1022262048 7:28715285-28715307 TTCATGACCCATGTGACCTTGGG + Intronic
1023055090 7:36284625-36284647 TCCTTTCCCCAGGTGGCGCTAGG + Intronic
1026845395 7:73696272-73696294 TCCATTCCCCATGGGGAGCTGGG + Intronic
1028147510 7:87334605-87334627 TCCATGGCCCATTAGGACCTTGG - Intergenic
1029142306 7:98419890-98419912 TCCAGGCCCCATGGGGGCCCTGG - Intergenic
1029711706 7:102303509-102303531 TCCAGGGCCCATGTGGCTCATGG - Intronic
1033056751 7:138062127-138062149 TCCATCCTCCAGGTGGCCCAGGG + Intronic
1033608012 7:142941527-142941549 CAAATGCTCCATGTGGCCCTTGG - Intronic
1034474281 7:151273837-151273859 GCCCTGCCCCATTTTGCCCTGGG + Intronic
1034866906 7:154649689-154649711 ACCATCCCCCATGAGGCCCCAGG - Intronic
1035466856 7:159084935-159084957 TCCATGGGCCATGATGCCCTTGG - Intronic
1037598615 8:20374715-20374737 TCCATGCCCCCAGTGGCCAAAGG - Intergenic
1038315908 8:26484114-26484136 TCCAGGCTCTATGTGGCCTTGGG + Intronic
1039853835 8:41395774-41395796 TCCATGCACTGTCTGGCCCTTGG + Intergenic
1041351185 8:56949493-56949515 TCCATGGCCCATTAGGCACTGGG + Intergenic
1041506187 8:58600292-58600314 ACCCTGCTCCATTTGGCCCTTGG - Intronic
1044793885 8:95876482-95876504 TGCATTCCTCATGTGGCTCTTGG - Intergenic
1048988235 8:139746804-139746826 TGGATGCCCAATGTGGCCGTGGG - Intronic
1049004841 8:139847963-139847985 TCCAGGCCCCACGTGCCCCAGGG - Intronic
1049398260 8:142411976-142411998 CCCATGGCCCCTGAGGCCCTGGG - Intergenic
1049509465 8:143020104-143020126 GCCATGCCCCACCTGGCCCCAGG + Intronic
1050797001 9:9558420-9558442 TCCAAGCCCTATGTCTCCCTCGG - Intronic
1052823072 9:33154763-33154785 TCCTGGCCGCATGTGGCCCATGG - Intronic
1053576006 9:39357870-39357892 TCCAGGCTGCCTGTGGCCCTGGG - Intronic
1053647520 9:40131902-40131924 TCCCTGCCCCATGGGACCCTGGG - Intergenic
1053758208 9:41331941-41331963 TCCCTGCCCCATGGGACCCTGGG + Intergenic
1053840522 9:42185807-42185829 TCCAGGCTGCCTGTGGCCCTTGG - Intronic
1054097576 9:60916561-60916583 TCCAGGCTGCCTGTGGCCCTGGG - Intergenic
1054118978 9:61192191-61192213 TCCAGGCTGCCTGTGGCCCTGGG - Intronic
1054328498 9:63729856-63729878 TCCCTGCCCCATGGGACCCTGGG - Intergenic
1054537059 9:66244268-66244290 TCCCTGCCCCATGGGACCCTGGG + Intergenic
1054588773 9:66990371-66990393 TCCAGGCTGCCTGTGGCCCTGGG + Intergenic
1056584604 9:87920028-87920050 TCCAGGCTGCCTGTGGCCCTGGG - Intergenic
1056612262 9:88132892-88132914 TCCAGGCTGCCTGTGGCCCTGGG + Intergenic
1056813916 9:89786486-89786508 TCCAGGACCCATGCTGCCCTGGG - Intergenic
1057877404 9:98768357-98768379 TCCCTTCCCCATGTGGCTCCAGG + Intronic
1060033142 9:120232859-120232881 ACCCTGCCCCAGGTGGCCCTTGG + Intergenic
1060826444 9:126690637-126690659 TACAGGCCCCCAGTGGCCCTGGG - Intronic
1061138455 9:128750403-128750425 TCCCTGCCCCATGTGGGGGTGGG - Intronic
1061416702 9:130451101-130451123 CACATGCCTCCTGTGGCCCTGGG - Intronic
1061497526 9:130983482-130983504 TCCATGTCCCATGAGGCAGTGGG + Intergenic
1202795304 9_KI270719v1_random:115199-115221 TCCCTGCCCCATGAGACCCTGGG - Intergenic
1187747547 X:22426107-22426129 TCCTTGCCTCATGTGGCCCGGGG - Intergenic
1188471992 X:30551467-30551489 TCCAGGCCACATGTGGCCCACGG - Intergenic
1188704619 X:33311793-33311815 TCCCTGCACCATTTGGCACTTGG - Intronic
1194286697 X:92019952-92019974 CCCCTGCCTCATGTGGCTCTTGG - Intronic
1197424109 X:126273469-126273491 TGCTTGCCCCATGTGGCTCCTGG + Intergenic
1199718653 X:150525809-150525831 TCCAAGTCCCATGAGGCCCTGGG - Intergenic
1199929064 X:152499921-152499943 TCCATGCCTGCTCTGGCCCTGGG + Intergenic
1200000794 X:153058855-153058877 TCCAGGTCCCATGTGGCCTGGGG - Intronic
1200067190 X:153509581-153509603 TCCGTGCCCCTCCTGGCCCTTGG + Intergenic
1200219486 X:154384093-154384115 TCCAAGGCCCATGGAGCCCTGGG - Intergenic
1200604243 Y:5244512-5244534 CCCCTGCCTCATGTGGCTCTTGG - Intronic
1201901396 Y:19048340-19048362 TCCCTTCCCCAGGTGGCCTTGGG + Intergenic