ID: 948862635

View in Genome Browser
Species Human (GRCh38)
Location 2:240760307-240760329
Sequence GCTGGCGGAGCGCCAAGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948862635 Original CRISPR GCTGGCGGAGCGCCAAGAGC GGG (reversed) Intronic
900432683 1:2610502-2610524 CCTGGCGGACAGCCAGGAGCTGG - Intronic
900713457 1:4129446-4129468 GCTGGAGCAGGCCCAAGAGCTGG - Intergenic
904710599 1:32427050-32427072 GCTGGCGCCGCGCACAGAGCTGG + Intergenic
905463083 1:38134034-38134056 GCAGGCGGAGGGCCCAGGGCCGG + Intergenic
905477535 1:38239441-38239463 GCTGGGGGAGTGCCATGTGCTGG - Intergenic
907118625 1:51990320-51990342 GCCGGGGGAGCTCCAAGGGCGGG - Intronic
910806265 1:91192226-91192248 GCTGGAGGTGAGCCCAGAGCGGG - Intergenic
914193981 1:145434782-145434804 GCTGGCAGTGAGCCAAGATCGGG + Intergenic
914475313 1:148017673-148017695 GCTGGCAGTGAGCCAAGATCGGG + Intergenic
920796273 1:209140179-209140201 AATGGAGGAGCTCCAAGAGCTGG - Intergenic
922586312 1:226737216-226737238 GCTGGCGGAGCGGCCGGCGCAGG - Exonic
923299721 1:232630091-232630113 GCTGGCGGAGCGAGAGGAGGAGG - Intergenic
1066676315 10:37891335-37891357 GCTGGCAGAGGGGCAAGAGCAGG - Intergenic
1069628039 10:69880392-69880414 GCTGGCAGGGGGCCAGGAGCAGG - Intronic
1069849643 10:71396777-71396799 GGTGGGGGAGCGCCGAGCGCGGG + Intergenic
1069913021 10:71771337-71771359 GCTGGCCCAACCCCAAGAGCTGG + Intronic
1071297683 10:84234089-84234111 GCTGGAGGAGGGCCAATGGCAGG - Exonic
1073100788 10:101005622-101005644 GCTGCAGGAGCGCGAACAGCTGG + Exonic
1073135335 10:101217146-101217168 GCTGGCCGAGCGACCTGAGCCGG - Intergenic
1074790975 10:116887504-116887526 CCTGGCGGAACACCAAGAGGTGG - Intronic
1074818566 10:117163080-117163102 GCTGGCGGAGCGCAGAGTCCCGG - Intergenic
1076830884 10:132993530-132993552 GCTGGCGCCCCACCAAGAGCAGG - Intergenic
1083921960 11:65786178-65786200 GCTGGTGGAGCGCGGAGGGCTGG - Intergenic
1083940569 11:65893212-65893234 GCAGAAGGAGCGCCTAGAGCTGG - Exonic
1084311193 11:68317274-68317296 GCTGGTGGGGTCCCAAGAGCTGG + Intronic
1085402987 11:76245686-76245708 GATGGCTGAGCCCCAACAGCAGG + Intergenic
1089273152 11:117315498-117315520 GCAGGCGGAGGGCTAAGGGCTGG + Intronic
1091193227 11:133711638-133711660 ACTGGAGGAGTGCTAAGAGCAGG - Intergenic
1094063519 12:26340166-26340188 GCTGGCGGAGCTCAAGGAGCAGG - Exonic
1095349118 12:41188623-41188645 GCTCGCCGGGCGCCAAGGGCTGG - Exonic
1097062996 12:56300021-56300043 GCTGGCGGCCAGCCAAGCGCAGG + Intronic
1100330074 12:93573233-93573255 CCTGGCGGAGCGCAGAGCGCGGG + Intronic
1103332591 12:120164519-120164541 TCTGGGGGAAGGCCAAGAGCAGG + Intronic
1105888370 13:24662505-24662527 GCTGGCAGTGCCCCAAGAACAGG - Intergenic
1106406617 13:29480244-29480266 GCAGGCCGAGCTCCAGGAGCTGG + Exonic
1108953460 13:56119816-56119838 GCTTGCGGTGAGCCAAGATCGGG + Intergenic
1118849213 14:69571885-69571907 GGCGGCAGAGCGCAAAGAGCGGG - Exonic
1122596841 14:102899599-102899621 GCTGGAGGAGTGCCTGGAGCTGG - Intronic
1129221525 15:74134300-74134322 GCTGGCGGAGCCCCGCGACCCGG + Exonic
1131275712 15:90978841-90978863 GGTGGGGGAGCGCCCTGAGCCGG + Intronic
1132549712 16:549309-549331 GCTGGCGGAGCGGCCGGACCTGG + Exonic
1133303234 16:4795606-4795628 GCTGGCGCTGGGCCAGGAGCGGG + Intronic
1134502057 16:14776962-14776984 GATGGCTGAGAGCCAGGAGCCGG + Intronic
1134578504 16:15351931-15351953 GATGGCTGAGAGCCAGGAGCCGG - Intergenic
1134724084 16:16405613-16405635 GATGGCTGAGAGCCAGGAGCCGG + Intergenic
1134943345 16:18306256-18306278 GATGGCTGAGAGCCAGGAGCCGG - Intergenic
1137378255 16:47973619-47973641 GCTGGCAGGGTCCCAAGAGCTGG - Intergenic
1137506194 16:49056003-49056025 GCTGGAGGAGAGGCATGAGCTGG + Intergenic
1137570733 16:49564791-49564813 GCTGGCGGGGGACCAAGGGCTGG - Intronic
1139386973 16:66579182-66579204 GCGGGCGCAGCGCCAAGCGCAGG - Intergenic
1144565097 17:16353305-16353327 GCTAGCGGAGCGCCGTGTGCGGG + Exonic
1144733369 17:17541325-17541347 GCTGGAGGAGCTGAAAGAGCTGG - Intronic
1144955985 17:19019136-19019158 CATGGCGGAGCTCCAAGGGCTGG + Intronic
1146056066 17:29581814-29581836 GCAGGCGGGGCACCATGAGCTGG - Exonic
1146957106 17:36942304-36942326 GCTGGTGGACCGCCTGGAGCCGG + Exonic
1147232135 17:39027283-39027305 GCTGGCGCCGCGCCCTGAGCCGG - Intergenic
1148073176 17:44920595-44920617 GTTGGCGGAGGGGCAGGAGCTGG + Intergenic
1150259965 17:63781278-63781300 GCTTGCGGTGAGCCAAGATCCGG - Intronic
1152576265 17:81142628-81142650 GCTGGCAGGGGACCAAGAGCAGG + Intronic
1152588146 17:81198223-81198245 GCAGGGGGAGCGCCAAGTCCAGG - Exonic
1154166108 18:12015574-12015596 GCTGCAGGAGAGCCCAGAGCAGG + Intronic
1154210484 18:12375606-12375628 GCTGGCAGTGAGCCAAGAGCGGG - Intronic
1155153764 18:23141888-23141910 GGTGGCAGAGAGCCAAGGGCAGG + Intronic
1160766846 19:812623-812645 GCTGGCGGAGCGCGAGGCGGAGG - Exonic
1160825401 19:1077962-1077984 GCTGGCAGCGCGCCGGGAGCAGG + Exonic
1160855179 19:1214080-1214102 GCTGGCGATGCCCCAAGAGCCGG + Intronic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1163128400 19:15256963-15256985 GCTGGCTGAGCTCCAGGAGCAGG - Exonic
1163692825 19:18746500-18746522 GCTGGCTGAGCACCAAGGGGCGG - Intronic
1163821406 19:19498565-19498587 GCTGGCGCTGCGCAAACAGCTGG + Exonic
1166091552 19:40512664-40512686 CCTGGCGGAGCTGCAGGAGCAGG + Exonic
1166366728 19:42281684-42281706 GCTGGCCCAGCGCCCAGGGCAGG + Intronic
1166380739 19:42353878-42353900 GGTGGCGGGGCTGCAAGAGCCGG + Exonic
1167233073 19:48297500-48297522 GCAGGTGGAGCTCCAGGAGCAGG - Exonic
1167569288 19:50276871-50276893 GCTGGCGGAGCAGCTGGAGCAGG + Exonic
1168594468 19:57664333-57664355 GCTGGCGGCGGGCGAGGAGCTGG + Intergenic
928115432 2:28542600-28542622 GCAGGGGGAGGGACAAGAGCTGG - Intronic
931274845 2:60735620-60735642 TGTGGCGCACCGCCAAGAGCTGG - Intergenic
933655094 2:84880690-84880712 GCTGGCGGAGGGCAAAGGCCAGG + Intronic
934754640 2:96816625-96816647 GCTGGCGGTGCGCGTGGAGCCGG + Exonic
935553146 2:104479551-104479573 GCTTGCAAAGAGCCAAGAGCAGG + Intergenic
944748153 2:202678905-202678927 GCTGGCCCAGCTCTAAGAGCTGG + Intronic
946416358 2:219541954-219541976 GGTGGCGCAGCGCCAGGTGCAGG + Exonic
947722922 2:232380305-232380327 GCTGGCGAAGCGCCAGGTGATGG + Exonic
947873657 2:233453781-233453803 GCTGGGGGAGCTGCAGGAGCAGG + Intronic
948772311 2:240257992-240258014 GGCGGCGGAGAGCCAGGAGCGGG + Intergenic
948862635 2:240760307-240760329 GCTGGCGGAGCGCCAAGAGCGGG - Intronic
1169363313 20:4970114-4970136 CCTCACGGAGGGCCAAGAGCAGG + Intronic
1171202712 20:23255001-23255023 GCTGGCGGAGAGCTCAGAGGAGG - Intergenic
1175467218 20:59197581-59197603 GCTGGCGTGGCCCCCAGAGCAGG + Intronic
1176110289 20:63407794-63407816 GCTGGAGGAGCGGGAAGAGGAGG + Intronic
1176856698 21:13980328-13980350 GCTGGCTGCGCTCCAGGAGCAGG + Intergenic
1179054164 21:37916181-37916203 TCTGGCCGAGCGCGGAGAGCAGG + Exonic
1180167224 21:46036428-46036450 GCTGGAGGAGGGCGCAGAGCGGG - Intergenic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1183218736 22:36498121-36498143 GGTGGCGGTGCTCCAGGAGCCGG + Exonic
1183647410 22:39134575-39134597 GCTTGCGGAGCGGGAAGGGCAGG + Exonic
1184209156 22:43025088-43025110 GCTGGAGGAGCGGCAGGAGGGGG - Intergenic
1185211605 22:49573633-49573655 GGTGGAGGAGCCCCAGGAGCTGG + Intronic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
950015109 3:9749811-9749833 GCTGGCAGAGAGCCCAGTGCCGG + Intergenic
954137410 3:48588386-48588408 GCTGGCGGAGCCTCAGGCGCTGG + Exonic
955156772 3:56424589-56424611 GATGGCACAGAGCCAAGAGCTGG - Intronic
960632266 3:119744097-119744119 GCTGGCTGAGCGCCAGCGGCGGG + Exonic
966721240 3:183064527-183064549 GCTGGTGGCGTGCCATGAGCAGG - Intronic
966919482 3:184602452-184602474 GCAGAGGCAGCGCCAAGAGCTGG - Intronic
967267899 3:187707156-187707178 GCTGGCTGAGTTCCAAGGGCTGG + Intronic
968334551 3:197901749-197901771 GCTGTCTGGGAGCCAAGAGCTGG - Intronic
969484405 4:7464075-7464097 GCTGGCAGTGAGCTAAGAGCTGG + Intronic
971371375 4:26022016-26022038 GCTGGCAGAGGGCAATGAGCAGG + Intergenic
972712608 4:41612756-41612778 GCTCCCCCAGCGCCAAGAGCTGG + Intronic
986285078 5:6353389-6353411 GCTCCCGGAGCACCCAGAGCTGG + Intergenic
986843334 5:11723668-11723690 GCTGGCACTGCTCCAAGAGCTGG + Intronic
991711739 5:69415255-69415277 GCAGGCTGAGCGCCGAGCGCGGG - Intronic
1001567172 5:172707194-172707216 GGTGGCTGAGCGGCAGGAGCAGG + Intergenic
1001577087 5:172771435-172771457 CCTGGGGACGCGCCAAGAGCAGG - Intergenic
1002048480 5:176555501-176555523 GCTGGAGGGGAGGCAAGAGCAGG - Intronic
1007362919 6:41371622-41371644 GCCGGCGGAGGGCGAAGAGCAGG + Intergenic
1007423640 6:41734229-41734251 GCTGGCGGAGAGCGGAGGGCGGG + Intronic
1018247810 6:161839278-161839300 GCTGAGGGAGCGCCTGGAGCTGG + Intronic
1018686489 6:166307987-166308009 CGTGGCGGAGGGCCAGGAGCTGG + Exonic
1018855104 6:167669371-167669393 GTCGGCAGAGCGCCATGAGCTGG + Intergenic
1019473611 7:1233656-1233678 GCTGGCGCTGCGCCTAGACCTGG + Exonic
1024300019 7:47879868-47879890 GCTTGCGGTGAGCCAAGATCGGG + Intronic
1024766674 7:52668603-52668625 GCTGGCGGGTCACCCAGAGCGGG - Intergenic
1025901836 7:65751086-65751108 GCACGCGGAGAGCCCAGAGCAGG - Intergenic
1033684141 7:143623309-143623331 GGTGGCTGAGAGCCAGGAGCAGG - Intronic
1033687317 7:143702528-143702550 GGTGGCTGAGAGCCAGGAGCAGG - Intronic
1033700471 7:143834314-143834336 GGTGGCTGAGAGCCAGGAGCAGG + Intergenic
1034087990 7:148337715-148337737 CATGGCGCAGGGCCAAGAGCTGG - Intronic
1034781638 7:153887218-153887240 GCTGGAGGAGCCCCCGGAGCCGG + Intronic
1036748127 8:11424486-11424508 GCTGGAGGAGCGGGATGAGCTGG - Exonic
1038781869 8:30575141-30575163 GCTCTAGAAGCGCCAAGAGCAGG - Intergenic
1040386654 8:46918901-46918923 GCTGGGTGAGCTCCAGGAGCAGG - Intergenic
1043621442 8:82197586-82197608 GCTTGCGGTGAGCCAAGATCAGG + Intergenic
1045242185 8:100412159-100412181 TCTGGGGGAGCTCAAAGAGCAGG - Intergenic
1047615944 8:126562589-126562611 GCTGGAGGAAAGCAAAGAGCAGG + Intergenic
1048491806 8:134901226-134901248 GCAGGCAGAGCCCCACGAGCAGG - Intergenic
1049843920 8:144790694-144790716 GCTGGCTGAGCTCCAAGCGCAGG + Intronic
1050046564 9:1552820-1552842 GCTGGAGCAGCGTCAGGAGCAGG + Intergenic
1057261335 9:93586486-93586508 GCTGGGGGAGGGCCAGCAGCCGG + Intronic
1057798754 9:98176497-98176519 GCTGGCGGGGCTCCAGGAACAGG - Intronic
1058051570 9:100411716-100411738 GCTGAGGGAGCGCGCAGAGCGGG - Intergenic
1058356907 9:104094038-104094060 GCTGGCGAAGCGCGAGGACCCGG + Intergenic
1058508926 9:105694902-105694924 GTTGGAGGGGCGCCAAGGGCCGG + Intronic
1058596633 9:106622287-106622309 CCTGGAGGAGGGCCAAGAGGTGG - Intergenic
1060278948 9:122203103-122203125 GCTGACTGAGGGCAAAGAGCAGG - Exonic
1061061077 9:128250798-128250820 GCAGGCGGAGGCCCAGGAGCAGG - Exonic
1061517308 9:131097138-131097160 GCTTGCGGGGAGCCACGAGCCGG - Intronic
1061737175 9:132669796-132669818 GCTCGCGGCGCGCCCACAGCCGG + Intronic
1061970391 9:134041759-134041781 GCTGGCGGAGCTGCAGGAGCAGG - Exonic
1062213914 9:135378814-135378836 GCTGGCGGAGGCCCAGTAGCAGG + Intergenic
1185870848 X:3663718-3663740 CCTGGGTGAGCCCCAAGAGCTGG + Intronic
1187268041 X:17755397-17755419 GAAGGCAGAGGGCCAAGAGCAGG - Intergenic
1187321209 X:18238886-18238908 GAAGGCAGAGGGCCAAGAGCAGG + Intergenic
1200094317 X:153650185-153650207 GCTGGAGGAGCGCCACTCGCAGG + Exonic
1200094435 X:153650572-153650594 GCTGGCTGAGCACCCAGGGCCGG - Exonic