ID: 948864997

View in Genome Browser
Species Human (GRCh38)
Location 2:240770759-240770781
Sequence AAGGCAGCCAGTTCACTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 263}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948864997_948865008 12 Left 948864997 2:240770759-240770781 CCCCCAAGTGAACTGGCTGCCTT 0: 1
1: 0
2: 3
3: 40
4: 263
Right 948865008 2:240770794-240770816 TGGTCTGGAGATAGACCACTGGG 0: 1
1: 1
2: 0
3: 18
4: 134
948864997_948865009 19 Left 948864997 2:240770759-240770781 CCCCCAAGTGAACTGGCTGCCTT 0: 1
1: 0
2: 3
3: 40
4: 263
Right 948865009 2:240770801-240770823 GAGATAGACCACTGGGCACCTGG 0: 1
1: 0
2: 0
3: 9
4: 128
948864997_948865004 -8 Left 948864997 2:240770759-240770781 CCCCCAAGTGAACTGGCTGCCTT 0: 1
1: 0
2: 3
3: 40
4: 263
Right 948865004 2:240770774-240770796 GCTGCCTTGGCTGCTGTGGGTGG 0: 1
1: 0
2: 4
3: 53
4: 553
948864997_948865007 11 Left 948864997 2:240770759-240770781 CCCCCAAGTGAACTGGCTGCCTT 0: 1
1: 0
2: 3
3: 40
4: 263
Right 948865007 2:240770793-240770815 GTGGTCTGGAGATAGACCACTGG 0: 1
1: 0
2: 1
3: 15
4: 133
948864997_948865006 -3 Left 948864997 2:240770759-240770781 CCCCCAAGTGAACTGGCTGCCTT 0: 1
1: 0
2: 3
3: 40
4: 263
Right 948865006 2:240770779-240770801 CTTGGCTGCTGTGGGTGGTCTGG 0: 1
1: 1
2: 2
3: 30
4: 348
948864997_948865011 23 Left 948864997 2:240770759-240770781 CCCCCAAGTGAACTGGCTGCCTT 0: 1
1: 0
2: 3
3: 40
4: 263
Right 948865011 2:240770805-240770827 TAGACCACTGGGCACCTGGGTGG 0: 1
1: 0
2: 0
3: 15
4: 139
948864997_948865010 20 Left 948864997 2:240770759-240770781 CCCCCAAGTGAACTGGCTGCCTT 0: 1
1: 0
2: 3
3: 40
4: 263
Right 948865010 2:240770802-240770824 AGATAGACCACTGGGCACCTGGG 0: 1
1: 0
2: 2
3: 34
4: 498

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948864997 Original CRISPR AAGGCAGCCAGTTCACTTGG GGG (reversed) Intronic