ID: 948866472

View in Genome Browser
Species Human (GRCh38)
Location 2:240777559-240777581
Sequence GCGTTCCAGGCTTGGGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 315}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948866472_948866479 7 Left 948866472 2:240777559-240777581 CCACCATCCCAAGCCTGGAACGC 0: 1
1: 0
2: 1
3: 13
4: 315
Right 948866479 2:240777589-240777611 CCATCCTGACTTGCCGCACCAGG 0: 1
1: 0
2: 0
3: 3
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948866472 Original CRISPR GCGTTCCAGGCTTGGGATGG TGG (reversed) Intronic
900283642 1:1888943-1888965 GGGTTCGAGGCTGGGGATGGAGG - Intronic
900412494 1:2519108-2519130 GCGTTAGAGGCTGGGGAGGGCGG + Intronic
900612141 1:3548737-3548759 GTGTTCCAGGCCTGGGAAGCTGG - Intronic
900909259 1:5583264-5583286 GCTTTCCTGGCATGGGGTGGGGG - Intergenic
901626615 1:10628600-10628622 GCCTTGGAGGCTGGGGATGGAGG + Intronic
901844988 1:11976138-11976160 GACTTTCAGGCCTGGGATGGTGG - Intergenic
902542976 1:17167317-17167339 GCGTTCCAGGTTGGGGCGGGGGG - Intergenic
902839295 1:19065200-19065222 ACGTTCCAGGGTTGGGATGGTGG - Intergenic
903893143 1:26583639-26583661 ACGTTCCAGGCTGGGCACGGTGG + Intergenic
904213259 1:28899550-28899572 GCCATCCAGGCTTAGGCTGGGGG + Intronic
904493273 1:30873126-30873148 CAGTCCCAGGCTTGGGCTGGTGG + Exonic
907872699 1:58457323-58457345 TCTTTCCAGCCTTGGGAGGGAGG - Intronic
909141380 1:71870165-71870187 GCTATCCAGGCTGGGCATGGTGG - Intronic
912331932 1:108827962-108827984 CCATTCCAGGCTGGGTATGGTGG + Intronic
912460348 1:109826711-109826733 GGGTCCCAGGCTTGGGCTAGGGG + Intergenic
912928331 1:113932664-113932686 GCGATCCAGGCCAGGCATGGTGG - Intronic
916883385 1:169044385-169044407 GTGTGCCAGGCATGGAATGGAGG - Intergenic
917425251 1:174906303-174906325 GCTTTCTAGGCTAGGCATGGTGG - Intronic
917439637 1:175055656-175055678 GCCTTCTAGGCTGGGGATGATGG - Intergenic
917509061 1:175655140-175655162 GCCTTGCAGGGTGGGGATGGTGG + Intronic
919760690 1:201096240-201096262 GCACTCCAGGGTTGGGCTGGAGG - Intronic
921472700 1:215567635-215567657 GCGGTCCCGGCTGGGGAAGGAGG + Exonic
922161672 1:223082751-223082773 GAGCTGCAGGCATGGGATGGAGG + Intergenic
922799363 1:228357861-228357883 CTGTTCCAGGCTTAGGAAGGTGG + Intronic
1062766090 10:66359-66381 CCATTCCAGGCTGGGGGTGGTGG + Intergenic
1065805948 10:29393956-29393978 GTTTTTCAGGCTTGGTATGGTGG - Intergenic
1067287176 10:44915002-44915024 GCCGTCCAGGCTGGGCATGGAGG + Intronic
1067318669 10:45197912-45197934 GCCCCCCAGGCCTGGGATGGGGG - Intergenic
1069408505 10:68127618-68127640 GTGTCCCAGGCTTGGCACGGTGG - Intronic
1070052673 10:72904376-72904398 GCAGTCCAGGCTTGGAATAGAGG + Intronic
1070360588 10:75684783-75684805 GTGTTCCTGGCAAGGGATGGTGG - Intronic
1074215378 10:111379018-111379040 GCGTACCAGGCTGGGCGTGGTGG - Intergenic
1074358696 10:112807913-112807935 TCTTTCCAGGCTGGGCATGGTGG + Intronic
1076798044 10:132808287-132808309 GCTTTCCAGAGTGGGGATGGGGG - Intergenic
1077066252 11:642214-642236 GCCTCCCAGGCTTGGAAAGGAGG + Intergenic
1077496269 11:2887983-2888005 GTGTCCCTGGCTTGGGCTGGGGG - Exonic
1079787855 11:24698061-24698083 GCCTCCAAGGCTAGGGATGGAGG + Intronic
1080074253 11:28130020-28130042 GCATACCAGGCTTGGCATGGTGG + Intronic
1080341779 11:31273093-31273115 GGCCTCCAGGCTTGTGATGGGGG + Intronic
1080886140 11:36369882-36369904 GAGTTGCAGGCTGGGCATGGTGG - Intronic
1081757808 11:45557059-45557081 AGGTGCCAGGCGTGGGATGGGGG + Intergenic
1082067757 11:47914760-47914782 GGGCTCCAGGCCTGGCATGGTGG - Intergenic
1083267620 11:61554064-61554086 GGGTTCCTGGCTGGGGATTGTGG + Intronic
1083887316 11:65579156-65579178 GGGATCCAGGTTAGGGATGGGGG + Intronic
1085391514 11:76184659-76184681 GTGTTCCAGGCTAGGGACTGGGG + Intergenic
1089217325 11:116842396-116842418 GCCTTCCAAGCTGGGCATGGTGG - Intergenic
1091104452 11:132905518-132905540 GCTTTCCAGGCTGGGTGTGGTGG - Intronic
1091596516 12:1882482-1882504 GTGTTCCAGCTGTGGGATGGTGG + Intronic
1092326236 12:7534439-7534461 GGCTTCCAGGCCTGTGATGGAGG - Intergenic
1093420749 12:18971640-18971662 GAATTCCAGGCTTGGGATTTGGG + Intergenic
1093782590 12:23154237-23154259 GGTTTCCAGGGTTGGGGTGGCGG - Intergenic
1093868820 12:24261850-24261872 GTTTCACAGGCTTGGGATGGAGG - Intergenic
1094735136 12:33225567-33225589 GCTTTACAGGGCTGGGATGGGGG - Intergenic
1095316299 12:40766068-40766090 GCATTCCAGGCTGGGCACGGTGG + Intronic
1096164731 12:49412591-49412613 TCGTTTCAGGCTGGGCATGGTGG + Intronic
1096368779 12:51051116-51051138 GTGTTCCAGGCTGGGCACGGTGG + Intronic
1096555142 12:52399265-52399287 GGGTTCCAGGGTAGGGTTGGAGG - Intronic
1096584685 12:52612182-52612204 GCTTTCCAGGGCTGGGATGGAGG + Intronic
1096987801 12:55773000-55773022 GCTTCCCAGGCTGGGCATGGTGG - Intronic
1097838187 12:64294669-64294691 GGGTTGCAGGGGTGGGATGGGGG + Intronic
1097990952 12:65833326-65833348 GCTTTCTAGGCTTTGGATAGTGG + Intronic
1100161399 12:91865102-91865124 GCTTTTCAGGCTGGGCATGGTGG - Intergenic
1100310525 12:93390878-93390900 GCATTCCAGGCCAGGCATGGTGG - Intronic
1102614596 12:114142366-114142388 TGGCTCCAGGCTTGGGAGGGAGG - Intergenic
1102976158 12:117208452-117208474 CCGTTCCGGGCTTGGGAAGCTGG - Exonic
1103097874 12:118146531-118146553 AACTTCCAGGCTTGGCATGGTGG - Intergenic
1104296683 12:127521756-127521778 GAGATCCAGGCTGGGCATGGTGG - Intergenic
1105997463 13:25686146-25686168 GCCATGCAGGCTTGGGAGGGAGG + Intronic
1106280286 13:28261543-28261565 GAGTTCCAGGCTGGGCCTGGTGG + Intronic
1111343818 13:86923481-86923503 ATGTTCCAGGTTTGGGGTGGGGG - Intergenic
1114646363 14:24258694-24258716 GGGTTCAAGGCATGGGTTGGGGG + Intronic
1114665218 14:24373593-24373615 TCATTCAAGGCTTTGGATGGAGG + Intronic
1114850538 14:26378024-26378046 TTGTTCCAGGCTGGGCATGGTGG + Intergenic
1116235888 14:42279182-42279204 GAGCTCCAGGCTGGGGACGGTGG - Intergenic
1117324717 14:54658519-54658541 GGGTCCCATGCTTAGGATGGGGG - Intronic
1117554823 14:56873120-56873142 ATGTTCCAGGCTGGGCATGGTGG - Intergenic
1118404586 14:65411718-65411740 GCGCCCCAGGCTTGGGATCTGGG + Exonic
1118713799 14:68544961-68544983 GAGTTCCAGGGATGGGATGTGGG + Intronic
1120749636 14:88186021-88186043 GCGCTCCATGCTGCGGATGGTGG + Exonic
1121237988 14:92406782-92406804 GGCCTCCAGGCTTGTGATGGGGG + Intronic
1122263462 14:100535914-100535936 GGGTTCAAGGCTGAGGATGGAGG - Intergenic
1122330387 14:100908305-100908327 GCATTCCAGGCTGGGCATGGTGG + Intergenic
1122871421 14:104640708-104640730 GCCATCCATGCTGGGGATGGGGG - Intergenic
1124418435 15:29493686-29493708 GCATTCCTGGCTAGGCATGGTGG + Intronic
1124464398 15:29923632-29923654 TGGTTGCAGACTTGGGATGGAGG + Intronic
1125083915 15:35707294-35707316 GCCTTCCAGGCTGGTCATGGTGG - Intergenic
1125383708 15:39114500-39114522 CTGCCCCAGGCTTGGGATGGGGG - Intergenic
1126117044 15:45217542-45217564 GAATTCCAGGCTGGGCATGGTGG + Intergenic
1129260693 15:74365650-74365672 TTCTTCCAGGCCTGGGATGGTGG - Intronic
1129291039 15:74567867-74567889 GGGTTCCAGGGTTGAGATGCTGG + Intronic
1129321032 15:74775139-74775161 GGCTTCCAGCCTTGGGATGTGGG + Intergenic
1129559625 15:76552743-76552765 ACGTTCCTGGCTGGGGGTGGGGG - Intronic
1129872018 15:78946535-78946557 GCGTTCCAGGCTGAGGAGGCCGG + Intronic
1130612887 15:85377716-85377738 GGGTTTCAGGCTGGGCATGGTGG + Intergenic
1130653751 15:85777471-85777493 GCTTTCCAGGCTTTGGCTGCAGG - Intronic
1130700748 15:86178024-86178046 TCATTCCAGGCTGGGCATGGTGG + Intronic
1132455893 16:22741-22763 CCGATCAAGGCATGGGATGGTGG + Intergenic
1132612368 16:823746-823768 GCGTTCCGGATTTGGGATTGCGG + Intergenic
1135509688 16:23071646-23071668 CGGCTCCAGGCTTGGCATGGAGG - Intronic
1136077143 16:27824972-27824994 TCGTCCCAGGCTGTGGATGGTGG - Intronic
1136528580 16:30849934-30849956 GCCTTCCAGGCTGGGCGTGGTGG + Intronic
1137632453 16:49956637-49956659 GTGTTCCAGGCTGGGTGTGGTGG - Intergenic
1137872321 16:51962469-51962491 GCGTCTCACTCTTGGGATGGTGG - Intergenic
1138283523 16:55790718-55790740 GGGTTCCAGTCTTGGTGTGGTGG + Intergenic
1138285479 16:55806269-55806291 GGGTTCCAGTCTTGGTGTGGTGG - Intronic
1141857594 16:86694474-86694496 GCGGTCCAGGCTGGGGAAGAGGG + Intergenic
1142362352 16:89633387-89633409 GCGTGCCAGGCTGGGCTTGGGGG + Intronic
1142404206 16:89877988-89878010 ACATTCCAGGCTAGGGTTGGTGG + Intronic
1143205536 17:5137597-5137619 CCCTTCCAGGCTGGGGCTGGTGG - Intronic
1143773547 17:9183193-9183215 GGGTTCCAGGCTTGGGAGAGAGG - Intronic
1144638640 17:16925977-16925999 CCTTTCCAGGCTGGGGCTGGTGG + Intergenic
1144876580 17:18400289-18400311 CCCTTCCAGGCTGGGGCTGGTGG - Intergenic
1145155646 17:20544131-20544153 CCCTTCCAGGCTGGGGCTGGTGG + Intergenic
1145395499 17:22490867-22490889 GCGTTTCAGGGTGGGCATGGTGG + Intergenic
1145761248 17:27426406-27426428 CCCTTCCAGGCTGGGGCTGGTGG - Intergenic
1145798284 17:27668297-27668319 CCCTTCCAGGCTGGGGTTGGTGG + Intergenic
1146161292 17:30560563-30560585 CCCTTCCAGGCTGGGGCTGGTGG - Intronic
1146843088 17:36168198-36168220 TCCTTCCAGGCTGGGGCTGGTGG + Intronic
1146855393 17:36256139-36256161 TCCTTCCAGGCTGGGGCTGGTGG + Intronic
1146865228 17:36332236-36332258 TCCTTCCAGGCTGGGGCTGGTGG - Intronic
1146871299 17:36380050-36380072 TCCTTCCAGGCTGGGGCTGGTGG + Intronic
1146878659 17:36431132-36431154 TCCTTCCAGGCTGGGGCTGGTGG + Intronic
1146882607 17:36452278-36452300 TCCTTCCAGGCTGGGGCTGGTGG + Intergenic
1147068088 17:37932830-37932852 TCCTTCCAGGCTGGGGCTGGTGG - Intronic
1147074185 17:37980674-37980696 TCCTTCCAGGCTGGGGCTGGTGG + Intronic
1147079618 17:38012385-38012407 TCCTTCCAGGCTGGGGCTGGTGG - Intronic
1147085707 17:38060212-38060234 TCCTTCCAGGCTGGGGCTGGTGG + Intronic
1147095559 17:38136327-38136349 TCCTTCCAGGCTGGGGCTGGTGG - Intergenic
1147101654 17:38184178-38184200 TCCTTCCAGGCTGGGGCTGGTGG + Intergenic
1147417602 17:40304726-40304748 GAGGTCCAGGCTGGGGGTGGTGG + Intergenic
1147465173 17:40605319-40605341 GGGTTACAGGGTTGGGGTGGAGG + Intergenic
1148486594 17:47994984-47995006 TCCATCCAGGCTTGGGAAGGAGG + Intergenic
1149846252 17:60010684-60010706 TCCTTCCAGGCTGGGGCTGGTGG + Intergenic
1150084601 17:62267263-62267285 TCCTTCCAGGCTGGGGCTGGTGG + Intergenic
1151294482 17:73174436-73174458 ATGTTCCGGGCTGGGGATGGTGG + Intergenic
1151836762 17:76586901-76586923 TCGGACCAGGCTTGGGATTGGGG + Intronic
1151881692 17:76899354-76899376 TCATTCCAGGCTGGGTATGGTGG + Intronic
1152117530 17:78397760-78397782 GGCTTCCAGGCTTGGAGTGGAGG - Intronic
1152854711 17:82658217-82658239 GCGTCCGAGCCTTGGGAGGGCGG - Intronic
1152855614 17:82663465-82663487 CCGCTCTTGGCTTGGGATGGGGG - Intronic
1153411643 18:4799854-4799876 GGTTTCCAGGCTTGAGATTGGGG + Intergenic
1154475324 18:14748811-14748833 GCCCCCCAGGCCTGGGATGGGGG + Intronic
1154954122 18:21239082-21239104 GTGTTCCGGGCTGGGCATGGTGG + Intergenic
1156358268 18:36361396-36361418 GCTGTCCAGGCTGGGCATGGTGG + Intronic
1157204844 18:45689182-45689204 ACGTGCCAGGCCTGGAATGGGGG - Intergenic
1157642595 18:49232894-49232916 CCGTTTCAGGCTGGGCATGGTGG - Intronic
1157831640 18:50861723-50861745 GTGTTACAGGCTGGGCATGGTGG - Intergenic
1158781949 18:60662763-60662785 GCGCTCCAGACCTGGGGTGGTGG + Intergenic
1159844295 18:73440174-73440196 GCAGCCCAGGTTTGGGATGGAGG + Intergenic
1160733223 19:650236-650258 GGGGCCCAGGCTGGGGATGGTGG + Exonic
1161395872 19:4044565-4044587 GAGGTCCAGGCTGGGGTTGGGGG - Exonic
1161453880 19:4360849-4360871 GCCTCCCTGGGTTGGGATGGGGG + Exonic
1161724170 19:5918832-5918854 GTGGTCCAGGCTTGGGGAGGAGG - Intronic
1161804296 19:6433563-6433585 GGGTTCCAGGATGGGGGTGGAGG + Exonic
1161912396 19:7204340-7204362 TCATTCCAGGCTGGGCATGGTGG - Intronic
1163080132 19:14933365-14933387 GATTTCCAGGCTGGGCATGGTGG - Intergenic
1163120895 19:15217148-15217170 GAATTCCAGGCTGGGCATGGTGG - Intergenic
1163467402 19:17476246-17476268 GTGCTCCAGGCTGGGCATGGTGG + Intronic
1164160742 19:22624034-22624056 GGCTGCCAGGCTAGGGATGGGGG - Intergenic
1164179440 19:22806717-22806739 GGCTGCCAGGCTGGGGATGGGGG + Intergenic
1164401523 19:27905344-27905366 GTGTTCCAGTCCTGGGATAGGGG - Intergenic
1166138873 19:40794855-40794877 GTGTGCCAGGCTGGGCATGGTGG + Intronic
1166698439 19:44867683-44867705 GCGTTCCAGGAATGGAAAGGGGG + Intronic
1166952792 19:46441012-46441034 GCAATCTAGGCTGGGGATGGTGG + Intergenic
1168093445 19:54100709-54100731 GGGTTCCTGGCTGGGGTTGGGGG - Intronic
1168118403 19:54239080-54239102 GCGTGTGAGGCTGGGGATGGTGG + Exonic
1168419683 19:56193246-56193268 GGGGTCCAGGATTGGGATGAGGG - Intronic
926156606 2:10458360-10458382 GCGTTCCAGGCCAGGTGTGGTGG - Intergenic
928158977 2:28904089-28904111 GAGTTCTAGGCTGGGTATGGTGG - Intronic
929919284 2:46161100-46161122 GCCCTCCTGGCTTGGAATGGTGG - Intronic
930203924 2:48570045-48570067 GAATTCCAGGCTGGGCATGGTGG + Intronic
932618432 2:73251094-73251116 GCGTTTGGGGCTTGGGATGGAGG + Intronic
933276923 2:80293887-80293909 GAGTGTCAGGCTTGGGATTGGGG + Intronic
933794555 2:85909235-85909257 GAGTTCCAGGCAAGGGAGGGTGG - Intergenic
934068175 2:88359436-88359458 GTGTTCCAGGCTGGGTGTGGTGG + Intergenic
935315419 2:101828988-101829010 TCGTTTTATGCTTGGGATGGAGG + Intronic
938236843 2:129712249-129712271 GCGTTGCAGGCTTGTCATGGAGG - Intergenic
938782550 2:134598624-134598646 GCGTTGCAGGCTGGGCGTGGTGG + Intronic
940165427 2:150765190-150765212 GCATTCCAGGCAGCGGATGGGGG - Intergenic
943711345 2:191098597-191098619 GGGTGCCAGTCTTGGGGTGGGGG + Intronic
944388115 2:199187416-199187438 CCCTTCCAGGCTGGGCATGGTGG + Intergenic
946234915 2:218318207-218318229 GGGTTCCTGGGTTGGGGTGGGGG - Intronic
946924823 2:224616270-224616292 GCATTCCATGCCTGGGATTGTGG + Intergenic
948056373 2:235011903-235011925 GCATTCCAGGCTCTGGGTGGGGG + Intronic
948337880 2:237224866-237224888 GCGTTCTAGGCTTGGCACAGTGG + Intergenic
948866472 2:240777559-240777581 GCGTTCCAGGCTTGGGATGGTGG - Intronic
1168814190 20:725452-725474 GAGCTCCAGGCTTTGGCTGGGGG - Intergenic
1169051548 20:2582761-2582783 GCGTTCAAGGCCAGGGATGGTGG - Intronic
1170895960 20:20414535-20414557 GCCATCCAGGATTGGGACGGTGG - Intronic
1171005489 20:21461489-21461511 GACTTCCAGGCTGGGGGTGGTGG + Intergenic
1174172462 20:48625918-48625940 GCGGTAGAGGCTGGGGATGGAGG + Exonic
1174511988 20:51060340-51060362 GGGTTCCTGGCCTGTGATGGGGG + Intergenic
1174700664 20:52605236-52605258 GAGATCCAGGCTGGGCATGGTGG + Intergenic
1174725702 20:52859595-52859617 GAATTCCAGGCCTGGGAGGGAGG - Intergenic
1175195956 20:57243552-57243574 GGGTTTGAGGCCTGGGATGGGGG + Intronic
1175818585 20:61896388-61896410 GCGCCCCAGGCCTGGGATGCAGG - Intronic
1176030084 20:63007535-63007557 GCGTTGCAGGCCGGGGAGGGCGG + Intergenic
1176309968 21:5144387-5144409 GGGTCCCGAGCTTGGGATGGAGG - Intronic
1177749058 21:25257072-25257094 AAGTTCCAGGCTGGGCATGGTGG + Intergenic
1178100747 21:29266223-29266245 GAGTCCCAGGCATGGGGTGGTGG - Intronic
1178164911 21:29962308-29962330 GGTTTCCAGGCTTGGGGTTGGGG + Intergenic
1178747471 21:35266865-35266887 GTGATCCAGGCTGGGCATGGAGG - Intronic
1178768109 21:35474188-35474210 GAGTTCCAGGCTAGGCATAGTGG + Intronic
1178899758 21:36589482-36589504 GTGTGCCAGGCTGGGGAGGGAGG - Intergenic
1179847088 21:44117645-44117667 GGGTCCCGAGCTTGGGATGGAGG + Intronic
1181031115 22:20149276-20149298 GGGTGCCAGGCTGGGGGTGGAGG - Intronic
1181175280 22:21031774-21031796 GCGTGCCAGGCTAGCAATGGTGG + Exonic
1181694089 22:24584442-24584464 GGGTCCCAGGACTGGGATGGAGG - Intronic
1182134672 22:27890235-27890257 AGCTTCCAGGGTTGGGATGGAGG - Intronic
1182294348 22:29304501-29304523 GGGTTGCAGGTTTGGGGTGGGGG - Intergenic
1183360715 22:37381780-37381802 GAGCTCCAGGCTAGGGATGGTGG + Intronic
1183784622 22:40022213-40022235 GGATTCCAGGCTTGGCATGGAGG + Intronic
1183821100 22:40346543-40346565 GGGTCGCAGGGTTGGGATGGCGG + Exonic
1184184271 22:42853910-42853932 CCCTTCCGGGCGTGGGATGGTGG + Intronic
1184528484 22:45039713-45039735 GAGTACCAGGCTGGGGATGGAGG - Intergenic
949932616 3:9090922-9090944 GCTTTTCAGGCTGGGCATGGTGG - Intronic
953202629 3:40790991-40791013 GAGTTCCTGGCTAGGGATAGGGG + Intergenic
953742197 3:45547573-45547595 TCCTTCCAGGCCTGGGATGAGGG + Exonic
953953914 3:47215779-47215801 TCGTTCCAGGCTGGGCACGGTGG + Intergenic
954780680 3:53057277-53057299 CCGCTCCAGGCTGGGCATGGTGG - Intronic
954850424 3:53595411-53595433 AAGTTCCAGGGGTGGGATGGGGG - Intronic
955891805 3:63658180-63658202 ATGTTCCAGGCTTGGGAAGCTGG - Intronic
958777677 3:98505468-98505490 GCCTTCCAGGAATGGGATTGAGG + Intronic
961233199 3:125339163-125339185 GTGTTTCTGGCTGGGGATGGTGG - Intronic
961443743 3:126968388-126968410 GAGATCCAGGCTTGGCCTGGGGG - Intergenic
962434236 3:135349721-135349743 GCTCTCCATGCTTGGGAAGGCGG - Intergenic
964034727 3:152181976-152181998 GCCCTCCAGGGTTGGTATGGTGG + Intergenic
966925875 3:184644284-184644306 GGGCTGCAGGCTTGGCATGGTGG - Intronic
967154035 3:186676485-186676507 TCATTCCAGGCTGGGCATGGTGG + Intronic
969689749 4:8697982-8698004 CCCTTCCAGCCATGGGATGGAGG - Intergenic
969907520 4:10410896-10410918 GCGTGCCAGGCTATGGAGGGAGG + Intergenic
973821291 4:54663949-54663971 ACGTTACAGGCTGGGGGTGGAGG + Intronic
974271417 4:59655995-59656017 GAGTTCCTGGGTTGGGATGCTGG - Intergenic
975785768 4:77886618-77886640 GCCTGCCAGGCTGGGTATGGTGG - Intronic
976258931 4:83127534-83127556 GTTTTCCAGGCTGGGCATGGTGG + Intronic
977451737 4:97207442-97207464 GCAATCCAGGCAAGGGATGGTGG + Intronic
982003009 4:151038241-151038263 ACTTTCCAGGCTGGGCATGGTGG - Intergenic
983890463 4:173024864-173024886 GAGTTCCAGGCTGGGCACGGTGG - Intronic
985619786 5:948128-948150 GCGGCCCAGGCGTGGGAAGGAGG + Intergenic
986151133 5:5131350-5131372 GCCTTCCTGACTAGGGATGGAGG - Intergenic
986819573 5:11450610-11450632 GCGTCCCAGGCTGGGCGTGGTGG + Intronic
988392263 5:30650169-30650191 GCGTTCCATGCTTGGGAACAAGG + Intergenic
988950577 5:36254981-36255003 GCATCCCAGACATGGGATGGGGG - Intronic
992110728 5:73490675-73490697 GTGTTCCAGGCTGGGCGTGGTGG + Intergenic
992574052 5:78092935-78092957 GCCTTTTAGGCTTGGCATGGTGG - Intronic
992892790 5:81219366-81219388 GCTGTCCAGGCTGGGCATGGTGG - Intronic
993198952 5:84787917-84787939 GGTTTCCAGGCTGGGCATGGAGG + Intergenic
994824689 5:104698419-104698441 CCGCTCCAGGCCTGTGATGGGGG - Intergenic
996112282 5:119580014-119580036 GATTTCCAGGGTAGGGATGGAGG - Intronic
996419503 5:123246666-123246688 GCGTTTCTGGCTGGGCATGGTGG - Intergenic
998132946 5:139660339-139660361 TTGTGCCAGGCTTGGGGTGGAGG - Intronic
999317068 5:150591053-150591075 AGGTGCCAGGCCTGGGATGGGGG + Intergenic
999527023 5:152418111-152418133 CCATTCCAGGCTGGGCATGGTGG + Intronic
1000244098 5:159434627-159434649 GCTTTGCAGGGGTGGGATGGGGG + Intergenic
1000555067 5:162716248-162716270 GTGTTCCTGGCTGGGCATGGTGG + Intergenic
1000905608 5:166962621-166962643 GTGTTCCTGGTTGGGGATGGGGG + Intergenic
1002388236 5:178887612-178887634 TCTTTCCAGGCTGGGCATGGTGG + Intronic
1003007310 6:2393709-2393731 GGGTGCCAGGATTGGGAAGGGGG - Intergenic
1003939974 6:11014901-11014923 GCGTTCAAGTCTTTGCATGGGGG - Intronic
1004266219 6:14150551-14150573 GGGTCCCAGGCTTGTGAAGGAGG - Intergenic
1004562338 6:16761871-16761893 TCCTTCCAGGTTTGGGAAGGGGG + Intergenic
1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG + Exonic
1006815096 6:36844752-36844774 CCGTTTGAGGCTGGGGATGGTGG + Intergenic
1012211359 6:96522081-96522103 GCGATCCAGGCTCGGGACAGAGG - Intronic
1013118607 6:107122043-107122065 GTGTCCCAAGCCTGGGATGGAGG + Intergenic
1013289058 6:108705404-108705426 AAGATCCAGGTTTGGGATGGAGG - Intergenic
1013327498 6:109062175-109062197 GCCTTCCAGGCTGGGCATGGTGG - Intronic
1016454762 6:144218786-144218808 TCTTTATAGGCTTGGGATGGGGG + Intergenic
1017275005 6:152556287-152556309 GCAGTACAGGCTTGGGAAGGGGG - Intronic
1018400552 6:163415386-163415408 CCTTTCCCCGCTTGGGATGGTGG + Intronic
1019365170 7:629402-629424 GTTTTCCAGCCTTGGGGTGGTGG - Intronic
1019365239 7:629626-629648 GTTTTCCAGCCTTGGGGTGGTGG - Intronic
1019365256 7:629682-629704 GTTTTCCAGCCTTGGGGTGGTGG - Intronic
1019706294 7:2498746-2498768 GAGCTCCAGGGTAGGGATGGGGG - Intergenic
1019787947 7:2991048-2991070 GAGTTCCAGGCCAGGCATGGTGG - Intronic
1020493848 7:8822506-8822528 GGCCTCCAGGCTTGTGATGGGGG + Intergenic
1021684308 7:23167915-23167937 GCGCTGCAGCCATGGGATGGTGG + Exonic
1021719563 7:23492231-23492253 GTGTTCCTGGCTGGGCATGGTGG - Intergenic
1022394077 7:29970030-29970052 GTGGTCCAGGCTGGAGATGGTGG - Intronic
1023012540 7:35936970-35936992 GGGTTCCAGGATAGGTATGGTGG + Intergenic
1023430984 7:40090921-40090943 GAATTCCAGGCTGGGCATGGTGG + Intronic
1024078596 7:45836875-45836897 GGGTTCCAGGATAGGTATGGTGG - Intergenic
1024567457 7:50693735-50693757 GCTTTGCAGGCATGGGATTGGGG + Intronic
1026065826 7:67071907-67071929 GTGTTCCAGGCCGGGTATGGTGG - Intronic
1026711052 7:72739942-72739964 GTGTTCCAGGCCGGGTATGGTGG + Intronic
1026815212 7:73505836-73505858 GCGTTCTTGGCTGGGCATGGTGG - Intronic
1026846011 7:73699641-73699663 GCGTTGCATGTTTGGGATGGTGG - Exonic
1027334467 7:77133629-77133651 GTGTTCCAGGCTGGGCGTGGTGG - Intronic
1028796440 7:94908216-94908238 GAGTTGCAGGCTGGGGGTGGGGG + Intronic
1029249700 7:99226968-99226990 GGGACCCAGGCTTGGGAGGGTGG + Intergenic
1030049418 7:105524511-105524533 GCGTTTAAGGCTGGGCATGGTGG - Intergenic
1030331907 7:108279845-108279867 GTGTTGCAGGCTGGGCATGGTGG - Intronic
1032525535 7:132576541-132576563 GCGTTCGGGGCTGGGGCTGGAGG - Exonic
1032831217 7:135628456-135628478 GCCTTGCAGGCTGGGCATGGTGG + Intronic
1033767043 7:144505553-144505575 GGTTTCCAGGCTTGAGGTGGGGG - Intronic
1033796545 7:144851868-144851890 GAGCTCCAGGCTGGGCATGGTGG - Intergenic
1034416300 7:150965939-150965961 GCTGTCCAGACTTGGGCTGGAGG - Intronic
1034686608 7:152977375-152977397 GGATTCTAGGCTTGGCATGGTGG + Intergenic
1035036513 7:155898887-155898909 CCGTTCTAGGCTGGGCATGGTGG - Intergenic
1038504674 8:28074084-28074106 AAGTTCCAGGCTGGGCATGGTGG - Intronic
1038580222 8:28741743-28741765 GTGATCCAGGCTGGGCATGGTGG - Intronic
1039806624 8:41005424-41005446 GTGTTCCCGGCTGGGGGTGGTGG + Intergenic
1043510463 8:80945861-80945883 GGCTTCCAGGCCTGTGATGGGGG - Intergenic
1045172485 8:99686633-99686655 TCGCTGCAGGCCTGGGATGGTGG - Intronic
1045432196 8:102124345-102124367 GCGAGCCAGGCTGGGGAGGGGGG - Intronic
1048288345 8:133160409-133160431 GGGTTCAAGGGTTGGGGTGGGGG + Intergenic
1049220380 8:141426222-141426244 ACGTTTCAGTCTTGGGAAGGCGG - Intronic
1052444701 9:28545482-28545504 ACATCCTAGGCTTGGGATGGAGG + Intronic
1052871217 9:33509216-33509238 GCGTTTCTGGCTGGGCATGGCGG + Intergenic
1053144686 9:35704458-35704480 GCGCTCCAGGCTGGGAATCGTGG - Exonic
1053450703 9:38192031-38192053 GGGTTCCCAGCTTGAGATGGAGG - Intergenic
1055300108 9:74873946-74873968 GCAGTCCAGGCTGGGCATGGTGG + Intronic
1056967831 9:91179316-91179338 GGGATCCAGGCTTAGGCTGGTGG + Intergenic
1057382350 9:94580502-94580524 GCAATCCAGGCTGGGCATGGTGG - Intronic
1058447327 9:105065661-105065683 GAGTGCCAGGCTGGGGAAGGTGG - Intergenic
1060506085 9:124199356-124199378 GAGTTCCAGACTTGAGGTGGTGG - Intergenic
1060641789 9:125245047-125245069 GCTTTCCAGGCTGGGCCTGGTGG + Intergenic
1062591625 9:137277177-137277199 GGGCTCCAGGCTGGGGACGGAGG + Intergenic
1187298464 X:18025556-18025578 TCTTTCCAGGTTTGGGGTGGGGG + Intergenic
1187336899 X:18389326-18389348 ACTTTCCAGACTTGGGAAGGAGG + Intergenic
1187579456 X:20592754-20592776 GTGTTCCAGGCCGGGCATGGTGG + Intergenic
1188067742 X:25682260-25682282 ATATTCCAGGCTTGGGATGTTGG + Intergenic
1190060194 X:47205906-47205928 CAGTTCCAGGGTGGGGATGGGGG - Intronic
1191840425 X:65509805-65509827 GCATTTCAGGCTGGGGACGGTGG + Intergenic
1193468985 X:81876552-81876574 GCGGGACAGGCTTGGGAAGGAGG - Intergenic
1196854930 X:119973843-119973865 GCCTTCTGGGCTGGGGATGGGGG + Intergenic
1196857335 X:119996573-119996595 GCCTTCTGGGCTGGGGATGGGGG + Intergenic
1198771577 X:140136305-140136327 ATGTTCCAGGCTGGGCATGGTGG + Intergenic
1198824624 X:140686397-140686419 GAGTTCAAGGCTGGGAATGGTGG + Intergenic
1200400477 X:156016984-156017006 CCGATCAAGGCATGGGATGGTGG - Intergenic