ID: 948867238

View in Genome Browser
Species Human (GRCh38)
Location 2:240782337-240782359
Sequence GGGGCTGCTGGGAGACACCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 7, 3: 36, 4: 369}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948867238_948867250 8 Left 948867238 2:240782337-240782359 CCTCGGTGTCTCCCAGCAGCCCC 0: 1
1: 0
2: 7
3: 36
4: 369
Right 948867250 2:240782368-240782390 GCCCTGCCGTGAGGCCGCCCCGG 0: 1
1: 0
2: 0
3: 18
4: 275
948867238_948867246 -1 Left 948867238 2:240782337-240782359 CCTCGGTGTCTCCCAGCAGCCCC 0: 1
1: 0
2: 7
3: 36
4: 369
Right 948867246 2:240782359-240782381 CCGCCCCAGGCCCTGCCGTGAGG 0: 1
1: 0
2: 3
3: 47
4: 438
948867238_948867258 28 Left 948867238 2:240782337-240782359 CCTCGGTGTCTCCCAGCAGCCCC 0: 1
1: 0
2: 7
3: 36
4: 369
Right 948867258 2:240782388-240782410 CGGACGCCCTCCGTCCCCGCAGG 0: 1
1: 0
2: 1
3: 13
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948867238 Original CRISPR GGGGCTGCTGGGAGACACCG AGG (reversed) Intronic