ID: 948867238

View in Genome Browser
Species Human (GRCh38)
Location 2:240782337-240782359
Sequence GGGGCTGCTGGGAGACACCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 7, 3: 36, 4: 369}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948867238_948867258 28 Left 948867238 2:240782337-240782359 CCTCGGTGTCTCCCAGCAGCCCC 0: 1
1: 0
2: 7
3: 36
4: 369
Right 948867258 2:240782388-240782410 CGGACGCCCTCCGTCCCCGCAGG 0: 1
1: 0
2: 1
3: 13
4: 79
948867238_948867246 -1 Left 948867238 2:240782337-240782359 CCTCGGTGTCTCCCAGCAGCCCC 0: 1
1: 0
2: 7
3: 36
4: 369
Right 948867246 2:240782359-240782381 CCGCCCCAGGCCCTGCCGTGAGG 0: 1
1: 0
2: 3
3: 47
4: 438
948867238_948867250 8 Left 948867238 2:240782337-240782359 CCTCGGTGTCTCCCAGCAGCCCC 0: 1
1: 0
2: 7
3: 36
4: 369
Right 948867250 2:240782368-240782390 GCCCTGCCGTGAGGCCGCCCCGG 0: 1
1: 0
2: 0
3: 18
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948867238 Original CRISPR GGGGCTGCTGGGAGACACCG AGG (reversed) Intronic
900086758 1:902285-902307 GGCTCTGTTGGGAGACACCCAGG - Intergenic
900114047 1:1020995-1021017 GGTGCTTCTGGGAGCCCCCGGGG + Intronic
900368859 1:2322690-2322712 CGGGCTGCTTGGAAACACTGTGG - Intronic
901186387 1:7375985-7376007 GAGGCAGCTGGGAGACCCCTTGG - Intronic
902229984 1:15021697-15021719 GGGACTGCAGGGAGCCACAGGGG - Intronic
902628874 1:17692945-17692967 GAGGCTGCTGGGTGACAAGGCGG - Intronic
904276960 1:29391079-29391101 GGGGCTGTGGGGAGACTCAGTGG + Intergenic
904306501 1:29593431-29593453 GGGGGTGCTGGGATACAGTGGGG + Intergenic
904493291 1:30873183-30873205 GAGGCTGCAGGGAGGCACTGTGG + Exonic
904741035 1:32676020-32676042 GAGGCTGCTGTGAGACATGGTGG + Intronic
906201638 1:43964168-43964190 GAGCCTGCAGGGAGACAGCGTGG - Intronic
906202674 1:43970208-43970230 GGCGCTGCAGCGAGAGACCGGGG + Exonic
906248884 1:44296141-44296163 GGCACTGCTGGGAGGCACGGTGG - Intronic
907050866 1:51329469-51329491 TGGGTTGCTGGGGGACACCCTGG - Intronic
907319248 1:53592522-53592544 AGGGCTGCTGGGAGACAGCTGGG - Intronic
915140442 1:153764629-153764651 GGGGCTGCTGGCACATACGGAGG - Intronic
915555636 1:156659272-156659294 GGGGCTTCTGGGAAATACCTAGG + Exonic
915593111 1:156881701-156881723 GGGGCTGCTGGGAGCTATGGGGG - Intronic
915981176 1:160420764-160420786 AGGGCTGATGAGAGACACAGAGG - Intronic
916022783 1:160808469-160808491 GGAGCTGCTGGGAGACTGTGGGG - Intronic
916505277 1:165423026-165423048 GGGGCTGCTGGCTGAGACTGGGG - Intronic
919797422 1:201329655-201329677 GGGGGTGCTGGCAGACAGCCTGG - Intronic
919880143 1:201895635-201895657 GGGGCTGCAGGCAGAGACCGTGG + Intergenic
919920305 1:202163285-202163307 CGGGATGCTGGGAGACCCCTGGG - Intergenic
920032737 1:203047197-203047219 GGGTCTGCTGGGACACAGCCAGG - Intronic
920096177 1:203487865-203487887 GGGGCTTCTGGGAGACGTCCAGG - Exonic
921685306 1:218082982-218083004 GGGGCTGGTGGGAGTCAGTGGGG - Intergenic
922057296 1:222053277-222053299 AGGGCTGCTGGGAAGCCCCGTGG - Intergenic
922184059 1:223258515-223258537 GGGGCTGGGGGGAGTCACCTGGG + Intronic
922418934 1:225446700-225446722 GGGGCTTCTAGGAAACACCTGGG - Intergenic
922664220 1:227454989-227455011 GGAAATGCTGGGAGACACCAGGG + Intergenic
922726853 1:227926742-227926764 GGATGTGCTGGGAGCCACCGGGG + Intronic
924500683 1:244635622-244635644 GCTGCTTCTGGGAGACACGGGGG - Intronic
1062829066 10:593419-593441 GGGTCTGCTGGGAGACAGCGGGG - Intronic
1062982634 10:1737732-1737754 GGTGCGTCTGGGAGAGACCGGGG + Intergenic
1063449954 10:6144757-6144779 CGGGCTGCTGGGGGAAGCCGGGG - Intergenic
1063502786 10:6570076-6570098 GGGGGTCATGGGAGACACAGAGG + Intronic
1064089004 10:12367596-12367618 GGGGGTGATGGGAGACAGTGAGG + Intronic
1067374833 10:45718340-45718362 GGGTCAGCTGGGGGACACCAAGG + Intergenic
1067378897 10:45754209-45754231 GGGTCAGCTGGGGGACACCAAGG - Intronic
1067882647 10:50059978-50060000 GGGTCAGCTGGGGGACACCAAGG + Intergenic
1067886599 10:50094871-50094893 GGGTCAGCTGGGGGACACCAAGG - Intronic
1073289997 10:102408821-102408843 GCGGCTTGTGGGAGGCACCGAGG - Intronic
1074392626 10:113070911-113070933 GTGGCTACTAGGAGACACGGGGG - Intronic
1075413989 10:122249183-122249205 AGGGCTGCTGGGAGGCCCCTGGG - Intronic
1075521949 10:123148461-123148483 GGGGCCCCTCGGAGGCACCGCGG + Exonic
1075631043 10:124000860-124000882 GGGGCCACTGGGAAGCACCGAGG + Intergenic
1075799144 10:125141997-125142019 GGGGCTGGTGGGACACAGTGTGG + Intronic
1076401822 10:130189930-130189952 GGGGCTGCAGGGACACCCCGGGG + Intergenic
1076707682 10:132310539-132310561 GGGGATGCTGGGAGGGACTGAGG + Intronic
1078526414 11:12104896-12104918 TGGGGTGCTGGGGGACAGCGAGG - Intronic
1081669809 11:44936745-44936767 CGGGCAGCTGGGAGACCCAGCGG - Intronic
1082236402 11:49823431-49823453 GGGCATGCTGGGAGCCACCAAGG + Intergenic
1082239852 11:49857938-49857960 GGGCATGCTGGGAGCCACCAAGG + Intergenic
1082796480 11:57381508-57381530 GGAGCTGGTGGGAGACAATGGGG + Intergenic
1082816960 11:57515374-57515396 GCGTCGGCTGAGAGACACCGAGG - Intronic
1083221997 11:61258713-61258735 GGGGCTGCTGGGGGCCAGGGTGG + Exonic
1083639299 11:64136687-64136709 GGGGCTCCTGGAAGCCACCCGGG - Intronic
1083853197 11:65379558-65379580 GGAGCTGCAGAGAGACACAGTGG + Exonic
1084392956 11:68890621-68890643 GGGCCTGCTGGGAGCTACCCAGG - Intergenic
1084461484 11:69298934-69298956 GGGTGAGCTGGGAGGCACCGTGG - Intronic
1084563255 11:69915752-69915774 AGGGGTGCAGGGAGACACTGAGG - Intergenic
1085054141 11:73394323-73394345 TGGGCTGGTGGGAGATAACGGGG + Intronic
1087046898 11:93850325-93850347 GGGGCCGCTGCTAGACCCCGGGG + Intronic
1087928254 11:103945698-103945720 GGCACTGCTGGGAGCCACCCTGG - Intronic
1088500628 11:110478843-110478865 GGGACTGCCTGGAGGCACCGAGG + Intergenic
1089319075 11:117612844-117612866 GGTGCTGATGGAAGACACCTGGG + Intronic
1089466575 11:118689881-118689903 GGGGCTGCTGGGAGGCAGAGCGG - Intergenic
1090042423 11:123302375-123302397 GCGGCTGCCGGGCGACAACGCGG + Intergenic
1090606196 11:128425064-128425086 GGAACTGCTGGGACACACTGTGG + Intergenic
1090653325 11:128824874-128824896 GAGGGTGCTGGGAGCCACAGGGG + Intergenic
1090675210 11:128986019-128986041 GGAGCTGCTGGATGACATCGTGG + Exonic
1090839883 11:130478410-130478432 GGGGCTGAGGGGTGACACCATGG - Intergenic
1091168090 11:133498212-133498234 GGTGCTCCTGGGAGAGACCTGGG - Intronic
1091251807 11:134150425-134150447 GGGCCTCCTGGCAGACAGCGAGG - Exonic
1091701530 12:2666624-2666646 TGGGCTGCTGGCAGAGACCGTGG + Intronic
1091766741 12:3125733-3125755 TGGCCTGCTGGGTGACACCAGGG + Intronic
1091838298 12:3601455-3601477 CGGGCTGCAGAAAGACACCGTGG + Intergenic
1092205491 12:6612373-6612395 GGGGATTTTGGGAGACAACGAGG + Intergenic
1092257738 12:6936518-6936540 GGGGCTGATTGGAGACAGAGAGG - Exonic
1095942386 12:47735576-47735598 GGGGCAGCTGGGAGACCACCGGG + Intronic
1096262988 12:50104482-50104504 GGGGCTGCTGTGAGATCCTGAGG + Intronic
1096741288 12:53695766-53695788 GGGGCTGCAGGGAGACAGGTGGG + Intergenic
1101824517 12:108209955-108209977 GGGGCAACTGGGAGACCCCAGGG - Intronic
1102031798 12:109744012-109744034 GGGGTTGCAGGGAGACTCCCGGG + Intronic
1103196067 12:119044682-119044704 AGGGCTGCTGGGAGGAACCAGGG + Intronic
1103242720 12:119428509-119428531 GGGGCTGCTGTGTGATACAGTGG - Intronic
1104166796 12:126239212-126239234 GGAGCTGCTGAGAGTCACCATGG + Intergenic
1104580397 12:130007247-130007269 GGGACTGCTGGCAGCCACCTTGG + Intergenic
1104775074 12:131386054-131386076 GGGGCTGCCTGGAGAGCCCGGGG + Intergenic
1104970904 12:132530274-132530296 CCGGCTGCTGGGAGGCACCTGGG + Intronic
1106956179 13:34942102-34942124 GGGACTGCTGCCAGACACTGGGG - Intergenic
1107436161 13:40382466-40382488 CGGGCTGCTCGGAGACAACCTGG - Intergenic
1108003348 13:45924369-45924391 AGGTTTGCTGGGAGACACAGTGG - Intergenic
1112319815 13:98395861-98395883 GCTGCTGCTGGGAGACAATGGGG - Intronic
1113745509 13:112741634-112741656 TGGGCTGCAGGGAGACTCAGGGG + Intronic
1113749269 13:112766952-112766974 GGGAGTGCTGGGAGCCCCCGTGG + Intronic
1113749334 13:112767111-112767133 GGGAGTGCTGGGAGCCCCCGTGG + Intronic
1113749487 13:112767468-112767490 GGGAGTGCTGGGAGCCCCCGTGG + Intronic
1113786881 13:113006677-113006699 GGGGCTGGCGGGAGACACTAAGG + Intronic
1113886992 13:113666238-113666260 GGGACAGCTGGGACACACCTGGG - Intergenic
1113887045 13:113666458-113666480 GGGACAGCTGGGACACACCTGGG - Intergenic
1115763615 14:36600499-36600521 GGAGCTGCTGGGAGAGGCCATGG + Intergenic
1115851105 14:37591437-37591459 GGGGCTCCTGGTGGTCACCGAGG + Exonic
1118156619 14:63248846-63248868 GGAGCTGCTGGGAGCCATCTGGG - Intronic
1119380848 14:74227341-74227363 GGGGCATCTGGGAGTCATCGAGG + Intergenic
1119620780 14:76130481-76130503 GGGTCTGCAGGGAGAGACAGTGG + Intergenic
1121080383 14:91103179-91103201 GGAGCTGCTGCCAGTCACCGAGG + Intronic
1122413354 14:101537147-101537169 GAGGGTGCTGGGAGACCCTGGGG + Intergenic
1122429406 14:101630381-101630403 GGGCCTGCTGGGATACCCTGTGG - Intergenic
1122736940 14:103848339-103848361 GGGACTGCAGGGAGAGACCCAGG - Intergenic
1122739922 14:103866339-103866361 GGGGCTGCGGGGGGACTCCCTGG + Intergenic
1122858695 14:104572413-104572435 GGGGCTGCTGCAAGACACCCTGG - Intronic
1123021169 14:105398589-105398611 GGGGCCGCTGGAGTACACCGCGG - Exonic
1124015110 15:25867137-25867159 GGGGATGCTGGGAGACACCTGGG + Intergenic
1124693155 15:31842562-31842584 GGGGCTGGTGGGGGACAGAGAGG + Intronic
1127531081 15:59844062-59844084 GAGGCTGCTGGGAGAAACAGTGG + Intergenic
1127613285 15:60657898-60657920 GGGGGTCCTGGAAGTCACCGTGG - Intronic
1128482913 15:68054842-68054864 GGGGCTACTGGGATCCACGGAGG - Intronic
1129167319 15:73786082-73786104 GGAGGTGCTGGGGGACACTGTGG + Intergenic
1129526131 15:76215849-76215871 GGGGCTGCTTTGAGACAGCATGG - Exonic
1131098181 15:89669204-89669226 GGGGCTTGTGGGAGACTCAGAGG + Intronic
1131653389 15:94427476-94427498 GGGGCTGGAGGGAGACAGCAAGG + Intronic
1132163792 15:99565877-99565899 AGGGCTGCGGAGGGACACCGAGG + Exonic
1132345939 15:101108879-101108901 GGGGCTGTGGGGAGACCCCCAGG - Intergenic
1132416260 15:101621098-101621120 GCCGCAGCTGGGAGACTCCGAGG - Intergenic
1132553794 16:564151-564173 GGGGCTCCTGGGGGAGACAGGGG - Exonic
1132658098 16:1049629-1049651 GGGGCCGCTGGGAGACACTGTGG + Intergenic
1132698224 16:1211351-1211373 GGCGCTGCTGGGAGCCACGCTGG - Intronic
1132765193 16:1530950-1530972 GAGGCTGCTGGGAGAACCCACGG + Intronic
1132942325 16:2514340-2514362 AGGGCTGCGGGGAGCCGCCGGGG + Intronic
1133101961 16:3485320-3485342 GTGGCTGCAGGCAGACACCATGG + Intronic
1133221472 16:4320858-4320880 GGGGGTGCTGGGGGAGGCCGGGG - Intronic
1135200276 16:20431152-20431174 TGGGCTGCTGGGAGAGGCCCAGG + Intronic
1136186488 16:28591546-28591568 GGGGCTGCTCAGAGACCCCCAGG - Intronic
1136282338 16:29221112-29221134 GGGGCGGCTGGGAGGCCCTGGGG + Intergenic
1136476681 16:30517874-30517896 GGAGCTGGTGGGAGAGATCGAGG + Exonic
1136683607 16:31981749-31981771 GGGGCTCCTGGTAGGCAGCGTGG + Intergenic
1137491816 16:48939256-48939278 GTGGCTACTAGGAGACACAGAGG - Intergenic
1137590051 16:49687900-49687922 GGGGCTCCTTGGAGACCCCAAGG + Intronic
1137724736 16:50649591-50649613 GGGACTGATGGGAGACAGCATGG - Intergenic
1138179482 16:54932234-54932256 GGGCCTACGGGGTGACACCGAGG + Intronic
1138679520 16:58674936-58674958 AGGGCTGCTGGGAGTCATCGAGG - Intronic
1139574189 16:67831012-67831034 TGGGGCCCTGGGAGACACCGAGG + Intronic
1139851469 16:69953256-69953278 AGGGCTGCTGAGGGACCCCGGGG + Intronic
1139880445 16:70176168-70176190 AGGGCTGCTGAGGGACCCCGGGG + Intronic
1140372065 16:74419349-74419371 AGGGCTGCTGAGGGACCCCGGGG - Intronic
1140949274 16:79800590-79800612 GGGGCTGCTAGGAGCCACTGTGG - Intergenic
1141387088 16:83631717-83631739 GGAGCTGCTAGGAGTCACCAAGG - Intronic
1142086710 16:88187030-88187052 GGGGCGGCTGGGAGGCCCCGGGG + Intergenic
1142102985 16:88285420-88285442 GGGGCTGTGGGGAGACAGTGTGG + Intergenic
1142196027 16:88739697-88739719 GGGGCTGCTGGGAGGCTCCGAGG + Intronic
1142356225 16:89603473-89603495 GGGGCTGGAGGGAGGCACTGGGG + Intergenic
1142360016 16:89621493-89621515 GAGCCTGCTGTGAGCCACCGGGG + Intronic
1203086893 16_KI270728v1_random:1189315-1189337 GGGGCTCCTGGTAGGCAGCGTGG + Intergenic
1142614249 17:1125571-1125593 GGGGCTGCTGGGAGGCGGGGAGG + Intronic
1143781812 17:9233115-9233137 GAAGCTGCTGGGAGCCACTGGGG + Intronic
1145869542 17:28262326-28262348 GGGGGTGCTAGGGGAGACCGGGG - Intergenic
1145900999 17:28490498-28490520 GGGGCTGCTGGTGGCCATCGCGG + Exonic
1146172050 17:30641935-30641957 GGGGCTGCTGGGAGCCAGAGAGG - Intergenic
1146345508 17:32057971-32057993 GGGGCTGCTGGGAGCCAGAGAGG - Intergenic
1146798518 17:35800074-35800096 GGGAGTGCTGGGAGGCACTGTGG - Intronic
1147144525 17:38477456-38477478 GGGGCTCCTGGTAGGCAGCGTGG + Intronic
1148331599 17:46817119-46817141 GGGGCTCCTGGGAGAGAGGGTGG - Intronic
1148440393 17:47708977-47708999 CGGGCAGCTGGGGGGCACCGGGG - Exonic
1148912274 17:50949418-50949440 GGGGGTGCTGGGGGAGGCCGAGG - Intergenic
1149636021 17:58170081-58170103 GGGGCTGGTGGTAGCCACCTGGG + Exonic
1150652437 17:67018757-67018779 TGGGGTGCTGGGAGACCCAGGGG + Intronic
1151830208 17:76544979-76545001 GGGGCTGCTGGCGGCCAGCGGGG + Intronic
1151889907 17:76945941-76945963 TGGGGTGCTGGGAGTCACCAAGG + Intronic
1152381230 17:79943271-79943293 GTGGCTGGTGCGAGACACAGCGG + Intronic
1152609389 17:81308182-81308204 GGGGGTGCTGGGAGGGCCCGAGG - Intergenic
1152892307 17:82889400-82889422 GGTGCTGCTGGGAGGCTCAGTGG + Intronic
1154030663 18:10750974-10750996 GGGTCTGCAGGGAGACAAAGGGG - Intronic
1154274381 18:12947253-12947275 GGGGGTGCTAGGAGCCACCACGG - Intronic
1156047550 18:32894131-32894153 AGGGCTGCTTGGAGAAACCTAGG + Intergenic
1157134341 18:45039314-45039336 GGGGCTGGTGGGAGGCACTGTGG - Intronic
1157412930 18:47479012-47479034 GGGCCTGCTGGAAGCCACCGTGG + Intergenic
1158478709 18:57802806-57802828 GGAGGTGCTGGGAGCCCCCGAGG - Intronic
1158884755 18:61816280-61816302 GAGGCAGCTTGGTGACACCGCGG + Exonic
1159534011 18:69692095-69692117 GGGGCGGTGGGGAGTCACCGTGG + Intronic
1159909972 18:74136592-74136614 GGGGCTTCAAGGAGACACCAAGG + Intronic
1160016136 18:75142006-75142028 GGCTCTGCTGGGAGCCACGGGGG - Intergenic
1160031965 18:75269816-75269838 GTGGCTGCTGGGAGCCAGGGGGG - Intronic
1160156448 18:76437336-76437358 GGGGCTGCTGGGCGGCAGGGAGG + Intronic
1160245427 18:77155249-77155271 GCGACTGCCGGGAGACACTGAGG + Intergenic
1161453116 19:4357592-4357614 GGGGCTGTTGGGAGAGCCTGGGG + Intronic
1161610617 19:5240337-5240359 GGGGGTGCAGGGAGACAACTAGG + Intronic
1162990373 19:14298102-14298124 GCGGCTGCTGGGAGCCAGAGAGG + Intergenic
1163158781 19:15452856-15452878 GGGTCTCCGGGGAGACACAGGGG - Intronic
1163566809 19:18056723-18056745 GGAGCTGCTGGGAGAAGCTGAGG + Intergenic
1163575930 19:18110678-18110700 GGGGCTGCTGGGACCCAGCAGGG - Intronic
1163618085 19:18341251-18341273 GGGACAGCTGGGAGAGCCCGAGG - Intronic
1163673700 19:18644724-18644746 GGGGCTGCTGGGGGGCAGTGGGG + Intronic
1165816396 19:38645043-38645065 GGGGGAGCTGGGAGACAGTGGGG + Intergenic
1166328882 19:42067482-42067504 AGGGATGCTGGGAGACCCGGAGG + Intronic
1166748375 19:45152735-45152757 GTGGCTGCCGGGGGACGCCGGGG - Exonic
1166773674 19:45299721-45299743 GGGGCTGCTTGGAGTCCCAGAGG + Intronic
1166824272 19:45599436-45599458 GGGGCTGCAGGGAGAAGGCGGGG - Intronic
1166837549 19:45676886-45676908 GGGGAGACTGGGAGACACCCGGG + Intronic
1166971672 19:46572876-46572898 GAGTCTGCTGGGAGAGACAGAGG + Intronic
1167698243 19:51027255-51027277 GGGGCTGCTGCCAGGCACAGGGG + Intronic
925768881 2:7263170-7263192 GTGGCTTCTGGGAGACATCTGGG + Intergenic
926679402 2:15652469-15652491 GGGGCTGCAGGGAGAGACCATGG - Intergenic
927192964 2:20529527-20529549 AGTGCTGCTGGGAGCCACTGAGG + Intergenic
927240077 2:20913604-20913626 GAGGCTGCTAGGGGACACAGTGG - Intergenic
929925132 2:46201418-46201440 GGGTCTGCTGGGACACAGAGAGG - Intergenic
932320749 2:70820466-70820488 GGGGGTGCAGGGAGACACACTGG + Exonic
933698289 2:85236496-85236518 GGGGCTCCAGGGACACACCAGGG - Intronic
934557375 2:95294590-95294612 GGGGCTGTGGGGAGAAACTGAGG - Intergenic
934650082 2:96085648-96085670 GGGGCTGCTGAGAGGCCCTGGGG + Intergenic
937017594 2:118619938-118619960 GGGGCTGCTGGGTGACAGCAGGG - Intergenic
937989356 2:127653773-127653795 GGGTGTGCTGGGAGAAGCCGGGG + Intronic
938392277 2:130915721-130915743 GGGGCCGCAGTGAGACACCGTGG - Intronic
939949474 2:148451957-148451979 GGGAATACTGGGAGACACAGTGG - Intronic
943529370 2:189059964-189059986 GGGGCTGCAGGGTGACTCAGGGG - Intronic
944621767 2:201522966-201522988 GTGGCTTCTGGGAAACACCCCGG - Intronic
945072386 2:206004626-206004648 GGAGCTGCTGGGGGTCACGGTGG + Exonic
945907974 2:215615444-215615466 GGGACTGCTGGAAAACACTGAGG + Intergenic
947344764 2:229179275-229179297 GGGGCTGATGGGAGCCATGGAGG - Intronic
947863880 2:233382524-233382546 GGGGCTGCAGGCAGACAGCTGGG - Intronic
948625079 2:239263722-239263744 GGGGTTCCTGAGAGACACGGGGG + Intronic
948845619 2:240681574-240681596 GGGGCTGCAGGGAGAGCCAGGGG - Intronic
948848236 2:240693156-240693178 GGGGCTGCAGGGAGAGCCAGGGG + Intronic
948867238 2:240782337-240782359 GGGGCTGCTGGGAGACACCGAGG - Intronic
1168856647 20:1013569-1013591 GGGGCTGCAGGGAGGCAGTGAGG - Intergenic
1168892101 20:1301243-1301265 GGGGCTCCTGGGAGACACCTGGG - Intronic
1168971677 20:1935542-1935564 GGGGCTGCGGGGGGACCCCATGG - Intronic
1170610139 20:17906185-17906207 GAGGCTGCTGGGAGAACCCCAGG + Intergenic
1171122217 20:22577520-22577542 GGGGGCGCTGGTAGACACCTGGG + Intergenic
1171146470 20:22788190-22788212 GGGGCTGCTGGGAGAGACTGAGG - Intergenic
1172448122 20:35003644-35003666 GGGGCTGGTGGGAGCCCCAGTGG + Intronic
1172623655 20:36335309-36335331 GGAGCTGGTGGGACACACCTGGG + Intronic
1174609887 20:51790368-51790390 GGAGCTGCTGGGAGCCTCCTGGG + Exonic
1175133540 20:56806937-56806959 TGGGCTCCGGGGAGACACCATGG - Intergenic
1175237686 20:57525515-57525537 GGGGGCGCTGGGAGACCCGGGGG + Intronic
1175964461 20:62653545-62653567 GGGGCTGCGAGGGGACACAGGGG - Intronic
1175982977 20:62750046-62750068 GGGTCTGCTGAGGGACACCTGGG - Intronic
1176285082 21:5015225-5015247 GGGGCAGCTGGGAGAGGCTGTGG - Intergenic
1179454644 21:41490782-41490804 GGGGCTGCTGGGCATCACTGGGG - Intronic
1179872099 21:44248250-44248272 GGGGCAGCTGGGAGAGGCTGTGG + Intronic
1179982917 21:44905792-44905814 GAGGCAGCTGGGAGACAGTGAGG - Intronic
1180159042 21:45990915-45990937 GGGGCTGCTGCCAGAGGCCGCGG + Intronic
1181546116 22:23603574-23603596 GGAGCTCCTGGGGGACACGGAGG - Intergenic
1181785310 22:25222369-25222391 GGGGCTCCTGAGAGTCACAGTGG + Intronic
1181801522 22:25350795-25350817 GGGGCTGAAGGGAGTCACGGTGG - Intergenic
1182419816 22:30243520-30243542 GGGGCTGCTGGCAGACCCCGAGG - Exonic
1182470893 22:30547566-30547588 GGGACTTCTGGGAGACAGCAGGG + Intergenic
1183086274 22:35489225-35489247 CGGGCTGCTGTGAGGCACTGAGG + Intergenic
1183349176 22:37325113-37325135 GAGGCAGCTGGGAGACACCCAGG + Intergenic
1183373671 22:37449853-37449875 GGGGCTGCTAGGAAACCCCGTGG - Intergenic
1183440206 22:37818683-37818705 GCGGCTCCTGGGAGCCACAGGGG - Intergenic
1183477931 22:38046291-38046313 GGGGCTACAGGGAGCCACGGAGG - Intergenic
1184034516 22:41912141-41912163 GGGGATGTTGGGAGACCCCCTGG + Intronic
1184479562 22:44738599-44738621 GGCTCTGCTGGGAGACAGCCTGG - Intronic
1184493721 22:44825424-44825446 GGGGCAGCTGGCAGCCACGGAGG - Intronic
1184557595 22:45241367-45241389 TGGTCTCCTGGGGGACACCGTGG + Intergenic
1184648823 22:45910382-45910404 GTGGCAGCTGGGAGACACGGTGG + Intergenic
1184690467 22:46115052-46115074 GGGGCTGCTCTGAGACTCTGAGG - Intergenic
1184775194 22:46619665-46619687 GGGGCAGCTGGCAGACTCCAGGG - Intronic
1184877936 22:47287114-47287136 GGGGTTGCTGGAAGCCCCCGGGG + Intergenic
1185066263 22:48633101-48633123 CGGGCTGCTGGGAGACCCTGTGG - Intronic
1185289768 22:50017458-50017480 GGGCCTGATGGGACCCACCGGGG + Intronic
1185339311 22:50284465-50284487 GGGGCAGCAGGGAGACCCCAGGG - Intronic
950121384 3:10484428-10484450 GGGGGTACGGGGAGACACTGAGG - Intronic
950530078 3:13548298-13548320 TGGGCTGCAGGGAGACCCCTGGG + Intergenic
952828327 3:37542492-37542514 TGTGCTGCTGGGAGAGACCATGG + Exonic
953854276 3:46488999-46489021 CAGGCTGCTCGGAGACTCCGAGG - Intergenic
953984520 3:47431104-47431126 GAAGCTGCTGGGAGGCACAGAGG + Intronic
954689463 3:52388072-52388094 GGGCCTGCTGAGGGACACCCTGG - Intronic
955356741 3:58237992-58238014 GCCGCTGCAGGGAGACACTGGGG - Intronic
958718800 3:97820940-97820962 AGGGCTTCTGGGAGGCAGCGTGG + Intergenic
960595526 3:119404446-119404468 GGGGCTGCTGAGAGGCTCAGGGG + Intronic
961319207 3:126061358-126061380 GAGGCTGCTTGGAGACAGTGTGG - Intronic
961330189 3:126133870-126133892 GGAGCTCCTGGGAAAGACCGTGG - Intronic
961462223 3:127058266-127058288 TGGGCTGGTGGGTGACCCCGTGG + Intergenic
961464262 3:127071927-127071949 GGGGCTGCTCAGGGACTCCGGGG - Intergenic
961567745 3:127775837-127775859 GGCGCTGCTGCGAGAGACGGTGG - Intronic
962753472 3:138451304-138451326 GGGGCTTCTGGGAGCCAAGGTGG + Intronic
963939916 3:151087163-151087185 GGGGGTGCTGGGCGACCCCCCGG + Intronic
965816781 3:172644296-172644318 GGGGCTGCTCAGAGTCACTGAGG - Intronic
967751855 3:193124298-193124320 GGGGCAGTTGGGAGACACTTTGG + Intergenic
967919567 3:194604320-194604342 GGAGCTGCCGGAAGACACCCGGG + Exonic
967970240 3:194994148-194994170 GGGGCAGCTGGGAGGCAGCGAGG - Intergenic
968085686 3:195872947-195872969 GGGGGTGCCGGGGGACACCTAGG + Intronic
968130279 3:196189081-196189103 TGGGCTGCTGGGAGGGCCCGAGG + Intergenic
968478995 4:825761-825783 GGGGCTGCGGGGAGAAGCCGGGG + Intronic
968569997 4:1334286-1334308 GGGGCTGCCGGGAAACACCCCGG - Intronic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
969556455 4:7914664-7914686 GGGGCTGCTGGATCACACTGTGG + Intronic
969659671 4:8519093-8519115 AGGGGTGCGGGGAGACACAGAGG + Intergenic
971013556 4:22464788-22464810 GGGACTGCTGGGAGCCAGCAAGG - Intronic
971229858 4:24792484-24792506 GGGGCTTCTGGGAGAACCCTGGG + Intronic
972615139 4:40690944-40690966 AGGGCAGCTGGGAGCCACTGGGG - Intergenic
972630187 4:40835750-40835772 GGGACTGCTGGGGGCCACTGCGG + Intronic
972960480 4:44447528-44447550 AGGGGTGCTGGGAAACGCCGGGG + Intronic
975549478 4:75596513-75596535 GGGGCTGCTGGGAGGCATGAGGG - Intronic
976236258 4:82900596-82900618 TTGGCTGCTGGGACACAACGTGG + Intronic
979258826 4:118630985-118631007 TAGGCTGCTGGGAGACACGCAGG - Intergenic
979329523 4:119409572-119409594 TAGGCTGCTGGGAGACACGCAGG + Intergenic
984019571 4:174468610-174468632 GAGGCTGCAGGGAGGCACCCAGG + Intergenic
984462784 4:180058399-180058421 GGGGCTGTGGGGAGCCCCCGGGG + Intergenic
984710431 4:182879912-182879934 GGGGGTGCTGGTAGACAGGGTGG + Intergenic
985513043 5:322598-322620 GGGGCGGCTGTGAGGCCCCGTGG - Intronic
985631758 5:1017674-1017696 GGGGCTGCAGGGCGGCCCCGTGG - Intronic
985838762 5:2290099-2290121 GGTGCTGCTGACACACACCGAGG + Intergenic
986233968 5:5890667-5890689 GGGGGCTCTGGGAGACCCCGTGG - Intergenic
986575481 5:9208513-9208535 AGGGCAGCTGGGAGAAACAGAGG + Intronic
988993455 5:36693027-36693049 GGGGCCGCTGGGAGAGCCCGCGG - Intergenic
990936231 5:61152873-61152895 AGTGCTGCTGGGAGCCACTGAGG - Exonic
991674101 5:69075169-69075191 GCGGGTGCTGGAAGGCACCGCGG - Intergenic
992265926 5:75018237-75018259 GTGCCTGCTGTGAGTCACCGGGG + Intergenic
994118592 5:96088887-96088909 GGGGTTGCTGGGATACCCAGGGG + Intergenic
995935355 5:117504888-117504910 GGGGTTGCAGGGAAACACAGAGG - Intergenic
997197014 5:131987140-131987162 GAGGCTCCTGGGAGACAGGGAGG + Intronic
998137666 5:139682664-139682686 TGGGCTGCTGGAAGGCCCCGAGG - Intronic
999370091 5:151049634-151049656 GAGGCTGCTGGTAGTCACTGTGG - Intronic
1001309557 5:170601235-170601257 GGGACGGCTGGGAGTCACAGCGG + Intronic
1001759471 5:174195303-174195325 GAGGATCCTGGGAGACACCAGGG - Intronic
1002195088 5:177497089-177497111 GAGGCTGCTGGGAGCCAGGGCGG + Intronic
1002401750 5:178994957-178994979 CGGGCTGCGGGGAGACAGAGGGG + Exonic
1002827194 6:784589-784611 GGGGTTGTTGGGTGACACCTTGG - Intergenic
1003256844 6:4482553-4482575 GATGCTGCTGGGAGGCGCCGGGG + Intergenic
1003338137 6:5194345-5194367 GGGGATGCTGGGAGGGACTGTGG - Intronic
1003551902 6:7107991-7108013 TGGGCTTCAGGGAGAGACCGAGG - Exonic
1003869363 6:10390081-10390103 AGGGCTGATGGGAGCCAGCGAGG + Intergenic
1004322014 6:14639258-14639280 GGGGCTGCTCTGTGACACCCGGG + Intergenic
1006445277 6:34076529-34076551 GGGGCTGCTGGCCCACACCGGGG + Intronic
1006601920 6:35231912-35231934 GGGGCTGCTGAGGGACAGCTGGG - Intronic
1006706335 6:36024477-36024499 GCCGCTGCTGGGAGACGCCTGGG - Intronic
1006988928 6:38196516-38196538 GGTGCTGATGGGAGTCACCTTGG - Intronic
1007169083 6:39849898-39849920 CGTGCTGCTGGGAGTCACCCAGG - Intronic
1007809149 6:44474168-44474190 AGGGCTGGTGGCAGACCCCGTGG + Intergenic
1007809166 6:44474222-44474244 AGGGCTGGTGGCAGACCCCGGGG + Intergenic
1007809176 6:44474249-44474271 AGGGCTGGTGGCAGACCCCGGGG + Intergenic
1007809184 6:44474276-44474298 AGGGCTGGTGGCAGACCCCGTGG + Intergenic
1007809199 6:44474330-44474352 AGGGCTGGTGGCAGACCCCGGGG + Intergenic
1008766228 6:54918838-54918860 GGGGATGCTGGAAGACAGAGAGG - Intronic
1008943762 6:57074648-57074670 CGGGCTGCTCATAGACACCGAGG - Intergenic
1011326324 6:86152594-86152616 GGGGCAGCTGGGGGAGACCTAGG - Intergenic
1017564151 6:155666301-155666323 AGAGCTGCAGGGAGACCCCGAGG + Intergenic
1018750511 6:166800267-166800289 GGGGCTGAGGGCAGACACAGTGG - Intronic
1018817349 6:167343404-167343426 GGGCCTGCTGGGAGACTCGCTGG - Intronic
1018861499 6:167713450-167713472 GAGGCTGGTGGAAGACACCTGGG + Intergenic
1018978197 6:168581772-168581794 GGGGCTGCAGGGAGGCAGCGGGG - Intronic
1019348405 7:541668-541690 GGGGCCGCTGAGAGGCACCTGGG + Intergenic
1019480563 7:1264810-1264832 GGGGCTGCTGGGAGAGTTCCAGG - Intergenic
1019556285 7:1633187-1633209 GTGGCTGCTGGGAGACCCAGGGG + Intergenic
1023849088 7:44140463-44140485 GGGCCTTCTGGGGGACACCCAGG - Intronic
1024260934 7:47573363-47573385 CGGGCTGGTGGGAGGCAGCGTGG - Intronic
1026671248 7:72392457-72392479 GGTGCTGATGGGAGAGACTGAGG + Intronic
1026817200 7:73522145-73522167 GGGGCTGCTGGGAGGCGCGGCGG - Exonic
1029019129 7:97345842-97345864 GGGGCTGCTGGGAAACAATAAGG + Intergenic
1029894299 7:103966248-103966270 TGAGCTGCTGGGAGACACTCTGG - Intronic
1029964559 7:104725689-104725711 GTGACTGCTGGGAGATACAGAGG + Intronic
1030261347 7:107567795-107567817 GGGGCTGCTGTGAGGAACAGTGG - Intronic
1032207026 7:129874966-129874988 GAGGCTGCTGGGAAACACGTGGG + Intronic
1033607259 7:142936454-142936476 GGGACTGCCGGGGGACACCATGG - Intergenic
1034266605 7:149784022-149784044 GGGGCTGCTGTGGGACCCTGAGG + Intergenic
1034702799 7:153111019-153111041 GGAGCTGCTGGGAGACACACTGG + Intergenic
1035677745 8:1467245-1467267 GGGGCTGGGGGGAGGGACCGTGG - Intergenic
1035736157 8:1888962-1888984 GGGTCTGCGAGGAGACACTGAGG + Intronic
1036288118 8:7462524-7462546 GGGGAAGCTGTGAGACCCCGTGG + Intronic
1036333357 8:7849004-7849026 GGGGAAGCTGTGAGACCCCGTGG - Intronic
1036391557 8:8328345-8328367 GGGGCTGCTGGGGGCCACTGGGG + Exonic
1036632641 8:10526039-10526061 GGTGCTGATGGGAGCCACAGAGG - Intronic
1038315636 8:26482321-26482343 TGGGCTCCTGGGAGAAACAGAGG - Intronic
1038556999 8:28528097-28528119 GGGGCATCTGGGAAACAACGTGG + Exonic
1038727701 8:30095726-30095748 GGGGCTGCGGGGCGAAGCCGGGG - Intronic
1040311250 8:46237971-46237993 GGGGCTTCTGGGAGAGACACAGG - Intergenic
1040334789 8:46410565-46410587 GGGCCTTCTGGGAGAGACAGAGG - Intergenic
1043979136 8:86618019-86618041 GGGGGTGATGGGAGACAGTGAGG + Intronic
1047647317 8:126882420-126882442 GGAGCTGCTGGTGGACACTGGGG - Intergenic
1049206210 8:141364833-141364855 GGGGCTGGTGGGTGACACGCAGG - Intronic
1049300806 8:141868448-141868470 GGCACTGCTGGGAGGCACCAGGG - Intergenic
1049447587 8:142638483-142638505 GGGGGTGCCGGGAGAGAACGTGG + Intergenic
1049532256 8:143160377-143160399 GGGGCGGCTGGGAGACGCGCGGG + Intronic
1049580566 8:143408759-143408781 GTGGCTGCTTGGAGAGGCCGGGG + Intergenic
1049635241 8:143684643-143684665 GCGGCTGCTGGGACAGACCGGGG + Intronic
1049867838 8:144950545-144950567 GGGTCTCCGGGGAGACCCCGGGG - Intronic
1050094340 9:2047636-2047658 GGTGCTGAGGGGAGGCACCGGGG + Intronic
1052781206 9:32783373-32783395 GGGGCTGCTGGGAGCGGCCGGGG - Intergenic
1053480943 9:38415810-38415832 TGGGCTGCTGGGACACCCAGGGG - Intronic
1055723433 9:79201025-79201047 GCTGCTGCAGGGAGACACAGGGG - Intergenic
1056967802 9:91179136-91179158 GGGGCTGCAGGGAGTCATCAGGG + Intergenic
1057308073 9:93924116-93924138 GGGCCTGCTGGGACAGACCTGGG - Intergenic
1057806170 9:98221267-98221289 GGGCCTGCTGGGCGCCACAGTGG + Intronic
1057857021 9:98609700-98609722 GGGGCTGCTGGGAGTGGCCTGGG + Intronic
1057885741 9:98828223-98828245 GGGGCAGCTGGGTCACACCCAGG - Intronic
1058058613 9:100473441-100473463 GCGGCTGCTAGGAGGCACCGAGG + Exonic
1061328282 9:129877175-129877197 GGGCCTGGTGAGAGACACTGAGG + Intronic
1061481867 9:130901480-130901502 GGGGATGCTGGGAGAGCCCTGGG - Intergenic
1061868491 9:133507528-133507550 GGCGCTGCTGGGAGACCCGAAGG - Intergenic
1061997195 9:134192566-134192588 TGGGCTGGTGGGGGACACAGCGG + Intergenic
1062074195 9:134575605-134575627 GAGGCTGCAGGGAGGCACCCAGG - Intergenic
1062131486 9:134896436-134896458 GGGTCTGCTGGGAGCTACAGAGG - Intergenic
1062190117 9:135243667-135243689 TGGGCTGCTAGGAGACAGGGTGG - Intergenic
1062402506 9:136378684-136378706 GGGGCTGCGGGGAGAAAGGGTGG + Exonic
1062454456 9:136629111-136629133 GGGGCTGCTGGGGGCCAAGGAGG - Intergenic
1062520363 9:136955156-136955178 GGGGCTGTTGGGAGCCGCTGTGG + Intronic
1186482189 X:9904499-9904521 GGGGCTGCTGGGAAACAAAGGGG - Intronic
1190320327 X:49176170-49176192 GGGGCGGCTCGGGGACACTGCGG + Exonic
1192496045 X:71617252-71617274 GGGGCTGCTGGGCAACGGCGCGG - Exonic
1192601193 X:72466127-72466149 GCTGCTGCTGGGAGATACAGAGG + Intronic
1197975941 X:132166060-132166082 GGGGCTGCTGACAGCCACCTTGG - Intergenic
1199213571 X:145242298-145242320 GGGGCTGGTGGTAGACAGCTTGG + Intergenic
1199760391 X:150899811-150899833 GGGGTTGGTGGGAGCCACTGAGG - Intergenic
1200063199 X:153492715-153492737 GGGGGTGTGGGGAGACACAGGGG - Intronic
1200076816 X:153555274-153555296 AGGGCAGCCGGGAGACACCAGGG - Intronic
1200115023 X:153766143-153766165 GGGGGTGCTGGGAGAAGCCAGGG - Exonic
1200214276 X:154360548-154360570 GGGGCTGCAGGGAGGCAGTGCGG - Exonic
1201793966 Y:17874671-17874693 AGGGATGCTGGGAGACACATTGG - Intergenic
1201807588 Y:18031314-18031336 AGGGATGCTGGGAGACACATTGG + Intergenic