ID: 948868065

View in Genome Browser
Species Human (GRCh38)
Location 2:240785288-240785310
Sequence GGGGCTGAGGACGCCACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 203}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948868065_948868072 -1 Left 948868065 2:240785288-240785310 CCCACAGTGGCGTCCTCAGCCCC 0: 1
1: 0
2: 0
3: 16
4: 203
Right 948868072 2:240785310-240785332 CAGCCCTTGCTGGTATATTCAGG 0: 1
1: 0
2: 0
3: 10
4: 107
948868065_948868073 0 Left 948868065 2:240785288-240785310 CCCACAGTGGCGTCCTCAGCCCC 0: 1
1: 0
2: 0
3: 16
4: 203
Right 948868073 2:240785311-240785333 AGCCCTTGCTGGTATATTCAGGG 0: 1
1: 0
2: 0
3: 4
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948868065 Original CRISPR GGGGCTGAGGACGCCACTGT GGG (reversed) Intronic
900173702 1:1282573-1282595 GGGGCTGAAGACGCCAGCCTGGG + Intronic
900528757 1:3142420-3142442 GCAGCTGAGGACCACACTGTCGG - Intronic
901332775 1:8423750-8423772 GGGGCTGGGGCCGCCGCTGACGG + Intronic
902551630 1:17223027-17223049 GGGGCTCAGGAGCCCACTGTGGG + Intronic
902955481 1:19922075-19922097 GGGGCTGAGGGCTGCACTGATGG + Intronic
903390489 1:22960230-22960252 TGGGCTGGGGCCCCCACTGTTGG + Intronic
904299380 1:29544191-29544213 GGGGCTGAGTAAGCCACTTGGGG + Intergenic
905762972 1:40575998-40576020 GGGGCTGTGAACGCCAATGAAGG + Intergenic
912512639 1:110199269-110199291 GAGGCAGAGGCCACCACTGTGGG - Exonic
913436068 1:118849103-118849125 GGGCCTGAGGACTCTACTGCTGG - Intergenic
915282101 1:154829699-154829721 GGGGCTGAGGAGGGCACAGGAGG - Intronic
919748996 1:201024903-201024925 GGGTCTGAGGATGCATCTGTTGG + Intergenic
1063348858 10:5336221-5336243 GGGTCTGAGAACCCCAGTGTGGG - Intergenic
1063371384 10:5525044-5525066 GTGGCAGAAGAGGCCACTGTGGG - Exonic
1063716798 10:8535624-8535646 GGGGCTGAGGAACCACCTGTTGG - Intergenic
1067210904 10:44259827-44259849 GGGGCTGATGAGGTCACTGTGGG - Intergenic
1068212598 10:53940508-53940530 GGGGCGGACGAAGCTACTGTAGG + Intronic
1069915675 10:71785218-71785240 TGGGATGAGGACACCTCTGTGGG + Intronic
1070813099 10:79308087-79308109 GTGGCTGAGGACGTCCCTGGTGG + Intronic
1074765977 10:116700389-116700411 GGAGCTGAGGACACCACTCAGGG + Intronic
1075525109 10:123177569-123177591 GGGGCTGGGGAAGCCACTTCTGG + Intergenic
1076674314 10:132140350-132140372 GGGGCTGCGGCCCCCACCGTTGG + Intronic
1076717626 10:132374447-132374469 GAGGCTGAGGAGGGCACTGCGGG - Intronic
1077390137 11:2297032-2297054 GAGGCTGAGGACCCCAGGGTGGG - Intronic
1078452792 11:11452890-11452912 GGGGCTGAGGACTCCCCAGGAGG + Intronic
1080204467 11:29712939-29712961 GCGGCTCAGGAGCCCACTGTGGG - Intergenic
1080426430 11:32158852-32158874 GAGGCTGAGGACACCATTTTGGG + Intergenic
1081462436 11:43284263-43284285 GTGGCTCAGGACTCCACTGAAGG - Intergenic
1081685154 11:45037126-45037148 GGGGCTTTGGACCCCACAGTAGG + Intergenic
1083718252 11:64591436-64591458 TGGGCTGGAGAAGCCACTGTGGG + Exonic
1084269661 11:68022210-68022232 GGGGCTCAGGACGGGACTCTCGG - Intronic
1085401581 11:76238933-76238955 GGGGCTGAGGACAGCGCTCTAGG + Intergenic
1087634819 11:100690068-100690090 GGGGCTGACCATTCCACTGTGGG + Intronic
1088846569 11:113673340-113673362 GGGGCCGAGGAAGCCCCTGAAGG - Intergenic
1089560424 11:119340648-119340670 GGGGCTGGGGAGGGGACTGTGGG - Intronic
1090003218 11:122979540-122979562 GGGGCGGAGGAAGGCACTGGGGG - Intronic
1092119422 12:6033699-6033721 GGGACTGAGGAGGCTGCTGTTGG + Intronic
1093711255 12:22332939-22332961 GGGGCTGAAGATGCTGCTGTTGG - Intronic
1096744069 12:53714138-53714160 GAGGATGAGGAGGCCGCTGTGGG - Exonic
1098925841 12:76348675-76348697 GGGGCAGCGGACGCCACTGGAGG - Intergenic
1100308205 12:93370771-93370793 GGGGCTGAGCCCTCAACTGTGGG - Intergenic
1100982144 12:100170389-100170411 GGGGCTGAGTCCGCTTCTGTGGG - Intergenic
1101651520 12:106681669-106681691 GGTGCTGTGGAAGCCACTGGAGG + Intronic
1104258081 12:127157386-127157408 GGGGCAGAGGATGGTACTGTGGG - Intergenic
1106127737 13:26914135-26914157 GGGGCAGAAGAGGCCTCTGTGGG - Intergenic
1112559630 13:100501524-100501546 TGGTCTGAGGACCACACTGTGGG - Intronic
1113508351 13:110832099-110832121 GAGGCTGAGGACTCCTCAGTGGG - Intergenic
1114159222 14:20144337-20144359 GAGGCTGAGCAGGCCACTGTTGG - Exonic
1114325707 14:21586871-21586893 GAGGATGAGGAGGCCACAGTGGG - Intergenic
1115160063 14:30383743-30383765 GGGGCTGGGGACAGCAGTGTAGG + Intergenic
1115555792 14:34544198-34544220 GGGGCTGAGGCTGCCATTGTGGG + Intergenic
1115558116 14:34558889-34558911 GGGGCTGAGGCTGCCATTGTGGG - Intergenic
1116122671 14:40740882-40740904 CGGACTGAGGACTGCACTGTTGG - Intergenic
1119484171 14:74977571-74977593 GGGAGTGAGGAAGCCACTTTGGG - Intergenic
1121226372 14:92324179-92324201 GGGGCTCAGGACGCGGCTGCAGG + Intronic
1121439412 14:93939393-93939415 GGGGCTGATGACGTCGCGGTTGG + Exonic
1122940862 14:104980807-104980829 GGGGCTGAGGACACAAAGGTGGG - Intergenic
1124469204 15:29968545-29968567 GGGGGCGAGGCCGCGACTGTCGG - Intronic
1124972978 15:34508211-34508233 GTGTCTGAGGGCCCCACTGTGGG - Intergenic
1128886792 15:71295351-71295373 GGGGCTCAGGAAGCAGCTGTAGG - Intronic
1129484114 15:75852390-75852412 GGGTCTGAGGTCCCCACTTTGGG + Intronic
1131159311 15:90094176-90094198 GGGGCAGGGGACGCTACTGAAGG + Intronic
1132520257 16:383984-384006 GGGGCTGAGGACGGCCCAGCTGG - Intronic
1132652789 16:1029095-1029117 GGGGCTGGGGGCTCCACTCTGGG - Intergenic
1133048931 16:3105833-3105855 GGGGCTGAGGACACTCCTGCGGG + Intergenic
1133202888 16:4215249-4215271 GGGGCTGAGGCAGCCATTCTTGG + Intronic
1134803474 16:17106306-17106328 GGGGCTGCCGAAGCCACTTTGGG - Exonic
1135142118 16:19930847-19930869 GGAGCTGAGGTCGTGACTGTGGG - Intergenic
1136666698 16:31819280-31819302 GAGCCTGAGGACGCCGCTGGGGG - Intergenic
1137060691 16:35789825-35789847 TGGGCTGTGGCCTCCACTGTGGG - Intergenic
1137483174 16:48869430-48869452 CGGGGTGAGGAGGCCAGTGTGGG - Intergenic
1138026122 16:53523695-53523717 GGGACTGTGGCCGCCACTGCAGG - Intergenic
1139938956 16:70591028-70591050 GGGTCTCAGGACAGCACTGTGGG + Intronic
1141513436 16:84527123-84527145 GAGGCTGTGGCCTCCACTGTGGG - Intronic
1141664859 16:85460805-85460827 GGAGCTGAGGAAGCCAGGGTGGG + Intergenic
1142306850 16:89290548-89290570 GAGGCTCAGGACTCCACTGGGGG + Intronic
1142878065 17:2864264-2864286 GGTGCTGAGGACGCAGCAGTGGG + Intronic
1146582247 17:34049178-34049200 GGTGCTGAGGAGGCTAATGTGGG + Intronic
1146601750 17:34223263-34223285 AGGGGTGAGGACATCACTGTTGG - Intergenic
1147357554 17:39909714-39909736 GGGACTGTGGAGGCCAGTGTTGG - Intronic
1147602686 17:41755777-41755799 GGGCCTGAGGCCGTCGCTGTAGG + Exonic
1147982182 17:44281439-44281461 GGGGGTGAGGATGGCATTGTGGG + Intergenic
1148108439 17:45131771-45131793 GTGGCTGTGGCCGCCTCTGTGGG + Intronic
1151428657 17:74047996-74048018 GAGGCTGAAGACGCCACATTTGG + Intergenic
1152308759 17:79536526-79536548 GGGGCTGATGCCACCACAGTGGG - Intergenic
1153444386 18:5155292-5155314 GGGGCTGAAAACTCCACTCTGGG + Intronic
1154297850 18:13165823-13165845 GGGGATGGGGGCGCCACAGTGGG + Intergenic
1160270213 18:77376891-77376913 GGGACTGAGGAGGCCGCTGCAGG - Intergenic
1160537648 18:79603662-79603684 GGGGCGGAGGGCGGCACTGCAGG - Intergenic
1160712565 19:559232-559254 GGGGCTGAGGGCTTCACTCTGGG - Intergenic
1160745639 19:709655-709677 GGGGCTCAGGACACCCCTGGAGG - Intronic
1160970204 19:1764578-1764600 GGGGCTGGGGAGGCCTCTGGGGG + Intronic
1162700811 19:12513516-12513538 GGGGCTGCGGTCGCCACGGACGG + Intronic
1164324171 19:24178064-24178086 GGGGCAGAGGAAACCACAGTAGG + Intergenic
1165451801 19:35888144-35888166 GAGGGTGAGGAGGCCATTGTAGG + Intronic
1166072412 19:40394907-40394929 GGGGCTGAGGATGCCTCCGCTGG - Exonic
1167693356 19:51000632-51000654 AGGGCTGGGAAGGCCACTGTGGG + Exonic
1168154091 19:54463611-54463633 CGGGCCGCTGACGCCACTGTCGG - Exonic
925144564 2:1572161-1572183 GGGCCTGTGGTGGCCACTGTGGG + Intergenic
926164075 2:10507263-10507285 GGGGCTGAGGCCGGCACCATTGG + Intergenic
926328495 2:11805651-11805673 GGGGCTGAGGGTCCCACGGTGGG - Intronic
929072371 2:38046007-38046029 GGGAATGAGGTCGCCATTGTAGG + Intronic
934658752 2:96132063-96132085 CGGGCTGAGGGCAGCACTGTGGG - Intronic
934720681 2:96573738-96573760 GGCTCTGAGTACACCACTGTGGG + Intergenic
935145354 2:100391699-100391721 AGGGCCGAGGACGCCACACTGGG - Intergenic
936081085 2:109432806-109432828 GGGCCTGGGGACGCCAGTGGGGG - Intronic
936987241 2:118323209-118323231 GAGGTTGAGGAGGCCACTCTAGG - Intergenic
939817618 2:146915611-146915633 GGGGCTGAGGTTACCACTATGGG - Intergenic
939892859 2:147758052-147758074 GGGGCTGTGTAGGCCAATGTGGG - Intergenic
940883648 2:158969791-158969813 GGGGCGGAGGACGCCAGGCTCGG + Intronic
942639910 2:178050050-178050072 GGGGGTCAGGAAGCCACTTTAGG - Intronic
946346886 2:219118189-219118211 GAGGCTGAAGAAGCCAATGTGGG - Intronic
946970573 2:225086593-225086615 GGAGCTGAGGACGCTACTCTGGG + Intergenic
948207210 2:236168536-236168558 CGGGCTGCGGGCGCCACCGTCGG + Intergenic
948628169 2:239283479-239283501 GGGGCCTGGGACGCCACTGCCGG + Intronic
948847186 2:240688658-240688680 GGGGCTCAGCACAGCACTGTGGG + Intergenic
948867520 2:240783299-240783321 GGGGCTGAGGGCAACACTGGGGG - Intronic
948868065 2:240785288-240785310 GGGGCTGAGGACGCCACTGTGGG - Intronic
949048088 2:241881457-241881479 GGTGCGGAGGAGGCCGCTGTAGG + Intergenic
1172167639 20:32908645-32908667 GAGGCTGAGGACGCCTGAGTGGG - Intronic
1173004621 20:39130336-39130358 GGGGCTGAAGAGGACACTGAGGG + Intergenic
1173831295 20:46090150-46090172 GGGGCTGAGGCGACCACCGTGGG - Intergenic
1174584683 20:51598959-51598981 GGGGCTGAAGAAGCCATAGTTGG - Exonic
1175700074 20:61130572-61130594 GGGGCTGAAGAATCCACTGTGGG - Intergenic
1176020831 20:62961609-62961631 GGGGCGGAGGCGGCCCCTGTAGG + Intronic
1176382564 21:6120601-6120623 GGGGCTCAGGCCGCCCCTGCTGG - Exonic
1179740905 21:43417638-43417660 GGGGCTCAGGCCGCCCCTGCTGG + Exonic
1180071452 21:45438696-45438718 GAGGCTCAGGACGCCTCTGCAGG + Intronic
1181322692 22:22020575-22020597 GGGTCAGAGGAAGCCACTCTAGG + Intergenic
1181884030 22:26004831-26004853 GGGGCTGAGGATGCGGCTGCTGG - Exonic
1182279566 22:29209889-29209911 TGGGCTGCGGACTCCACAGTGGG + Intronic
1182682912 22:32096413-32096435 GGGGCTGAGGAGGACAGTGTGGG - Intronic
1183328635 22:37207660-37207682 GGGGATCAGAACGCCACTGACGG + Exonic
1184121241 22:42451850-42451872 TGGGCTGAAGGGGCCACTGTTGG + Intergenic
950447322 3:13045778-13045800 GAGGCTGAGGAGGCTCCTGTAGG - Intronic
954183240 3:48898156-48898178 GAGGCTGAGCAGGCCACCGTTGG + Intronic
961310034 3:125990710-125990732 GGACCTGAGGAGTCCACTGTGGG + Intergenic
961346082 3:126264206-126264228 GAGGCAGAGGAGGCCACTGTGGG + Intergenic
961360076 3:126361413-126361435 GGGGCTATGGACGCCACCCTGGG + Intergenic
965833800 3:172828941-172828963 GGTGCTGAGGCAGCCACAGTTGG - Intergenic
968581862 4:1398985-1399007 GGGGCTGAGGAGGCCACGCCAGG + Intergenic
968662356 4:1804014-1804036 GGGGCTGAGGGGGCCCCTCTGGG - Intronic
968829601 4:2926124-2926146 GTGGCAGCGGCCGCCACTGTGGG + Intronic
968916534 4:3499279-3499301 GGGGGTGGGGAGGTCACTGTGGG + Intronic
969188992 4:5501880-5501902 GGGACTGGGCACGCCACTGGAGG - Intergenic
969466725 4:7361699-7361721 AGGGCTGGGGACCCCACTGCAGG + Intronic
976629357 4:87220639-87220661 GGGGCTGCGCACGGCACTCTGGG + Intronic
980988614 4:139718948-139718970 GGGGCTGAGGATACCTCTCTTGG + Exonic
984973395 4:185209843-185209865 GGGGCCGGCGCCGCCACTGTCGG - Intronic
985065557 4:186117545-186117567 GGGGCTTGGGAGGGCACTGTCGG + Intronic
986218929 5:5749425-5749447 TGGGCTGAGGTAGACACTGTAGG + Intergenic
986330330 5:6712944-6712966 GGGGCAGCGGACGCCACCGCAGG - Intergenic
996510207 5:124308094-124308116 GGGTCTGAGAAGGCCACTGCAGG + Intergenic
996528356 5:124501363-124501385 GGGTCTGAGAAGGCCACTGCAGG + Intergenic
996745088 5:126840739-126840761 GGGTCTGAGAAGGCCACTGCAGG - Intergenic
997289853 5:132721798-132721820 GGCACTGAGGCGGCCACTGTAGG + Intronic
997718746 5:136061709-136061731 GGGGCTGAGGATGCCTCAGTGGG - Intronic
998717054 5:144896363-144896385 GAGGCTAAGGAGGACACTGTGGG + Intergenic
999744349 5:154580416-154580438 GGGCCAGAGGACGCCACAGTTGG - Intergenic
1000396318 5:160778309-160778331 GGAGCTGTGGTCTCCACTGTGGG - Intronic
1002582422 5:180216785-180216807 AGGGCTCAGGACGCCCCTGTAGG + Intergenic
1003425261 6:5994739-5994761 GCGGCTGAGGACGCCAGCTTAGG - Intergenic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1006535440 6:34696004-34696026 GGGGCTGAGGATGCCAGGATTGG - Intronic
1007096154 6:39214488-39214510 GGGGCAGAGGAGGGCTCTGTTGG + Intronic
1007133572 6:39499464-39499486 GGGGCTGTGTATCCCACTGTAGG + Intronic
1007357427 6:41331827-41331849 GGGGCTGGGGACAGCAATGTGGG + Intergenic
1007431581 6:41780136-41780158 GGGGCTGAGGACACCAAAGTTGG + Intronic
1007628418 6:43259481-43259503 GGGGCTGATGAGGCGGCTGTGGG - Intronic
1007833422 6:44656020-44656042 GGGGCTGAGGTGGCCTCTGCCGG - Intergenic
1008590234 6:52986762-52986784 GGGCCTGAGGACCCTGCTGTTGG + Intronic
1012257549 6:97051086-97051108 TGTGCTGAGGAACCCACTGTGGG + Intronic
1014931713 6:127343742-127343764 GGAGGTGAGGAAGCCAGTGTAGG + Intergenic
1016351934 6:143177865-143177887 GGGGCTGGGGTCGCCAGTGGTGG + Intronic
1018034634 6:159871681-159871703 GTGATTGAGGAGGCCACTGTAGG + Intergenic
1018379013 6:163240732-163240754 GAGGGTGAGGACGGCACAGTCGG - Intronic
1019344205 7:521589-521611 GGGCCCGAGGACACCTCTGTGGG + Intergenic
1023014669 7:35955324-35955346 TGGGCTGAGGATCCCACCGTGGG + Intergenic
1023041370 7:36175909-36175931 GGGGCTGAGCAGGTCACTGCCGG + Intronic
1024066328 7:45739696-45739718 TGGGCTGAGGATCCCACTGTGGG - Intergenic
1024996908 7:55279194-55279216 CGGGCTGCTGACACCACTGTGGG - Intergenic
1025007413 7:55365498-55365520 GGGGCTGAGCTCGCCCCGGTCGG + Exonic
1026091173 7:67302240-67302262 GGCGCTGAGGACGCCGCTCCGGG + Intergenic
1027266334 7:76497024-76497046 AGGGCGGAGGACGCCACTCCAGG - Intronic
1027317714 7:76995142-76995164 AGGGCGGAGGACGCCACTCCAGG - Intergenic
1029280938 7:99435113-99435135 GGGGCTGATGCGGCCAATGTGGG - Exonic
1029507827 7:100973121-100973143 AGGGCTGGGGATGCCTCTGTAGG + Intronic
1034150404 7:148910645-148910667 GGGCCTGAGGAGGCCCCTGGAGG - Intergenic
1034882940 7:154776167-154776189 GGGGCTTCTGAGGCCACTGTAGG - Intronic
1035307444 7:157942312-157942334 AAGGCTGAGGACCCCACCGTGGG - Intronic
1035371067 7:158379227-158379249 GGGGCTGCGGACCCCAGGGTGGG + Intronic
1039902180 8:41760846-41760868 GGTGGAGAGGAAGCCACTGTGGG - Intronic
1040593908 8:48819718-48819740 GGGGCTGGGGAAGCCCCTGAGGG - Intergenic
1041699652 8:60774114-60774136 CTGGCTGAGGATACCACTGTTGG + Intronic
1042227447 8:66525097-66525119 TGGGCTGGGGATGCCGCTGTTGG - Intergenic
1042916121 8:73878095-73878117 GGGGCTGAGGACTCGGCTCTCGG + Intronic
1046645774 8:116783827-116783849 GAGGCTAAGGGCGCCACTGGAGG - Intronic
1047497587 8:125419555-125419577 GGGGGTGAGGAAGCCACCCTAGG - Intergenic
1049230046 8:141477248-141477270 GGGTCTGAGGACCCAGCTGTGGG - Intergenic
1049406176 8:142452746-142452768 GGGGCGGAGGACGCCGCAGGAGG - Intronic
1049853950 8:144850001-144850023 GGGGCTCAGGCGGCCAGTGTGGG - Intronic
1051193066 9:14534743-14534765 GGGGCTGAGCACTCCTCCGTCGG + Intergenic
1051367271 9:16329976-16329998 GGGGCTGGGGATGCCTCTGGGGG - Intergenic
1056292681 9:85159657-85159679 GGGGCTCTGGACGCTACTTTGGG + Intergenic
1056552019 9:87660020-87660042 GGGGCTGGGGGCGCCCCTGCGGG + Intronic
1057171133 9:92963888-92963910 GGGTCTGAGGAAGCCTCTGATGG + Intronic
1057857262 9:98611149-98611171 GGGGCTGAGGAGCCCATTGTTGG - Intronic
1059364000 9:113771172-113771194 GGGCATGAGGTCGCCAGTGTGGG + Intergenic
1060302181 9:122381250-122381272 GGTCCTGAGGAGGCCACTCTGGG + Intronic
1060426872 9:123513539-123513561 GGGTCTGAGGACGCCAGAGCGGG + Intronic
1061801664 9:133116290-133116312 CGGTCTGAGGCCGCCTCTGTGGG - Intronic
1062041199 9:134405084-134405106 GGGGCTGTGGAGCCCACTGGGGG + Intronic
1062189437 9:135240224-135240246 GGGGCTGAGAAGGCCACTTAAGG - Intergenic
1062452556 9:136621683-136621705 GGGGCTCAGGACGCCTCTCCAGG + Intergenic
1062554077 9:137106204-137106226 GTGGGTGAAGAGGCCACTGTGGG - Exonic
1186890430 X:13954202-13954224 GGGAATGAGCACTCCACTGTGGG - Intergenic
1194035320 X:88863910-88863932 GGGGCTGCGTGCACCACTGTTGG + Intergenic
1194214441 X:91110959-91110981 GGGCTTGAGGCAGCCACTGTGGG + Intergenic
1199415996 X:147583886-147583908 GGGGCTGCCCATGCCACTGTTGG - Intergenic
1200117088 X:153774130-153774152 GGTGCTCAGGCCGCCTCTGTGGG + Intronic