ID: 948868653

View in Genome Browser
Species Human (GRCh38)
Location 2:240787510-240787532
Sequence TCAGGGGTCCCTGGCTGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 347}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948868644_948868653 4 Left 948868644 2:240787483-240787505 CCAAGGAGCCAGTGTCTCCCTCT 0: 1
1: 0
2: 1
3: 32
4: 369
Right 948868653 2:240787510-240787532 TCAGGGGTCCCTGGCTGGTGTGG 0: 1
1: 0
2: 2
3: 31
4: 347
948868645_948868653 -4 Left 948868645 2:240787491-240787513 CCAGTGTCTCCCTCTTAACTCAG 0: 1
1: 0
2: 4
3: 15
4: 231
Right 948868653 2:240787510-240787532 TCAGGGGTCCCTGGCTGGTGTGG 0: 1
1: 0
2: 2
3: 31
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948868653 Original CRISPR TCAGGGGTCCCTGGCTGGTG TGG Intronic
900093174 1:929373-929395 ACAGGGGACCTGGGCTGGTGAGG + Intronic
900379961 1:2378835-2378857 TGAGGCGTCACAGGCTGGTGGGG + Intronic
900569283 1:3350508-3350530 TCAAGGGCCCCGGGCTGATGTGG + Intronic
900682487 1:3924588-3924610 GCAGGGGCACCTGCCTGGTGGGG - Intergenic
900880507 1:5377971-5377993 TCAGGGGGCTCTGGCTGGTGGGG + Intergenic
901020770 1:6254228-6254250 TGTGGGGTGCCTGGGTGGTGCGG - Intronic
901078663 1:6571353-6571375 TCAGGGGTCCCTGCCCAGCGTGG + Intronic
901208153 1:7509037-7509059 CCTGGGCTCCCTGGCTGCTGTGG + Intronic
902372962 1:16016984-16017006 TCTGGGGTCCCAGGATGGTAAGG + Intronic
902833542 1:19033149-19033171 GGAGAGGTCCCTGGCTGGAGAGG - Intergenic
903353162 1:22730351-22730373 TCAGGGATCCCTGGCCTTTGGGG + Intronic
904328182 1:29740950-29740972 TGATGAGCCCCTGGCTGGTGAGG + Intergenic
904385868 1:30141732-30141754 TCAGGTGGCCCTGGCTGATGGGG - Intergenic
905861524 1:41355194-41355216 CCAGGGTTCCCTGTGTGGTGGGG + Intergenic
906225791 1:44120039-44120061 TCATTGGTCCCCGGGTGGTGAGG + Intronic
907277563 1:53325777-53325799 TCAGTGCTCCCTGGCTGGCAGGG + Intronic
907354670 1:53862573-53862595 CGAGGGGTCCCTGGCAAGTGTGG + Intronic
908504917 1:64787462-64787484 GCAGGGCTGCCTGGCTGGGGTGG - Intronic
910553012 1:88498137-88498159 TCAGGGCTGCCTGACTTGTGTGG - Intergenic
911850384 1:102811189-102811211 TAAGGGGTTCCTGGATGGTGAGG + Intergenic
912447927 1:109751679-109751701 CCAGGGGTCCCCGGCTGTAGGGG + Exonic
912505145 1:110150951-110150973 TCAGCCCTCCCTGGCTGGGGCGG - Intronic
913181104 1:116322482-116322504 TCAGGACTCCCTTGCTGATGAGG + Intergenic
913392764 1:118332925-118332947 TCTGGGGTCACATGCTGGTGCGG + Intergenic
913982232 1:143531271-143531293 TTAGGGGTGACTGGCGGGTGAGG - Intergenic
915008930 1:152666579-152666601 TCAGTGGTCCATGGCTGGTACGG + Intergenic
915010197 1:152678362-152678384 TCAGTAGTCCATGGCTGGTATGG + Intergenic
915246015 1:154556889-154556911 TAAGGTTTCCCTGGCTTGTGTGG - Intronic
915462449 1:156078209-156078231 TCAGTGGTCCCTGGGTAGTTTGG - Intronic
916327064 1:163574186-163574208 TCAGGTGTCTCTGGGTTGTGAGG + Intergenic
916587818 1:166164230-166164252 CCAGGGGCCCCAGGCTGCTGTGG + Intronic
916723320 1:167501735-167501757 TCTGGTCTCCTTGGCTGGTGAGG - Intronic
916928175 1:169545795-169545817 TAGGGGGACCCTGGCTGTTGTGG + Intronic
917055641 1:170978460-170978482 GCCAGGGGCCCTGGCTGGTGAGG + Intronic
917055699 1:170978741-170978763 TCAAGAGGCCCTGTCTGGTGAGG + Intronic
918175072 1:182036270-182036292 TCAGGGGGACCAGGATGGTGTGG + Intergenic
918302802 1:183219281-183219303 TCAGGGGTTTCTGGCTGCTGAGG + Intronic
919914503 1:202131093-202131115 TTAGGGGTCCCAGGCTTGCGGGG + Exonic
921914671 1:220593958-220593980 TCAGGGGTCTCAGGGAGGTGTGG - Intronic
922570944 1:226634384-226634406 GAGGGGGTCCCTGGCTGCTGAGG - Exonic
922726036 1:227923511-227923533 CCAGGGGCCACTGGCTGTTGGGG - Intronic
923216191 1:231850193-231850215 GGAGGGGTCCCTGGATGATGGGG + Intronic
923507818 1:234621345-234621367 TCAGAGGTCACTGGCTGATCAGG + Intergenic
924772242 1:247088353-247088375 TCAGGGATCCCTGGCTGCTATGG - Intergenic
1062907050 10:1186281-1186303 TCAGACGTCCATGGGTGGTGGGG + Intronic
1063794892 10:9502806-9502828 TCAGTGGTCCCCAGCTAGTGGGG - Intergenic
1067044068 10:42974726-42974748 TCAGGGGTCCAGGCCTGGGGTGG - Intergenic
1067543371 10:47174159-47174181 ACAGGGTTCCATGTCTGGTGAGG + Intergenic
1069590160 10:69636369-69636391 CCTGGGATCCCTGGCTGGGGCGG + Intergenic
1069651304 10:70051997-70052019 CCAGGGCTCCATGGCTGGAGGGG - Intergenic
1069870237 10:71528646-71528668 TCAGGATTCCCAGGCTGCTGCGG - Intronic
1069893822 10:71668160-71668182 GCAGGGGTCTCTGGCTGTGGTGG - Intronic
1069893828 10:71668182-71668204 GCAGGGGTCTCTGGCTGTGGTGG - Intronic
1070685129 10:78474986-78475008 TGAGGGGTCCCTGGCTGCTAAGG + Intergenic
1070751279 10:78965365-78965387 ACAGGGGCCCCAAGCTGGTGGGG + Intergenic
1071776391 10:88792914-88792936 TGCGGTTTCCCTGGCTGGTGTGG - Intergenic
1072536838 10:96370514-96370536 ACAGGGGACCTTGGCTTGTGAGG - Intronic
1072537044 10:96371708-96371730 TCACGGGGCCCAGGCAGGTGGGG - Intronic
1073429793 10:103478715-103478737 TCATGGGTCACTGAGTGGTGTGG + Intronic
1073455461 10:103634145-103634167 TCCGGGATCCCTGGCTCCTGGGG + Intronic
1074317037 10:112370038-112370060 GCAGGAGCCCATGGCTGGTGGGG - Intergenic
1075585334 10:123653315-123653337 GCAGGAGTCCCTGGAAGGTGTGG + Intergenic
1075736557 10:124667954-124667976 TCAGGGCTACTCGGCTGGTGAGG + Intronic
1076395654 10:130136131-130136153 TCGGGGCTCCCTGGCTGAAGGGG - Intergenic
1076726090 10:132413962-132413984 TGAGGGCTCCCAGGCAGGTGGGG + Intronic
1077500573 11:2908154-2908176 TCTGGGGTCCCTGGATGGGCAGG - Intronic
1077539634 11:3140460-3140482 TCAGGGGTCCCAGTCTGAGGGGG + Intronic
1077545474 11:3167470-3167492 TCAAGGGCTCCTGGATGGTGGGG - Intergenic
1080052432 11:27871005-27871027 TGAGGGATCCCAGGCTGGAGTGG + Intergenic
1081572678 11:44301444-44301466 GCAGGAGTCCCAGCCTGGTGGGG + Intronic
1081864810 11:46353650-46353672 CCAGGGGTCGGTGGCTGGTCTGG + Intronic
1083143958 11:60743952-60743974 TCGGGGGTACATTGCTGGTGTGG - Exonic
1083631109 11:64095974-64095996 TCATGGGCCCCTGGGGGGTGGGG - Intronic
1084296223 11:68214431-68214453 TCGGGGATCCCGGGCTGGCGGGG + Intergenic
1084304309 11:68271799-68271821 TCAGGGCTCCCTGACTGGCTTGG - Intronic
1084415921 11:69032912-69032934 GCTGGGGTTCCTGGTTGGTGCGG + Intergenic
1084432109 11:69116872-69116894 TCAGGGGTCCCAGGCAGGGTCGG - Intergenic
1084980645 11:72826854-72826876 CCTGGGGCTCCTGGCTGGTGGGG - Intronic
1085520578 11:77136925-77136947 TCAGAGCTCCCAGCCTGGTGTGG - Intronic
1089319024 11:117612642-117612664 ACAGGGCTCACTGGCTGGGGAGG - Intronic
1089599743 11:119605970-119605992 TGAGGAGCCCCTGGCTGATGAGG - Intergenic
1091186113 11:133649422-133649444 TCAGGGGTCTCTCGCAGGTATGG - Intergenic
1091222047 11:133935582-133935604 GCAGGGGAGCCTGGGTGGTGGGG - Intronic
1091767333 12:3130164-3130186 TCAGGTTTCCCAGGCTGGTGGGG - Intronic
1093253383 12:16836110-16836132 TAAGGGGTGCCAGGATGGTGAGG - Intergenic
1093643551 12:21555852-21555874 TCTGGGTCCCCTTGCTGGTGGGG - Intronic
1095697726 12:45159452-45159474 CCAGGGGTCCATGGCTTGTTAGG - Intergenic
1097070908 12:56354288-56354310 TCTGGGCTCCCTGCGTGGTGAGG + Intronic
1097261164 12:57720976-57720998 TCAGGGGTTCCAGGGTGGGGAGG - Exonic
1103693116 12:122791852-122791874 CCAGGGGTCCTTGCCAGGTGTGG + Intronic
1103930493 12:124448279-124448301 TCTGGGGCCCCTGTCTGGGGTGG - Intronic
1104733506 12:131122073-131122095 TCTGAGGGCCCTGGCTGGTTGGG + Intronic
1104919849 12:132285091-132285113 TCAGGGTTCCCTGGCGGGTGGGG + Intronic
1104953137 12:132451360-132451382 AGAGGGGTCACTGGCAGGTGTGG - Intergenic
1106105816 13:26732612-26732634 TCAGAGGTCCCTGGCGGAAGGGG + Intergenic
1106902145 13:34364943-34364965 CCAGGGGTCACTGAATGGTGAGG - Intergenic
1113330721 13:109324429-109324451 TCATGGTTCCTTGTCTGGTGGGG - Intergenic
1113681364 13:112247372-112247394 GCAGGGGACCCTCTCTGGTGTGG - Intergenic
1113887145 13:113666991-113667013 TCTGGGGCCCCTGGCTGGAGAGG - Intergenic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1114495050 14:23126620-23126642 ACAGGGAGCCCTGGCTGGGGTGG + Exonic
1114697945 14:24644891-24644913 CCAGGGCTGCCTGACTGGTGAGG - Intergenic
1114808242 14:25863167-25863189 TCAGTGCTCCCAGACTGGTGAGG - Intergenic
1115190815 14:30745417-30745439 TCAGAATTCCCTGGCTGGGGAGG + Intergenic
1116998588 14:51349595-51349617 TCAGGGATCCTTGGTTGATGTGG - Intergenic
1117014732 14:51507235-51507257 GCAGGGCATCCTGGCTGGTGTGG + Intronic
1118397748 14:65352049-65352071 TGAGGGGACTCTTGCTGGTGAGG - Intergenic
1118767428 14:68919297-68919319 TCAGGGGTCAGTGGCAGGGGTGG - Intronic
1118905606 14:70021114-70021136 TCATGGCTCCCTGGCAGGAGGGG + Intronic
1121102535 14:91259956-91259978 TCAGGGGTCCCAGGCAGTTAAGG - Intergenic
1121182690 14:91941564-91941586 TCAGGGGTCCCAGGGAGTTGGGG + Intronic
1122353567 14:101111018-101111040 GCAGGGGACATTGGCTGGTGGGG + Intergenic
1122633846 14:103121293-103121315 GCAGGGGGCTCTGCCTGGTGGGG - Intergenic
1122904051 14:104793890-104793912 TCAGGGGTCTCTGCCTGGCCTGG - Exonic
1122972426 14:105157880-105157902 TGGTGGGTCCCTGGCTGGGGAGG - Intronic
1123018627 14:105387247-105387269 GCAGGGGAGCCTGGCTGGAGAGG - Intronic
1123044158 14:105503280-105503302 TGAGGGGCCCGGGGCTGGTGAGG + Intergenic
1123044337 14:105504037-105504059 GCGGGGGTGCCGGGCTGGTGGGG + Intergenic
1124600607 15:31130078-31130100 TCAGAGCTGCCTGGGTGGTGTGG + Intronic
1124891173 15:33734559-33734581 GCAGGGGTCCTTGGTTGATGTGG - Intronic
1125506935 15:40272484-40272506 CAAGGGTGCCCTGGCTGGTGAGG + Exonic
1126091108 15:45052706-45052728 TCAGCAGTCTCTGGGTGGTGGGG - Intronic
1127722816 15:61719493-61719515 TCAGGTGTCCCTGTCTGGATGGG + Intergenic
1129167542 15:73787292-73787314 TCAGGGGGGCCTGGGAGGTGAGG + Intergenic
1130017202 15:80196763-80196785 TCAGGGGACCCTGGGTGATACGG - Intergenic
1130579468 15:85122996-85123018 TCAGGAGTACCTGTCTGGTCTGG + Intronic
1132146947 15:99434836-99434858 TCGGGAGCCCCGGGCTGGTGGGG - Intergenic
1132319893 15:100918384-100918406 TCTTGGGTCCCTGGTTGGAGAGG - Intergenic
1132617898 16:851471-851493 TCTGGGGTCCCTGTGTGGTCAGG - Intergenic
1132710116 16:1262736-1262758 TCAGGGGTCCTGGTCTGGGGCGG + Intergenic
1132710762 16:1266063-1266085 TCAGGGGTCCTGGGCTGCGGGGG + Intergenic
1133440874 16:5819988-5820010 CCAGAGGTCCCGGTCTGGTGGGG - Intergenic
1133839680 16:9396205-9396227 TCAGGTGTTCCTGGCAGGTGGGG - Intergenic
1134359951 16:13522084-13522106 TTAGGATTCCATGGCTGGTGGGG - Intergenic
1134880764 16:17743735-17743757 TCAGGGAGGCCCGGCTGGTGGGG - Intergenic
1135422407 16:22313996-22314018 TGAGGCTTCCCTGGCGGGTGGGG + Intronic
1136544320 16:30947316-30947338 TCAGGAATCCCAGGGTGGTGAGG - Exonic
1137222509 16:46470155-46470177 TCAGGGGTCCCAGGAAGGGGAGG + Intergenic
1137577269 16:49608568-49608590 CCTTGGGTCCCTGGCTGGTCTGG - Intronic
1138105413 16:54285061-54285083 TGAGCTGTCCCTGGCTGGGGCGG - Exonic
1138183515 16:54959442-54959464 TCAGGGGTTTGTGGGTGGTGGGG - Intergenic
1139486151 16:67257640-67257662 CCATGCTTCCCTGGCTGGTGGGG - Intronic
1140861903 16:79025516-79025538 TCAGTGCTCCCTGGCTTGTGGGG - Intronic
1141149099 16:81551971-81551993 CAGGGGGGCCCTGGCTGGTGGGG + Intronic
1141183237 16:81768935-81768957 TCAGGAGTCCCAGGCTGCTGGGG - Intronic
1141451967 16:84110060-84110082 TCATGCGTCCTTGGCAGGTGAGG - Intronic
1142131803 16:88434599-88434621 TCAGGGGTCCCTGGGTCCTCCGG - Exonic
1142224817 16:88872262-88872284 TCTGGGGTCCGTGGGTGGAGAGG + Intergenic
1203138990 16_KI270728v1_random:1747776-1747798 TCTTGGGTCCCTGGCTGGCTTGG - Intergenic
1144013799 17:11174686-11174708 TCAGGGATCCCTGGATTTTGAGG + Intergenic
1144809041 17:17986879-17986901 TCAGGGTTACCTGGCAGGTGGGG - Intronic
1146478235 17:33180485-33180507 TCTGACGTCCCTTGCTGGTGAGG + Intronic
1147383113 17:40067253-40067275 GCAGGTGCCCCTAGCTGGTGGGG - Intronic
1148073363 17:44921495-44921517 ACAGTGGGCCCTGGCTGGGGTGG - Intergenic
1148117720 17:45186977-45186999 TCAAGGGGTCCTGTCTGGTGAGG - Intergenic
1148342027 17:46878891-46878913 TGAGGGCTCCTTGGCTTGTGGGG + Intronic
1148911198 17:50944140-50944162 TCAGGAGTCTCAGGCTGGGGAGG - Intergenic
1149329439 17:55566217-55566239 TCAGTGGACCCTGGGTGATGCGG + Intergenic
1149460889 17:56829464-56829486 TCTTGGCTGCCTGGCTGGTGTGG - Intronic
1149550133 17:57533745-57533767 TCAGGGGTCCCCAGCTGGGGTGG + Intronic
1149685223 17:58531274-58531296 GCAGAGGGACCTGGCTGGTGGGG + Intronic
1152347523 17:79762390-79762412 TTATGGGTCCCTGGAGGGTGGGG - Intergenic
1152461038 17:80442622-80442644 ACAGGTGTCCCTGTCTTGTGTGG + Intergenic
1152755637 17:82085900-82085922 TCAGGGGCACCTGCCTGGTGTGG - Intronic
1159758479 18:72395051-72395073 TCATGGTTCCCTCCCTGGTGGGG - Intergenic
1159954199 18:74507818-74507840 TCAGGGAGCCCTGGAGGGTGGGG + Intronic
1160148589 18:76383514-76383536 TCATGGGTCCCTGGCTGAGAAGG - Intronic
1160208626 18:76858517-76858539 TCAGAGGTCCCTATCTGGAGGGG + Intronic
1160797264 19:951592-951614 TCAGAGTTCCCCGGCTGGTCTGG + Intronic
1161021501 19:2013627-2013649 CCAGGGGTCTCTGGCTGAGGTGG + Intronic
1161302811 19:3551230-3551252 CCTGGGAGCCCTGGCTGGTGCGG - Intronic
1161370413 19:3908130-3908152 TAAGGGGTCGCCGGCTGCTGTGG + Intronic
1161979753 19:7624271-7624293 TCTGGGGGCCCCGGCTGGTGGGG - Intronic
1162479485 19:10920322-10920344 CCAGGGGTCCCTGGCAGAGGGGG + Intronic
1162559020 19:11405255-11405277 TCAGGGGTCAGTGGCTTGGGAGG + Intronic
1162683688 19:12365051-12365073 TGTGGGGTCGCTGGTTGGTGGGG - Exonic
1163236388 19:16032797-16032819 TCAGTGGGGCCTGGCTAGTGGGG + Intergenic
1163425135 19:17236702-17236724 TCAGGGGTCACCATCTGGTGGGG - Intronic
1163633024 19:18426669-18426691 CCAGGGGTCCCTGGCAGGCTGGG + Intronic
1163863627 19:19755240-19755262 TCAGGGGGTCCTGGCTAGTGGGG - Intergenic
1163863726 19:19755691-19755713 TCAGTGGGGCCTGGCTAGTGGGG - Intergenic
1164771348 19:30811797-30811819 TCCAGGGACCCTGGCTGATGGGG - Intergenic
1164832971 19:31336757-31336779 TCTGGCTTTCCTGGCTGGTGAGG - Intronic
1164888381 19:31802823-31802845 TCCGGGGACCCTGGCTTTTGAGG + Intergenic
1165293187 19:34905411-34905433 GCAGGGTTCCCTGTCTGGTCTGG + Intergenic
1165781701 19:38438427-38438449 TCAGGGGCCCCAGGGAGGTGGGG + Intronic
1165996783 19:39849250-39849272 CCAGAGGTCCCAGCCTGGTGGGG + Intergenic
1166410855 19:42554678-42554700 TCAGGGGTGACTGGCAGGAGTGG + Intronic
1167144444 19:47673388-47673410 TCAGGGGTTTCTGGCTGGGAGGG + Intronic
1167459286 19:49615820-49615842 TCAGGGGTCTCAGGCTTGGGAGG - Exonic
1167588160 19:50386757-50386779 CCAGAGGTCCCTGGCTGGTAAGG + Intronic
1168277217 19:55284720-55284742 TCCTGGGTCCCTGGATGGAGGGG + Intronic
1168334936 19:55592304-55592326 TGAGGGGACCCTGACTGGAGAGG - Exonic
925026508 2:611744-611766 TCAGGGGTCTCAGGCAGGAGAGG + Intergenic
926060024 2:9799496-9799518 TCTGGGCTGCCTGGCTGGGGTGG - Intergenic
926715622 2:15921592-15921614 TCAGGGGTCCAAGGCTGCTGGGG - Intergenic
929761461 2:44810898-44810920 ACAAGGGTCCCTGCTTGGTGTGG + Intergenic
929936546 2:46297851-46297873 CCTGGGCTCCCTGGCGGGTGGGG - Exonic
929961229 2:46497793-46497815 TGAGCGTGCCCTGGCTGGTGAGG + Intronic
930100392 2:47598807-47598829 TGAGAGGTCACTGGCTGGTTTGG + Intergenic
931903905 2:66821849-66821871 TCGGGGCTCTTTGGCTGGTGGGG + Intergenic
932398907 2:71466404-71466426 CCCGGGATCCCTGGCTGGTGTGG + Intronic
932414795 2:71566940-71566962 TAAGGGGTCCCACGCTGGTCAGG - Intronic
934113973 2:88766314-88766336 TAGGGGGTGCCTGGCTGGGGTGG + Intergenic
934572978 2:95383819-95383841 TCCGAGGTCCCCAGCTGGTGAGG - Intronic
934636054 2:95991372-95991394 TAGGGGGTGCCTGGCTGGGGTGG - Intronic
934835821 2:97589385-97589407 TAGGGGGTGCCTGGCTGGGGTGG - Intronic
934978346 2:98821931-98821953 TCGGGGGGCGCGGGCTGGTGCGG + Exonic
935125059 2:100215547-100215569 TCAGGAGACCCAGACTGGTGGGG - Intergenic
935130660 2:100258598-100258620 GCAGGGGTAACTGGCTGGGGTGG + Intergenic
935156421 2:100487398-100487420 TCAGGGGTCCATGTCTGGCCAGG + Intergenic
935179265 2:100675565-100675587 ACAGGGGTACCTGGTTTGTGGGG - Intergenic
935258096 2:101330500-101330522 GCAGGGCTCCAAGGCTGGTGGGG - Intergenic
946125680 2:217560564-217560586 TAAGGGTGCCCTGGCTGATGAGG - Intronic
946374144 2:219298010-219298032 TCTGGTGGCCCTGGCAGGTGTGG - Exonic
946686784 2:222278792-222278814 TCAGGTGTCCGTGTTTGGTGGGG - Intronic
947838983 2:233195451-233195473 TCATGGGGTCGTGGCTGGTGAGG - Exonic
948464558 2:238145956-238145978 TCAGGGCTCGCTGTCTGGTGGGG + Intronic
948868653 2:240787510-240787532 TCAGGGGTCCCTGGCTGGTGTGG + Intronic
948894123 2:240920428-240920450 ACAGGGCTCCCGGGCAGGTGCGG - Intronic
949014447 2:241701733-241701755 CCAGGGGTCGCTGACAGGTGCGG + Intergenic
1169208481 20:3753057-3753079 TCAGGGCTCTCAGGCAGGTGGGG - Exonic
1169234914 20:3923059-3923081 TAAGGAGTCCCTGTCTGGGGAGG - Intronic
1172055463 20:32151404-32151426 TCGGGGATCCCTGGGAGGTGAGG - Intronic
1172432790 20:34906416-34906438 GCTGGGGCCCCTGGCTGGTTGGG - Intronic
1172798955 20:37563274-37563296 GCTGGGGTTCCTGGCAGGTGTGG + Intergenic
1172854121 20:37988107-37988129 TCAGGGCTCCCTGTCTGCTGGGG + Intronic
1172881174 20:38200910-38200932 TCAGGAGTTCCTGGCAAGTGTGG + Intergenic
1173334553 20:42102011-42102033 GCAGGGGGGGCTGGCTGGTGGGG + Intronic
1173470310 20:43318581-43318603 TAAGGGGTCCTTGGCTCGGGAGG - Intergenic
1173868875 20:46329760-46329782 GCCGGGCTCCCTGGCTGCTGCGG + Intergenic
1174061690 20:47837514-47837536 TCAGGGGTCCTTGGTCGGGGTGG - Intergenic
1174069818 20:47891710-47891732 TCAGGGGTCCTTGGTCGGGGTGG + Intergenic
1174398200 20:50260849-50260871 TCAGGGGTGACTAGGTGGTGGGG + Intergenic
1174445212 20:50586528-50586550 TCAGGGCTCCTGGGCTGATGTGG + Exonic
1175445453 20:59016550-59016572 GCAGGGGCCCCTGGGTGGGGAGG + Intergenic
1176215257 20:63944850-63944872 CCAGGGCACCCTGGCAGGTGGGG + Intronic
1176231517 20:64035662-64035684 TGAGGGGTCTCTGGCTGAAGAGG - Intronic
1176289921 21:5038296-5038318 CCTGAGGTCCCTGGCTGCTGTGG - Intronic
1176299105 21:5090272-5090294 TCCCGGGCTCCTGGCTGGTGGGG + Intergenic
1176388719 21:6152494-6152516 GCAGGGGTCCCTGGTGTGTGTGG - Intergenic
1177393770 21:20507974-20507996 CCAGTGGGCCCTGCCTGGTGAGG + Intergenic
1178938501 21:36884872-36884894 TCAGGGGTCTCAGGAAGGTGTGG + Intronic
1179495506 21:41769013-41769035 TCATTGGTCCCAGGCTGGTGAGG + Intergenic
1179577844 21:42318719-42318741 TCAGAGCTCACAGGCTGGTGAGG + Intergenic
1179719363 21:43306600-43306622 TTGGGGCTCCCTGGCTTGTGGGG - Intergenic
1179734753 21:43385754-43385776 GCAGGGGTCCCTGGTGTGTGTGG + Intergenic
1179782899 21:43713809-43713831 TCAGAGTTCCCTGGCTGAGGAGG - Intergenic
1179801323 21:43812750-43812772 CCAGGGCTCCCTGGCTGAAGTGG + Intergenic
1179857920 21:44171676-44171698 TCCCGGGCTCCTGGCTGGTGGGG - Intergenic
1179867331 21:44225343-44225365 CCTGAGGTCCCTGGCTGCTGTGG + Intronic
1180835282 22:18926572-18926594 GCAGGGGTGCAGGGCTGGTGGGG - Intronic
1181045519 22:20212327-20212349 CCAGGCTTCCCTGGGTGGTGGGG + Intergenic
1181627309 22:24130659-24130681 TCATGGGTGCCAGGCTGGTGGGG - Intronic
1181910615 22:26235475-26235497 TCAGAGTTGCCTGGCTGGAGGGG + Intronic
1182097923 22:27638432-27638454 TCAGGGACCCCTGGCTGGGCTGG + Intergenic
1182747483 22:32616673-32616695 GAAGGGTTCCCAGGCTGGTGGGG + Intronic
1183428663 22:37752736-37752758 TCCGGGGACCCTGGGTGGGGAGG - Intronic
1183542041 22:38435126-38435148 TCATGGCTCCCTGGCAGGAGAGG + Intronic
1183676096 22:39299619-39299641 TCCGGGCTCCCTGCCTGGGGTGG + Intergenic
1183934928 22:41256659-41256681 TCTGGGGTCTGTGGGTGGTGGGG - Intronic
1184309661 22:43633109-43633131 TCAGGGGTCCCCGGCTCGCCTGG + Intronic
1184330103 22:43821804-43821826 TCTGAGGGCCCTGGCTGGGGTGG + Intergenic
1185075962 22:48682399-48682421 TCAGGGGGCTCTGGGTGGAGGGG - Intronic
1185078465 22:48696038-48696060 CCAGGGGTCCGGGGCAGGTGGGG - Intronic
1203285370 22_KI270734v1_random:151871-151893 GCAGGGGTGCAGGGCTGGTGGGG - Intergenic
949684575 3:6553474-6553496 GCTGGTGTCCCTGGCAGGTGGGG + Intergenic
950122505 3:10491088-10491110 TCAGGGGTGCTTGGTTGGGGAGG + Intronic
950677130 3:14561112-14561134 ACAGGGGAGCCTGGCAGGTGTGG - Intergenic
950906592 3:16544546-16544568 TCAGGGAGCCCTTGCTGATGGGG - Intergenic
951067495 3:18284011-18284033 TCAGGATTCCCTGGCTAGAGAGG + Intronic
951189291 3:19749675-19749697 TCAGGGATCCATGGCCTGTGGGG + Intergenic
953886077 3:46715049-46715071 ACAAGGGTGCCTGGTTGGTGTGG - Intronic
954620532 3:51992921-51992943 TCCTGGGTCCCTAGCTGTTGGGG + Intergenic
955391271 3:58524229-58524251 ACGGGGGTCCATGGCTGATGGGG + Intronic
958864477 3:99485197-99485219 TGGGGGGTCCCTGGCTCCTGTGG + Intergenic
959006467 3:101026023-101026045 CCAGGGGTTCCTGACTGTTGAGG + Intergenic
961385284 3:126519849-126519871 CCAGGTGGCCCTGGCTGGTGAGG - Intergenic
961450756 3:127001316-127001338 TCATGTGGCCCTGGCTGTTGGGG + Intronic
964248679 3:154684686-154684708 TCATGCCTCCCTGGCTGCTGTGG + Intergenic
968592623 4:1466471-1466493 GCAGAGGTCCCTGGCCGGGGTGG + Intergenic
969166923 4:5323796-5323818 TCAGAGTTCACTGGCTGGTGGGG + Intronic
972730037 4:41785292-41785314 TCAGTAGGCCCTGCCTGGTGTGG - Intergenic
975135314 4:70868808-70868830 TCATGGTTCCTTGACTGGTGGGG + Intergenic
981923779 4:150116326-150116348 CCAGGGCTTCCTGGCTGTTGGGG + Intronic
985366581 4:189237485-189237507 TCACGGGGCCCTGTCTGCTGAGG + Intergenic
985562954 5:601172-601194 TCAGGGGTCAGGGGCTGGAGTGG + Intergenic
985650716 5:1105967-1105989 GCAGGAGTCCCTGGGTGCTGGGG - Intronic
986664128 5:10085227-10085249 TCAGGTGTCCCTCGCTAGTCAGG - Intergenic
987112649 5:14701706-14701728 TCAGGAGTCCCCGTTTGGTGTGG + Intergenic
992161944 5:74012778-74012800 TCAGGGGTGCATGGCTGTGGTGG + Intergenic
992648708 5:78836386-78836408 GCAGGAGTCCCAAGCTGGTGGGG + Intronic
993118492 5:83746387-83746409 TCAGGAGTCCCTGGGTCTTGAGG + Intergenic
993659990 5:90621673-90621695 TCCTAGGTCCCTGACTGGTGGGG + Intronic
994774301 5:104024784-104024806 CCTGGGGTCCCTGGCACGTGAGG - Intergenic
995225006 5:109690947-109690969 TCAGGGGCTCTGGGCTGGTGCGG - Intronic
996443020 5:123512660-123512682 GCTGGGGTCCCGGGCGGGTGGGG + Intronic
996550077 5:124721433-124721455 TCAGGGGTTCCAGGCTGGCAGGG + Intronic
999617769 5:153443286-153443308 TGAGAAGTCCATGGCTGGTGAGG + Intergenic
1001400975 5:171446306-171446328 TGCGGTGGCCCTGGCTGGTGAGG + Intronic
1002415314 5:179117412-179117434 TCAGGGATCCCAGCCTGGTGGGG - Intronic
1002457520 5:179354030-179354052 TCAGGGGTCCCTGCATGGCTGGG + Intergenic
1003039886 6:2677974-2677996 GCAGGAGTCCATGGCTGGTATGG + Intronic
1005742276 6:28803342-28803364 ACAGGGGTCCTTAGCTGGCGTGG + Intergenic
1005968160 6:30742108-30742130 TCTGGGGTCACTGGCTGGGAAGG + Intronic
1006316299 6:33293778-33293800 TCAGAGGTGACTGGCGGGTGAGG - Exonic
1006638198 6:35474975-35474997 CCAGGGGTGCCAGGCAGGTGTGG + Exonic
1010488940 6:76451921-76451943 ACAGAGGTTTCTGGCTGGTGAGG - Intergenic
1010547206 6:77173106-77173128 CAAGGGGTCCCTTCCTGGTGGGG + Intergenic
1013422474 6:109978972-109978994 TCTGGGGTCCCAGGGTGGGGTGG + Intronic
1016934132 6:149436358-149436380 TCAGGGGTCATGGGCTTGTGAGG + Intergenic
1017000840 6:149996059-149996081 CCAGTGGCCCCTGGCTGGTGGGG - Intergenic
1017040957 6:150308305-150308327 TCAGGGTCTCCTGCCTGGTGGGG + Intergenic
1017967694 6:159280802-159280824 TCAGGGGTCCCTGAGTGTAGAGG - Intergenic
1018146964 6:160900510-160900532 CCAGCGGGCCCTGCCTGGTGAGG - Intergenic
1018421994 6:163647948-163647970 ACAAGACTCCCTGGCTGGTGTGG - Intergenic
1018523236 6:164676919-164676941 TCAGGGATCACTGTCTTGTGAGG + Intergenic
1019327435 7:445374-445396 TGACGGGGCGCTGGCTGGTGGGG - Intergenic
1019358921 7:594901-594923 TCTGGGGTCCCTTGGTGGTCTGG - Intronic
1019729211 7:2621252-2621274 TCAGGGGTGTGTGGCTGGAGGGG - Intergenic
1019731013 7:2629696-2629718 GCAGGGCTGCCAGGCTGGTGTGG + Intergenic
1020032532 7:4942944-4942966 TAAGGGGTCACTGGCTGGGATGG - Intronic
1021787280 7:24164676-24164698 ACAGAGGTTGCTGGCTGGTGAGG - Intergenic
1022248976 7:28587999-28588021 TCAGGGGTCCAGGGCTGTTTGGG + Intronic
1023763004 7:43484131-43484153 GCTGGGGTCCCTGGCAGGGGAGG - Intronic
1024036619 7:45512234-45512256 TCATCGGACACTGGCTGGTGTGG - Intergenic
1024480337 7:49855792-49855814 CCACCGGCCCCTGGCTGGTGAGG - Intronic
1026114740 7:67486686-67486708 TCAGGGGTCACTTGAGGGTGGGG + Intergenic
1027681810 7:81232116-81232138 ACAGAGGTTTCTGGCTGGTGAGG - Intergenic
1032011452 7:128350708-128350730 CCAGGGGTCCCTGGGTGGGTGGG - Exonic
1032110170 7:129069176-129069198 TCTAGGGTGCTTGGCTGGTGGGG - Intergenic
1033358968 7:140624308-140624330 TCAGAGGTCCCAGTCTAGTGAGG + Intronic
1033930124 7:146509631-146509653 GCAGGGGTCTCTGACTGGGGTGG + Intronic
1034500687 7:151448653-151448675 CCAGGGGGCCCGGGCTGGCGGGG - Intergenic
1034746670 7:153529355-153529377 TCAGGTCTCCATGGCTGTTGTGG + Intergenic
1034932644 7:155174670-155174692 TCAGGGGTCACTGATTGGAGTGG - Intergenic
1036635647 8:10548197-10548219 TCAGGTGGGCCTGGCTGGAGTGG + Intronic
1037419417 8:18686622-18686644 TCAAGGGCCCCTGGATGCTGAGG - Intronic
1037860921 8:22405032-22405054 TCAGGGTTCCCTGTCTAGTTGGG + Intronic
1038394968 8:27239947-27239969 TGAGGGGTCCCTGGCTAGAGAGG - Intronic
1044170848 8:89049991-89050013 TCAGGGGGCCCTGTCCAGTGAGG + Intergenic
1045425442 8:102061335-102061357 TCAGTGGTCCAGGGCTGCTGGGG - Intronic
1048251641 8:132871118-132871140 TCTGGGGTACCTGACTGATGTGG + Intronic
1048311852 8:133328897-133328919 TCAGGGCTGCCTGGATGGTCTGG + Intergenic
1048987447 8:139742318-139742340 ACAGCTGTCCCAGGCTGGTGGGG - Intronic
1049170570 8:141158184-141158206 TCAGGTGCCCTTGGCTGGGGAGG - Intronic
1049189720 8:141280243-141280265 CCTGGGGTCACTGGCTCGTGAGG + Intronic
1049191367 8:141289692-141289714 TCAGGGGTCCCCTGCGGCTGTGG + Intronic
1049222560 8:141434653-141434675 TCAGGGCTCCCTGTCTCCTGGGG + Intergenic
1049740731 8:144239739-144239761 GCTGGGGTACCTGGATGGTGAGG + Exonic
1050388045 9:5111302-5111324 ACAGGGGTCCGGGGCTGCTGAGG - Intronic
1050395228 9:5188411-5188433 GCGGGGGCCCCTGCCTGGTGAGG + Intergenic
1053025269 9:34724057-34724079 TCTGTGGTCCCTGGCTGCTTTGG + Exonic
1053145215 9:35707284-35707306 TCAGGAGTCCCTGGAAGATGAGG + Intronic
1057037440 9:91821552-91821574 TCAGGGGTGCATGGCTGTGGAGG - Intronic
1057193035 9:93097784-93097806 TCAGGGACCCCTGCCTGATGTGG - Intronic
1057599578 9:96445637-96445659 TCAGGAGTTCCAGGCTGGTCTGG + Intergenic
1057605891 9:96497334-96497356 TCGGGGGTCCCTGGCCTGTGTGG - Intronic
1059249949 9:112879589-112879611 TCAGGGATCCCTGGTGGATGGGG - Exonic
1060508434 9:124215338-124215360 TGAGGAGCCCATGGCTGGTGGGG - Intergenic
1060597860 9:124858815-124858837 TCAGGGGTCCCAGCCTAGTGGGG + Intronic
1061418873 9:130462573-130462595 CCAGCCGTGCCTGGCTGGTGAGG + Intronic
1061789311 9:133050699-133050721 TCTGGGCTCCCTGCCTGGTCTGG + Intronic
1061959903 9:133982554-133982576 GCAGGAGTCTCTGGCTGGCGGGG + Intronic
1061990195 9:134154579-134154601 GCAGGTGTCTCTGGCTGGGGAGG - Intronic
1062334329 9:136058357-136058379 TCCCGGGTCCCTGGCTGGGAAGG - Intronic
1185460825 X:332139-332161 TAAGGGGACCCAGCCTGGTGGGG - Intergenic
1187554452 X:20338694-20338716 TCAGGGGTCCCAGCCTGGGTTGG + Intergenic
1189129003 X:38479175-38479197 TCCAGGGTCTCTGACTGGTGAGG - Intronic
1189196145 X:39154888-39154910 TCAGGGGTAGCTGATTGGTGAGG - Intergenic
1189860402 X:45265440-45265462 TCAGGCTGCCTTGGCTGGTGGGG + Intergenic
1190295988 X:49028018-49028040 TCAGAGGTCACAGTCTGGTGGGG + Intergenic
1190297959 X:49039578-49039600 TCAGGGGTCACAGTCTGATGGGG + Intronic
1190357422 X:49618599-49618621 TCAGGTGTCACAGTCTGGTGAGG + Intergenic
1193148235 X:78099667-78099689 TGAGTGGTCCAGGGCTGGTGAGG + Intronic
1195702236 X:107714341-107714363 TCAGGGGTCTGTCGCTGGAGTGG + Exonic
1195946554 X:110219991-110220013 TCAGAGCTGCCAGGCTGGTGTGG + Intronic
1199878870 X:151956923-151956945 TCATGACTCCCAGGCTGGTGTGG + Intronic
1200051376 X:153433543-153433565 TCCGGGTTCCCTGGCAGGAGGGG + Intergenic
1200122558 X:153798017-153798039 TCAGGGGTGCCTGGCGTGTGGGG - Intronic
1200231757 X:154447279-154447301 TCACGGGCCCCTGGAGGGTGTGG + Intronic