ID: 948871020

View in Genome Browser
Species Human (GRCh38)
Location 2:240798129-240798151
Sequence CACCAGCGCCTGCATCCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 185}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948871020_948871029 20 Left 948871020 2:240798129-240798151 CCCTGTGGATGCAGGCGCTGGTG 0: 1
1: 0
2: 0
3: 20
4: 185
Right 948871029 2:240798172-240798194 CAGGCCCCAAGAGCCAGTGCTGG 0: 1
1: 0
2: 2
3: 32
4: 335
948871020_948871024 -9 Left 948871020 2:240798129-240798151 CCCTGTGGATGCAGGCGCTGGTG 0: 1
1: 0
2: 0
3: 20
4: 185
Right 948871024 2:240798143-240798165 GCGCTGGTGGGCTCCATGCCAGG 0: 1
1: 0
2: 2
3: 15
4: 182
948871020_948871025 1 Left 948871020 2:240798129-240798151 CCCTGTGGATGCAGGCGCTGGTG 0: 1
1: 0
2: 0
3: 20
4: 185
Right 948871025 2:240798153-240798175 GCTCCATGCCAGGTCCGCGCAGG 0: 1
1: 0
2: 0
3: 14
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948871020 Original CRISPR CACCAGCGCCTGCATCCACA GGG (reversed) Intronic
900403974 1:2484389-2484411 GACCAGGGCCTGCATGCACAGGG - Intronic
900619210 1:3579332-3579354 CACCAGCTCCTGCTTCAACCTGG + Intronic
901465282 1:9417339-9417361 CAGCAGGGTCTGCAGCCACAGGG - Intergenic
901511186 1:9718779-9718801 CTCCAGCCGCTGCTTCCACACGG - Exonic
902598288 1:17523805-17523827 CACCAGCCCCTGCACTCAGATGG - Intergenic
902955594 1:19922567-19922589 CCCCAGCTCCTCCATCCCCATGG + Intronic
903071231 1:20727894-20727916 CACCAGCGCCTGCTACCTGAGGG + Intronic
905888673 1:41505906-41505928 CTCCAGACCCTGCCTCCACAAGG - Intergenic
910371711 1:86523752-86523774 CCCCAGCGCCTGGATCCCCTAGG - Intergenic
912856245 1:113170965-113170987 CAGCAGTGCCTGCATCTCCATGG + Intergenic
915527053 1:156482385-156482407 TACCCCCGCCTGCATCCACATGG - Intronic
915973780 1:160371659-160371681 CACCAACCCCTGCCTCCCCAGGG - Exonic
916006923 1:160670735-160670757 CACCAGCACCTGCATCAGAATGG - Intergenic
918244558 1:182647344-182647366 AACCAGGGCCTCCCTCCACAGGG - Intronic
922517104 1:226215583-226215605 CTCCAGCCCCTGGCTCCACAGGG + Intergenic
922841973 1:228650177-228650199 CATCAGCGGCTGCAGCCCCATGG + Intergenic
923220543 1:231888771-231888793 CCCCAGTGCCCCCATCCACAGGG + Intronic
1063479980 10:6367053-6367075 CACCAGCGCCAGCATCTACTTGG + Intergenic
1064143967 10:12812786-12812808 GGCCAGCCCCTGCCTCCACACGG + Intronic
1064561652 10:16599920-16599942 CACCAGCCACTGCAGCCCCATGG - Intronic
1064985951 10:21209876-21209898 CACCAGTTCCTGGCTCCACAAGG - Intergenic
1067287063 10:44914445-44914467 CACGGGCGCATGCATGCACATGG - Intronic
1067745554 10:48933121-48933143 CCACAGAGCCTGGATCCACATGG - Intronic
1069778696 10:70941637-70941659 CTCCAGTGCCTCCATTCACAAGG - Intergenic
1069833785 10:71296308-71296330 CAGCAGCGCCTGAGACCACAAGG + Intronic
1069992690 10:72324986-72325008 CACCCAGCCCTGCATCCACAGGG - Intergenic
1070724200 10:78777392-78777414 CTCTAGTGCCTGCATCCACAAGG + Intergenic
1072610174 10:97012687-97012709 CACAAGAGCCTCCATCCAAATGG - Intronic
1074507466 10:114084393-114084415 CACCAGCCCCAGCAGCCACAGGG - Intergenic
1074888810 10:117717773-117717795 CAGCAGTGCCTTCTTCCACATGG - Intergenic
1075690486 10:124390610-124390632 CCCCAGACCCTGCATCCCCATGG + Intergenic
1076674472 10:132141036-132141058 CACCAGCCCCTTCTTCCAGAAGG + Intronic
1076936034 10:133567967-133567989 CAGCAGCTCCTGCACCCACTGGG + Intronic
1077103630 11:832825-832847 CCCCAGCGCCTACACCCACGCGG + Exonic
1077916718 11:6616372-6616394 CAGCAGCGCCTACATCCAGCGGG - Exonic
1078897956 11:15614874-15614896 CACCAGAGCCTGCATCCCTGTGG - Intergenic
1079108292 11:17588300-17588322 CTCCAGCACCTGCCTCCCCACGG - Intronic
1083285995 11:61659484-61659506 CACCAGCGCCAGAATCCCCCAGG + Intergenic
1083307939 11:61770497-61770519 CACCAGCTCCTGCAGCAGCACGG + Exonic
1083488676 11:62999156-62999178 CACCAGCTTCTGCATCCCCACGG + Intronic
1084565127 11:69924262-69924284 CACCGACACCTGCAGCCACAAGG + Intergenic
1085351435 11:75800420-75800442 CACCAGGGCCTCCATGTACATGG - Exonic
1087812406 11:102622706-102622728 CACCAGCTCCCTCATCCTCATGG + Intronic
1088829034 11:113519608-113519630 CACCAGCTCCTTCATCTTCAGGG - Intergenic
1089335771 11:117722749-117722771 CACCTCAGCCTGAATCCACAGGG - Intronic
1091549837 12:1529401-1529423 CAGCAGCTCCTGCCTCCACTGGG + Intergenic
1091836996 12:3593004-3593026 CACCTGCTCCTGGAACCACAGGG - Intronic
1092953706 12:13530544-13530566 AACCAGTGGGTGCATCCACATGG - Intergenic
1092953832 12:13531464-13531486 CAGCAGCGACTGCATTCACATGG - Intergenic
1097953306 12:65456843-65456865 CACCCCCTCCTCCATCCACAAGG - Intronic
1102247766 12:111366047-111366069 AACCGGGGCCAGCATCCACATGG - Intronic
1102532998 12:113560401-113560423 CAACAGAGGCTGGATCCACAAGG + Intergenic
1104626013 12:130355429-130355451 CACCAGCGCCTTCACCCTGACGG + Intronic
1105287214 13:19014183-19014205 CATCTGCACCTCCATCCACATGG + Intergenic
1107126612 13:36853529-36853551 CCCCAGCGGCTGCAGCCTCAAGG - Exonic
1107998020 13:45879878-45879900 GACCAGCGCCAGCAACCACCAGG - Intergenic
1110678072 13:78274575-78274597 AATAAGCTCCTGCATCCACATGG + Intergenic
1112009188 13:95279821-95279843 CACGAGCTCCTGGAGCCACAGGG + Intronic
1113580895 13:111428080-111428102 CACCAAGGCTTCCATCCACAAGG - Intergenic
1115761451 14:36581768-36581790 CACCAGCGCCGGCCTCCTCCAGG + Intronic
1115893817 14:38061627-38061649 CACCAGAGGCAGCTTCCACATGG - Intergenic
1117486980 14:56207781-56207803 AAAGAGTGCCTGCATCCACAGGG + Intronic
1118489262 14:66243481-66243503 TACCTCCACCTGCATCCACAGGG + Intergenic
1120647673 14:87092855-87092877 CCCCAGCCCCTGAATCTACACGG - Intergenic
1120781055 14:88486077-88486099 CATCATCGCCTGGACCCACAAGG + Intronic
1121859539 14:97303693-97303715 CACCATCGCCTGTATACACATGG + Intergenic
1122743615 14:103885665-103885687 CACCCTCGCCTGCAGCCCCAAGG + Intergenic
1122788677 14:104175427-104175449 CACCAGAGGCTGCATCCCCCAGG + Exonic
1123016834 14:105379793-105379815 CCACAGCGCCCGCAGCCACAAGG + Exonic
1125525131 15:40369735-40369757 CACCAGCCCCTGCCTCCCCAAGG + Exonic
1128516189 15:68343594-68343616 CACCAGCGACTACCTCCACCTGG - Intronic
1128547772 15:68579310-68579332 CGCCGGCGCCTGCATCCCCCGGG + Intronic
1129725218 15:77898177-77898199 CTCCAGCTGCAGCATCCACATGG - Intergenic
1130199123 15:81808848-81808870 CACCAGAACTTGCATCCTCAGGG - Intergenic
1132093134 15:98961692-98961714 CACCAGCTCCTGCTGCCTCAGGG - Exonic
1132866619 16:2096224-2096246 CCACAGGGCCTGCATGCACAGGG - Intronic
1133700283 16:8302277-8302299 TACCAGCGCCTTCTCCCACAAGG + Intergenic
1135004700 16:18809355-18809377 CACCATGGCCTGCAACCCCAGGG - Exonic
1135426006 16:22336166-22336188 AACCAGAGCCTGAGTCCACAAGG - Intergenic
1136069535 16:27779457-27779479 CCCCAACACCTGCATCCAGAGGG - Exonic
1138436125 16:57001030-57001052 CACCTGAGCCTGGATGCACAGGG - Intronic
1138505327 16:57475618-57475640 CACCTGGGACAGCATCCACAAGG + Exonic
1138549386 16:57739307-57739329 CACCAGACCCTGGAGCCACAAGG - Intronic
1138657717 16:58500582-58500604 CACTAGCGCCCGGGTCCACACGG - Intronic
1139513084 16:67438249-67438271 CATCAGCGGCTGTAACCACAGGG + Exonic
1139659336 16:68410195-68410217 CACCAGCCCCAGCACCCACGGGG - Intronic
1139750652 16:69107203-69107225 CACCAGCGCCTGATTGCACGTGG + Intronic
1140959706 16:79900154-79900176 CAACAGAGCCTGCACCCACCAGG + Intergenic
1141051449 16:80768491-80768513 CACCAGACCCTGAATCCACTGGG - Intronic
1141611359 16:85182813-85182835 CTCCTGCCCCAGCATCCACAGGG + Intronic
1141896774 16:86963396-86963418 CTCCAGCGTCCGCATCCCCAGGG - Intergenic
1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG + Intronic
1142080395 16:88146041-88146063 CAACACCGCCTCCCTCCACACGG + Intergenic
1142849745 17:2698630-2698652 CACAAGAGCCTGCATCCACCTGG + Intronic
1142991617 17:3734937-3734959 CACCAACTCCTGCCTGCACAGGG + Exonic
1143321545 17:6071763-6071785 CCCCAGCACCTGCAGCCACCAGG - Intronic
1143871375 17:9959327-9959349 CCCCAGCGCCTCCACCCTCAGGG - Intronic
1147995829 17:44359886-44359908 CACCTGCCCCTGCACTCACAGGG + Exonic
1148978283 17:51548533-51548555 CACCCGTGCCTGCAGCCCCAGGG + Intergenic
1151213032 17:72559047-72559069 CAGCAGCATCTGCATCAACAGGG + Intergenic
1152112836 17:78366528-78366550 CACCAGCTCCTGCCTCTCCAAGG - Intergenic
1153540690 18:6150993-6151015 CAGCAGCGCCAGGCTCCACAAGG + Intronic
1154172137 18:12060142-12060164 CACCAGGGCTTGCATCTGCATGG + Intergenic
1159746867 18:72247267-72247289 CACCAGAGCCTGCATCTCCCTGG - Intergenic
1159937690 18:74382109-74382131 GACCAGGGCCTCCATCCGCACGG + Intergenic
1160121052 18:76130791-76130813 CAGGAGCACCTGCAGCCACAGGG + Intergenic
1160980888 19:1816107-1816129 CGCCGGCGCCTGCATGCACCTGG - Exonic
1161130139 19:2583514-2583536 CCCCAGCACCTGCACCAACAAGG - Intronic
1161130589 19:2586289-2586311 CCCCAGCACCTGCACCAACAAGG - Intronic
1162341036 19:10091727-10091749 CAGCAGCCACTGCTTCCACATGG + Intronic
1163199767 19:15758475-15758497 CACCATTGCCTGCATCAACTTGG - Intergenic
1165080143 19:33302204-33302226 CATCAGCGCCTACATCGACCCGG - Exonic
1165352250 19:35282152-35282174 CCCCATCGCCTACATGCACACGG - Intronic
1165382295 19:35489939-35489961 AACCCAGGCCTGCATCCACATGG - Intronic
1165488855 19:36111634-36111656 CACCAGGGCCGGCAGCCACAGGG + Intronic
1165819508 19:38665667-38665689 CCCCAGCCCCTGCATCCATCTGG + Intronic
1166001382 19:39879575-39879597 CACCAACATCTCCATCCACAAGG - Exonic
1166004165 19:39895826-39895848 CACCAACATCTCCATCCACAAGG - Exonic
1166506201 19:43373159-43373181 CACCAGCGCCTTCATCCTTGGGG + Intergenic
925186724 2:1852026-1852048 CAGCAGAGCCAGCAACCACAGGG + Intronic
927706035 2:25297105-25297127 GACCAGCACCTGCGACCACAAGG + Intronic
928266452 2:29816034-29816056 TACCAGCGCCTCCAACCCCAAGG - Intronic
932189725 2:69730620-69730642 CACCTGGGCCTGCCTCCACATGG + Intronic
935291381 2:101613577-101613599 CACCATCCCCAGCATCCACATGG + Intergenic
937986455 2:127640267-127640289 CACCATCGCCTTCAATCACATGG + Exonic
942302044 2:174571967-174571989 CAACAGGCCCTCCATCCACAGGG - Exonic
944069958 2:195657412-195657434 CCCCAGCGCCCGCATCCCCGAGG - Intronic
944920141 2:204404163-204404185 CACCATCTCCTGCATCCAGAAGG - Intergenic
948234025 2:236373945-236373967 CCCCAGTGCCTTCCTCCACAGGG - Intronic
948500639 2:238390836-238390858 TACCAGCCCCTGGAACCACAAGG + Intronic
948871020 2:240798129-240798151 CACCAGCGCCTGCATCCACAGGG - Intronic
1170035585 20:11986228-11986250 CTCCAGCGACTTCATCCTCAGGG + Intergenic
1172375747 20:34438498-34438520 CACCAGCTCCTGCATCTTCAGGG - Exonic
1173836630 20:46130283-46130305 CAGTAGCTCCTGCAGCCACAGGG - Intergenic
1174476885 20:50801969-50801991 CACCAGGGCCTGGGTCCCCAGGG + Intronic
1174503879 20:51004480-51004502 CCCCAGCGTCTGCAGCCCCAGGG + Exonic
1175490470 20:59377242-59377264 CACCCCCGGCTGCTTCCACAAGG + Intergenic
1175723124 20:61299624-61299646 AAGCAGCTCCTCCATCCACAAGG - Intronic
1175749232 20:61483724-61483746 CTCCAGGGCATGCATCCACTAGG - Intronic
1175992818 20:62797851-62797873 CACCACCTCCTGCTGCCACAGGG - Intronic
1176144844 20:63560994-63561016 CACCCGCGTCTGCACACACAGGG + Intronic
1176145428 20:63563323-63563345 CTCCAGCAGCTGCTTCCACAGGG + Exonic
1179249633 21:39662054-39662076 CCCCAGCTCCTTCATTCACAGGG + Exonic
1181313163 22:21956385-21956407 CACCAGCACCTGGCACCACACGG + Intergenic
1181346269 22:22222457-22222479 CACCAGCACCTGGCACCACAGGG + Intergenic
1183723232 22:39574299-39574321 CAGCAGCGGCTGCAGCCACCGGG - Intronic
1185414269 22:50701158-50701180 CACCAGCCCCTGCACGCACAGGG - Intergenic
950721881 3:14889064-14889086 CACCAGCTCCTGCAGGGACATGG + Intronic
954704433 3:52471665-52471687 CAGCAGCTCCTGCATGCCCAGGG + Intronic
958147983 3:89652077-89652099 CACCACCCCCTGCACCCAGATGG + Intergenic
965659740 3:171028814-171028836 CACCAGTGCCTGCAATCACCCGG + Intergenic
968512656 4:1002462-1002484 CAGCAGCGCCAGCAGCCCCATGG - Exonic
968603821 4:1522236-1522258 GACCAGGCCCTGCATCCTCACGG + Intergenic
968631042 4:1651693-1651715 GACCAGCGCTTGCATGGACAGGG + Intronic
969252212 4:5975441-5975463 CAGCAGCCCCTGCTTGCACATGG - Intronic
969688586 4:8690718-8690740 CAAGAGCACCTGCAGCCACACGG - Intergenic
975647007 4:76555467-76555489 CCCCAGCGCTTGCAGCCAGAGGG - Intronic
981645166 4:146991054-146991076 CACCAGTGGCTGCAGCAACAAGG + Intergenic
986307279 5:6525071-6525093 GGCCAGCGCCTGCACCCACTTGG - Intergenic
988918944 5:35922984-35923006 CACCAGTTCCTGCTTCCATAGGG - Intronic
989640271 5:43577389-43577411 CACCAGCCATTGCATACACAAGG + Intergenic
995833538 5:116378557-116378579 CACCACCACCTGCTTCCCCAAGG - Intronic
996110746 5:119563622-119563644 CCCCAGCCCCAGCATCCACTCGG + Intronic
999708906 5:154298932-154298954 AAGCAGCGCCAGCATCCCCAGGG - Intronic
1000541793 5:162549990-162550012 CACCAGCCACTGCATCCAGCAGG - Intergenic
1002297833 5:178241268-178241290 CACCAGTGCCTGAAACCACTGGG + Intronic
1002930986 6:1634894-1634916 CACCACCGCCTCCAACCCCAGGG - Intronic
1003569886 6:7248779-7248801 CACCAAGGACTGCAGCCACAGGG + Exonic
1004484938 6:16057556-16057578 CACCATCCCCTTCTTCCACACGG + Intergenic
1005157175 6:22819955-22819977 CTCCAGCGCCTGCACACAGAGGG - Intergenic
1006581260 6:35079070-35079092 CACCAGCTCCTGGCTCCCCAGGG - Intronic
1007260579 6:40560224-40560246 CACCAACGCCTGCACCCATCAGG + Intronic
1007637185 6:43306563-43306585 CACCAGCACCTGCCTGCATATGG + Intronic
1016993432 6:149944894-149944916 AACCAGCACCAGCATCCACAGGG + Intronic
1017004901 6:150022636-150022658 AACCAGCACCAGCATCCACAGGG - Intronic
1018906910 6:168080791-168080813 CACCAGCACCTGCACACACGTGG - Intronic
1019618839 7:1979654-1979676 CCCCAGCTCCTGCTTGCACACGG - Intronic
1019748793 7:2715971-2715993 CAGAAGCCCCTGCATTCACAAGG + Exonic
1019915752 7:4131212-4131234 CACCAGCGCCTGCTTCAGGAGGG - Intronic
1022970630 7:35513730-35513752 CACCAGATTCTGCATCAACATGG + Intergenic
1023079052 7:36510820-36510842 CACCAGGGCCTGAACCCAAAAGG + Intergenic
1023923877 7:44650933-44650955 AAACTGTGCCTGCATCCACAGGG - Intronic
1024253240 7:47521800-47521822 AACCTGTGCCTGCATCCTCATGG - Intronic
1027054899 7:75043152-75043174 CACCAGCGCCTGTCTCCTCCGGG - Intronic
1031381657 7:121093574-121093596 CTCCACAGACTGCATCCACAGGG + Intronic
1034522391 7:151631106-151631128 CACAAGGGACAGCATCCACATGG + Intronic
1035250995 7:157596731-157596753 CACAAGCGGCTGCCTCCCCAAGG - Intronic
1035345307 7:158193383-158193405 CACCAGCTTGTGCAGCCACACGG + Intronic
1039839070 8:41280692-41280714 CAGCAGCTCCTGCAGCCACAGGG - Intronic
1043585164 8:81760349-81760371 CCCCAGCCCCTGCCTACACAGGG + Intergenic
1048163024 8:132038319-132038341 CTCCAGCGCCTGCAGCAAAAGGG - Intronic
1049615661 8:143574868-143574890 CACCAGGGCCTGCAGCCTCTCGG + Exonic
1049713869 8:144080385-144080407 CACCAGCTGCTTCCTCCACATGG - Exonic
1054815104 9:69467009-69467031 CACCAGCACCTGGAACCACTGGG - Intronic
1056113994 9:83424128-83424150 CACGACCGTCTGCATCCACCTGG - Intronic
1057042615 9:91858280-91858302 CACACACGCATGCATCCACACGG + Intronic
1061022658 9:128026330-128026352 CAGCAGCTCCTGCCTGCACATGG - Intergenic
1061326533 9:129867978-129868000 AACCAGGGGCTGCATCAACAGGG - Intronic
1061507388 9:131039162-131039184 CACCTGCGCCTGCAAGCCCACGG + Exonic
1062395347 9:136350512-136350534 CCCCGGCCCCTGCACCCACAAGG - Intronic
1062521891 9:136961399-136961421 CACCAGGGCCTGCAGGGACAGGG + Intergenic
1190164578 X:48062487-48062509 CACCTGCCCCTGCCTCCCCAAGG - Intronic
1190691013 X:52913255-52913277 CACTAGTGCATGCACCCACAGGG - Intergenic
1190694970 X:52942537-52942559 CACTAGTGCATGCACCCACAGGG + Intronic
1195304112 X:103562346-103562368 CAGCAGAGGCTCCATCCACAGGG + Intergenic
1200105244 X:153708472-153708494 CCCCAGCCCCTGCATACACATGG + Intronic