ID: 948871077

View in Genome Browser
Species Human (GRCh38)
Location 2:240798508-240798530
Sequence GGTAAAGGCCAGGCCGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 130}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948871077_948871084 1 Left 948871077 2:240798508-240798530 CCAGCTTCGGCCTGGCCTTTACC 0: 1
1: 0
2: 0
3: 6
4: 130
Right 948871084 2:240798532-240798554 CAGCTGTGTGACAGCTTCCTGGG 0: 1
1: 0
2: 4
3: 29
4: 242
948871077_948871083 0 Left 948871077 2:240798508-240798530 CCAGCTTCGGCCTGGCCTTTACC 0: 1
1: 0
2: 0
3: 6
4: 130
Right 948871083 2:240798531-240798553 CCAGCTGTGTGACAGCTTCCTGG 0: 1
1: 0
2: 1
3: 26
4: 256
948871077_948871090 30 Left 948871077 2:240798508-240798530 CCAGCTTCGGCCTGGCCTTTACC 0: 1
1: 0
2: 0
3: 6
4: 130
Right 948871090 2:240798561-240798583 TTTACCGTCTGTGAAATGACGGG 0: 1
1: 1
2: 0
3: 12
4: 169
948871077_948871089 29 Left 948871077 2:240798508-240798530 CCAGCTTCGGCCTGGCCTTTACC 0: 1
1: 0
2: 0
3: 6
4: 130
Right 948871089 2:240798560-240798582 GTTTACCGTCTGTGAAATGACGG 0: 1
1: 0
2: 1
3: 32
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948871077 Original CRISPR GGTAAAGGCCAGGCCGAAGC TGG (reversed) Intronic
900288890 1:1915499-1915521 GGGGAAGCCCAGGCCAAAGCGGG + Intronic
901055326 1:6446483-6446505 GGAAAGGGCCAGGCCTGAGCTGG + Intronic
902479038 1:16702106-16702128 GGAAAGGGCCAGGCCTGAGCTGG - Intergenic
903730141 1:25487567-25487589 GGCAATGGCCAGTCCAAAGCTGG - Intronic
904334164 1:29786274-29786296 GCCCAAGGCCAGGCTGAAGCAGG - Intergenic
916102680 1:161406357-161406379 GGTCATGGCTAGGCCAAAGCTGG + Intergenic
917798921 1:178552862-178552884 GGCAAAGGCCTGACTGAAGCAGG + Intergenic
921291453 1:213661528-213661550 GGTAAAGGTCAGTCTGAATCAGG + Intergenic
922076732 1:222252786-222252808 GGTGAGGACCAGGCCGCAGCAGG + Intergenic
922942553 1:229480340-229480362 GTGAAAGGCCAGGGTGAAGCTGG + Intronic
1064063955 10:12164407-12164429 GTTAAAGAACAGGCCGAAGTTGG + Exonic
1065973597 10:30823937-30823959 GGGAAAGGCCAGGGTGAAACAGG - Intronic
1067762586 10:49059194-49059216 GGTCAAGGCCTGGCCCTAGCAGG + Intronic
1069781855 10:70961861-70961883 GGTCAAGACCAGCCCCAAGCTGG - Intergenic
1070286299 10:75086301-75086323 GGGAAAGACTAGGCCGAGGCGGG - Intergenic
1072513541 10:96153089-96153111 GTTAAAGGCCTGGCTAAAGCAGG + Intronic
1073062604 10:100741497-100741519 GGGAAAGGCCGGGCAGGAGCCGG + Intronic
1076666958 10:132098711-132098733 GGTAAAGACCAGGCCCAGGATGG - Intergenic
1077159990 11:1108311-1108333 GGAAAAGGGCAGGCTGAAGGAGG - Intergenic
1077394987 11:2316290-2316312 CGTGAGGGCCAGGCCGATGCTGG - Exonic
1079375038 11:19884719-19884741 GATTAGGGCCAGGACGAAGCAGG - Intronic
1082774666 11:57236042-57236064 GGTGCAGGCCTGGCGGAAGCGGG + Exonic
1083966657 11:66047751-66047773 TGTAAGGGGCAGGCCGAAGCAGG - Intronic
1084152587 11:67297483-67297505 GGTAAAGGCCAGGCCAGGCCCGG - Intronic
1084192900 11:67506871-67506893 GATGAAGGCCAGGGAGAAGCGGG + Exonic
1084524427 11:69686881-69686903 GGGACAGCCCAGGCCCAAGCAGG - Intergenic
1084641484 11:70429175-70429197 GGAAGAGGCCAGGAGGAAGCTGG + Exonic
1085392344 11:76188940-76188962 GGGAGAGGCCAGGCCTGAGCCGG + Intronic
1085458334 11:76678333-76678355 AGAAAACGCCAGGCCGAAGAGGG - Intergenic
1087622889 11:100563007-100563029 GGAAAAAGCCAGGCCGAGGTGGG - Intergenic
1088022751 11:105139520-105139542 GATAAAGGCCAGGAAGAATCTGG - Intronic
1089390723 11:118099817-118099839 GGTGAAGGCCAAGCTGAAGGGGG - Intronic
1091274115 11:134338537-134338559 GGTACAGGGCAGGCCCCAGCAGG - Intronic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1099861721 12:88231073-88231095 GGTAAAGGCTAGGCCTAGGTAGG - Intergenic
1103789277 12:123458124-123458146 TGTAAAGGTCAGGCCGAGGCCGG + Intronic
1104581432 12:130013999-130014021 GGTCAAGGTCAAGCCAAAGCAGG + Intergenic
1105452472 13:20512282-20512304 GGTAAAGGCCAGGCCTACAGTGG - Intronic
1105944072 13:25175016-25175038 GTTACAGGCGAGGCAGAAGCAGG - Intergenic
1107146976 13:37070062-37070084 GGGAGAGGCCAGGCAGGAGCAGG - Intergenic
1117890623 14:60417941-60417963 GATAATGGACATGCCGAAGCAGG - Intronic
1119775969 14:77248988-77249010 GGTCAGGGCCAGGGCCAAGCTGG + Intronic
1119986348 14:79142437-79142459 AGTAAAGGGCAGACAGAAGCTGG + Intronic
1126052134 15:44695597-44695619 GGAAAAGGCCAGCCGGCAGCCGG - Intronic
1127390939 15:58504576-58504598 GGAGAAGGCCAGGTCGATGCTGG - Intronic
1127594403 15:60464619-60464641 TGTAAAGGCCAGTCCGCAGGTGG + Intronic
1129924857 15:79354966-79354988 AGCAAAGGCCAGGACGAATCAGG + Intronic
1132157083 15:99503155-99503177 GGGAAGGGCAAGGCCGAATCGGG + Intergenic
1132837907 16:1963806-1963828 GGTCATGGCTAGGCCAAAGCTGG - Intronic
1132857524 16:2053452-2053474 GGTAAGGCCCAGGGCGACGCTGG + Exonic
1132894779 16:2223656-2223678 GCAGAAGCCCAGGCCGAAGCCGG + Exonic
1133106137 16:3510913-3510935 GGGAAAGCCCAGGCTGGAGCTGG + Intronic
1135644868 16:24152942-24152964 GACAAAGGCCAGGCAGATGCAGG - Intronic
1135951689 16:26920161-26920183 GGTAAAGGGCAGGAAGAAGGTGG + Intergenic
1136288828 16:29259612-29259634 CGCAAAGGCCAGGCCTAATCAGG - Intergenic
1136392997 16:29977249-29977271 GGAAATGGCCAGGCCGGAGGCGG - Intronic
1137744936 16:50813460-50813482 GGTAAAGGAAAGGAAGAAGCAGG + Intergenic
1141764305 16:86048480-86048502 GGCAGAGGCCAGGCCGGGGCAGG - Intergenic
1142404629 16:89880920-89880942 AGCAAAGGCCAGGCAGAAGGAGG + Intronic
1144435791 17:15239435-15239457 GGTAAAGTCCATGTGGAAGCGGG - Intronic
1149539925 17:57461149-57461171 GGTCAAGGGCAGGGAGAAGCCGG - Intronic
1151577953 17:74962344-74962366 GGGACAGGCCAGGAAGAAGCCGG + Intronic
1152011542 17:77721889-77721911 GGGAAGGGCCAGCCCCAAGCTGG + Intergenic
1152545688 17:80999108-80999130 TGTCAAGGCCAGGCCCAGGCAGG + Exonic
1155344249 18:24843054-24843076 GCGAAAGGCCAAGCAGAAGCAGG + Intergenic
1156399237 18:36725662-36725684 GGAAAAGGCCAGGGGAAAGCAGG - Intronic
1160412331 18:78683474-78683496 AGGAAAGGCCAGGCAGCAGCAGG + Intergenic
1160455375 18:78995422-78995444 GGTGAAGGCCCGGCCGCAGATGG - Exonic
1160594417 18:79964234-79964256 GCTACTGGCCAGGCCGAGGCAGG + Intergenic
1161473917 19:4474068-4474090 GGTACAGGCCAGCGGGAAGCAGG + Intronic
1165136223 19:33671382-33671404 GGAAGAGGCCAGGCAGAAACAGG - Intronic
1165386674 19:35514085-35514107 GAGAAAGGCCAGGCCGAGGACGG - Intergenic
1166529866 19:43535596-43535618 GCCAAAGGCCTGGCCGCAGCTGG - Exonic
1202713079 1_KI270714v1_random:28013-28035 GGAAAGGGCCAGGCCTGAGCTGG - Intergenic
925890495 2:8430390-8430412 GGAAAAGGCCAGGCCGCAGTGGG + Intergenic
926141018 2:10368470-10368492 ATTAAAAGCCAGGCCGGAGCTGG - Intronic
934257925 2:91443150-91443172 GGAAAAGGCCAGGGCGACGGGGG - Intergenic
935626212 2:105174265-105174287 GGAAAAGGCAAGGCTGAAACTGG + Intergenic
935687613 2:105698102-105698124 GGTTAAGGCCAGGAGGAAGCAGG - Intergenic
939960565 2:148561662-148561684 GGTAAGGGGCAGCCCGAAGTGGG + Intergenic
945791385 2:214309855-214309877 GGTAGAGGCAAGGCAGCAGCTGG + Intronic
948223401 2:236290841-236290863 GGCAAAAGCCCGGCAGAAGCAGG + Intergenic
948871077 2:240798508-240798530 GGTAAAGGCCAGGCCGAAGCTGG - Intronic
1169342808 20:4809455-4809477 GCTGAAGGGCAGGCCGAAGTGGG - Intronic
1170506392 20:17030138-17030160 GGAAGAAGCCAGGCCGAAGTAGG + Intergenic
1174502115 20:50992874-50992896 GCCAAAGGCAGGGCCGAAGCCGG - Intergenic
1175810714 20:61855940-61855962 TGCAAAGGCCAGGACGGAGCTGG + Intronic
1176038675 20:63052829-63052851 TGCAAAGGCCAGGCTGAGGCCGG - Intergenic
1177057524 21:16326414-16326436 GGGAAAGGGCAGCCCGAGGCAGG + Intergenic
1180143489 21:45907041-45907063 GCTGAAGGCCAGGCGGAGGCCGG + Intronic
1180633065 22:17243286-17243308 GGTAAAAGCCAGTCCGAGGCTGG + Intergenic
1182485296 22:30635553-30635575 GGGAAATGCCAGGCCGATGGGGG + Intergenic
1182571421 22:31241678-31241700 GGTATGGGCCAGGCCTATGCTGG - Intronic
1183566023 22:38615979-38616001 GGGAGAGGCCAGGGCGAAGGTGG + Intronic
1185226809 22:49658036-49658058 GGTAGAGGCCAGGGTGAGGCTGG - Intergenic
951866857 3:27318134-27318156 GGTAAAGGCCAGTCCACAGAGGG - Intronic
976235351 4:82891015-82891037 GGTAGAGCCCAGGCCAAAACTGG - Intronic
978400671 4:108326928-108326950 GGTAAGTGCCAGGCAGAAGAAGG - Intergenic
980953558 4:139406160-139406182 GGTAAAACCCAGGCCGAATTTGG + Intronic
986606723 5:9530036-9530058 GGCAAAGGCAAGGCAGAGGCTGG + Intronic
994205003 5:97024787-97024809 GTTACAGGCCAGGCCTAAGTTGG + Intronic
998164769 5:139836742-139836764 GGGAAAGGCCATGACGATGCGGG + Intronic
999885712 5:155920659-155920681 TATAAAGGCCAGGCCCAAGAAGG - Intronic
1000585373 5:163090992-163091014 GTGAAAGGCAAGGCAGAAGCAGG + Intergenic
1011157492 6:84349095-84349117 GGGAAAGGCCAGGAAGAAGGGGG + Intergenic
1016593052 6:145766944-145766966 CATAGAGGGCAGGCCGAAGCAGG - Intergenic
1017920743 6:158869907-158869929 GGTACACGTCAGGCAGAAGCAGG - Intergenic
1019339585 7:502588-502610 GGCAAAGTCCAGTCCGAAGAGGG - Intronic
1020617445 7:10476936-10476958 GATGAAGGCCAGGGAGAAGCGGG - Intergenic
1022040359 7:26575541-26575563 GAAAAAGACCAGGCCGAGGCAGG - Intergenic
1026765449 7:73156883-73156905 GGCAGAGGGCAGGCAGAAGCAGG - Intergenic
1027041923 7:74966577-74966599 GGCAGAGGGCAGGCAGAAGCAGG - Intronic
1027081719 7:75235778-75235800 GGCAGAGGGCAGGCAGAAGCAGG + Intergenic
1029390307 7:100270359-100270381 GGCAGAGGGCAGGCAGAAGCAGG + Intronic
1032011609 7:128351314-128351336 GGAAGAGGCCAGGCGCAAGCAGG + Exonic
1035286405 7:157809997-157810019 GGGAACCGCCAGGCCGGAGCTGG + Intronic
1035305945 7:157931390-157931412 GGGAAAGGGCAGGCCCAATCAGG + Intronic
1039473842 8:37829119-37829141 GGTTGGGGCCAGGCCGCAGCTGG - Intronic
1045246494 8:100445794-100445816 GGTGGAGGCCTGGCTGAAGCAGG + Intergenic
1047238162 8:123060739-123060761 GCTAAAGGTCAGGACAAAGCTGG - Intronic
1047594724 8:126366569-126366591 GGGAAAGGCCAGAGCAAAGCAGG - Intergenic
1053753706 9:41280869-41280891 GATGAAGGCCAGGGAGAAGCAGG - Intergenic
1054259229 9:62845229-62845251 GATGAAGGCCAGGGAGAAGCAGG - Intergenic
1054332550 9:63774808-63774830 GATGAAGGCCAGGGAGAAGCAGG + Intergenic
1057279232 9:93698349-93698371 GGTAAAGGCCAGCCGGGAGGGGG - Intergenic
1058899612 9:109430832-109430854 GGGACAGGCCAGGCTGGAGCTGG - Intronic
1059392419 9:114007540-114007562 GAAAAAGGCCAGGCAGTAGCTGG + Intronic
1062476922 9:136732858-136732880 GGTCAAGGCCTGGGCGAAGCTGG + Intergenic
1202799557 9_KI270719v1_random:163119-163141 GATGAAGGCCAGGGAGAAGCAGG + Intergenic
1195202873 X:102566579-102566601 GGTAATGGTCAGGGAGAAGCAGG - Intergenic
1195869805 X:109474140-109474162 ATTATAGGCCAGGCCTAAGCTGG + Intronic
1198167798 X:134074421-134074443 GGTACATGCCAGGCAGAGGCAGG + Intergenic
1198676473 X:139136609-139136631 GGTAAAGTCCAGGAAGAACCAGG + Intronic
1199777709 X:151030153-151030175 GCTAAATGCCAGGTGGAAGCGGG - Intergenic
1200047088 X:153408920-153408942 GGGGAAGGCCAGGCCAAAGGGGG - Intergenic
1200073841 X:153541698-153541720 GATGAGGGCGAGGCCGAAGCTGG + Exonic
1200089050 X:153625877-153625899 GGAAAAGACCAGGCCAAAGGGGG + Intergenic