ID: 948875324

View in Genome Browser
Species Human (GRCh38)
Location 2:240823888-240823910
Sequence GAGAGAAAAACATGCTCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948875324_948875328 -2 Left 948875324 2:240823888-240823910 CCCGGGGAGCATGTTTTTCTCTC No data
Right 948875328 2:240823909-240823931 TCCAGCTGGCCATATTCCTTGGG No data
948875324_948875332 14 Left 948875324 2:240823888-240823910 CCCGGGGAGCATGTTTTTCTCTC No data
Right 948875332 2:240823925-240823947 CCTTGGGCGTCGAGTGACTCTGG No data
948875324_948875327 -3 Left 948875324 2:240823888-240823910 CCCGGGGAGCATGTTTTTCTCTC No data
Right 948875327 2:240823908-240823930 CTCCAGCTGGCCATATTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948875324 Original CRISPR GAGAGAAAAACATGCTCCCC GGG (reversed) Intergenic
No off target data available for this crispr