ID: 948875325

View in Genome Browser
Species Human (GRCh38)
Location 2:240823889-240823911
Sequence GGAGAGAAAAACATGCTCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948875325_948875328 -3 Left 948875325 2:240823889-240823911 CCGGGGAGCATGTTTTTCTCTCC No data
Right 948875328 2:240823909-240823931 TCCAGCTGGCCATATTCCTTGGG No data
948875325_948875327 -4 Left 948875325 2:240823889-240823911 CCGGGGAGCATGTTTTTCTCTCC No data
Right 948875327 2:240823908-240823930 CTCCAGCTGGCCATATTCCTTGG No data
948875325_948875332 13 Left 948875325 2:240823889-240823911 CCGGGGAGCATGTTTTTCTCTCC No data
Right 948875332 2:240823925-240823947 CCTTGGGCGTCGAGTGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948875325 Original CRISPR GGAGAGAAAAACATGCTCCC CGG (reversed) Intergenic
No off target data available for this crispr