ID: 948875329

View in Genome Browser
Species Human (GRCh38)
Location 2:240823910-240823932
Sequence GCCCAAGGAATATGGCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948875329_948875336 17 Left 948875329 2:240823910-240823932 CCAGCTGGCCATATTCCTTGGGC No data
Right 948875336 2:240823950-240823972 TGTGAGCGCCCAGTGGTGTCGGG No data
948875329_948875335 16 Left 948875329 2:240823910-240823932 CCAGCTGGCCATATTCCTTGGGC No data
Right 948875335 2:240823949-240823971 CTGTGAGCGCCCAGTGGTGTCGG No data
948875329_948875333 10 Left 948875329 2:240823910-240823932 CCAGCTGGCCATATTCCTTGGGC No data
Right 948875333 2:240823943-240823965 TCTGGCCTGTGAGCGCCCAGTGG No data
948875329_948875332 -8 Left 948875329 2:240823910-240823932 CCAGCTGGCCATATTCCTTGGGC No data
Right 948875332 2:240823925-240823947 CCTTGGGCGTCGAGTGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948875329 Original CRISPR GCCCAAGGAATATGGCCAGC TGG (reversed) Intergenic
No off target data available for this crispr