ID: 948875332

View in Genome Browser
Species Human (GRCh38)
Location 2:240823925-240823947
Sequence CCTTGGGCGTCGAGTGACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948875325_948875332 13 Left 948875325 2:240823889-240823911 CCGGGGAGCATGTTTTTCTCTCC No data
Right 948875332 2:240823925-240823947 CCTTGGGCGTCGAGTGACTCTGG No data
948875324_948875332 14 Left 948875324 2:240823888-240823910 CCCGGGGAGCATGTTTTTCTCTC No data
Right 948875332 2:240823925-240823947 CCTTGGGCGTCGAGTGACTCTGG No data
948875323_948875332 15 Left 948875323 2:240823887-240823909 CCCCGGGGAGCATGTTTTTCTCT No data
Right 948875332 2:240823925-240823947 CCTTGGGCGTCGAGTGACTCTGG No data
948875329_948875332 -8 Left 948875329 2:240823910-240823932 CCAGCTGGCCATATTCCTTGGGC No data
Right 948875332 2:240823925-240823947 CCTTGGGCGTCGAGTGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948875332 Original CRISPR CCTTGGGCGTCGAGTGACTC TGG Intergenic
No off target data available for this crispr