ID: 948875333

View in Genome Browser
Species Human (GRCh38)
Location 2:240823943-240823965
Sequence TCTGGCCTGTGAGCGCCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948875330_948875333 2 Left 948875330 2:240823918-240823940 CCATATTCCTTGGGCGTCGAGTG No data
Right 948875333 2:240823943-240823965 TCTGGCCTGTGAGCGCCCAGTGG No data
948875329_948875333 10 Left 948875329 2:240823910-240823932 CCAGCTGGCCATATTCCTTGGGC No data
Right 948875333 2:240823943-240823965 TCTGGCCTGTGAGCGCCCAGTGG No data
948875331_948875333 -5 Left 948875331 2:240823925-240823947 CCTTGGGCGTCGAGTGACTCTGG No data
Right 948875333 2:240823943-240823965 TCTGGCCTGTGAGCGCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948875333 Original CRISPR TCTGGCCTGTGAGCGCCCAG TGG Intergenic
No off target data available for this crispr