ID: 948875335

View in Genome Browser
Species Human (GRCh38)
Location 2:240823949-240823971
Sequence CTGTGAGCGCCCAGTGGTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
948875330_948875335 8 Left 948875330 2:240823918-240823940 CCATATTCCTTGGGCGTCGAGTG No data
Right 948875335 2:240823949-240823971 CTGTGAGCGCCCAGTGGTGTCGG No data
948875331_948875335 1 Left 948875331 2:240823925-240823947 CCTTGGGCGTCGAGTGACTCTGG No data
Right 948875335 2:240823949-240823971 CTGTGAGCGCCCAGTGGTGTCGG No data
948875329_948875335 16 Left 948875329 2:240823910-240823932 CCAGCTGGCCATATTCCTTGGGC No data
Right 948875335 2:240823949-240823971 CTGTGAGCGCCCAGTGGTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
948875335 Original CRISPR CTGTGAGCGCCCAGTGGTGT CGG Intergenic
No off target data available for this crispr